FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1874198492> ?p ?o ?g. }

• W1874198492 endingPage "1109" @default.
• W1874198492 startingPage "1104" @default.
• W1874198492 abstract "Article4 February 2011free access Lgr5 intestinal stem cells have high telomerase activity and randomly segregate their chromosomes Arnout G Schepers Arnout G Schepers Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands University Medical Centre Utrecht, Utrecht, The Netherlands Search for more papers by this author Robert Vries Robert Vries Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands University Medical Centre Utrecht, Utrecht, The Netherlands Search for more papers by this author Maaike van den Born Maaike van den Born Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands University Medical Centre Utrecht, Utrecht, The Netherlands Search for more papers by this author Marc van de Wetering Marc van de Wetering Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands University Medical Centre Utrecht, Utrecht, The Netherlands Search for more papers by this author Hans Clevers Corresponding Author Hans Clevers Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands University Medical Centre Utrecht, Utrecht, The Netherlands Search for more papers by this author Arnout G Schepers Arnout G Schepers Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands University Medical Centre Utrecht, Utrecht, The Netherlands Search for more papers by this author Robert Vries Robert Vries Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands University Medical Centre Utrecht, Utrecht, The Netherlands Search for more papers by this author Maaike van den Born Maaike van den Born Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands University Medical Centre Utrecht, Utrecht, The Netherlands Search for more papers by this author Marc van de Wetering Marc van de Wetering Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands University Medical Centre Utrecht, Utrecht, The Netherlands Search for more papers by this author Hans Clevers Corresponding Author Hans Clevers Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands University Medical Centre Utrecht, Utrecht, The Netherlands Search for more papers by this author Author Information Arnout G Schepers1,2, Robert Vries1,2, Maaike van den Born1,2, Marc van de Wetering1,2 and Hans Clevers 1,2 1Hubrecht Institute for Developmental Biology and Stem Cell Research, Utrecht, The Netherlands 2University Medical Centre Utrecht, Utrecht, The Netherlands *Corresponding author. Hubrecht Institute for Developmental Biology and Stem Cell Research, Uppsalalaan 8, 3584 Utrecht, The Netherlands. Tel.: +31 030 212 1800; Fax.: +31 030 251 6464; E-mail: [email protected] The EMBO Journal (2011)30:1104-1109https://doi.org/10.1038/emboj.2011.26 There is a Have you seen? (March 2011) associated with this Article. PDFDownload PDF of article text and main figures. Peer ReviewDownload a summary of the editorial decision process including editorial decision letters, reviewer comments and author responses to feedback. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Somatic cells have been proposed to be limited in the number of cell divisions they can undergo. This is thought to be a mechanism by which stem cells retain their integrity preventing disease. However, we have recently discovered intestinal crypt stem cells that persist for the lifetime of a mouse, yet divide every day. We now demonstrate biochemically that primary isolated Lgr5+ve stem cells contain significant telomerase activity. Telomerase activity rapidly decreases in the undifferentiated progeny of these stem cells and is entirely lost in differentiated villus cells. Conversely, asymmetric segregation of chromosomes has been proposed as a mechanism for stem cells to protect their genomes against damage. We determined the average cell cycle length of Lgr5+ve stem cells at 21.5 h and find that Lgr5+ve intestinal stem cells randomly segregate newly synthesized DNA strands, opposing the ‘immortal strand’ hypothesis. Introduction The intestinal epithelium provides an attractive system to study adult stem cells. It is the fastest self-renewing tissue in mammals with a turnover time of 5 days. It has a simple, repetitive architecture of crypts and villi and a defined hierarchical organization. Epithelial renewal is driven by stem cells located near the base of the crypts of Lieberkühn. These stem cells divide to fill a Transit Amplifying (TA) compartment. TA cells divide with a cell cycle time of 12 h and go through 4–5 rounds of division after which they differentiate into one of several cell types. Enterocytes and goblet cells move up flanks of the villi and are eventually shed into the lumen, while Paneth cells settle at the bottom of the crypts to live for up to 2 months (Ireland et al, 2005). Several stem cell markers have been proposed that either identify cells at position +4, the original stem cell proposed by Potten (Potten, 1998; He et al, 2004), or the mark cells that are localized near the base of the crypt (Barker et al, 2007; Snippert et al, 2009). Three years ago, our laboratory identified Lgr5 as a definitive marker of crypt stem cells. Lgr5+ve cells are located between Paneth cells, and had previously been named crypt base columnar cells (CBCs) (Cheng and Leblond, 1974a, 1974b). Using lineage tracing experiments, we have demonstrated that these cells represent genuine stem cells, giving rise to all the different epithelial cell types throughout life (Barker et al, 2007). With the identification of the Lgr5+ve cells, we were able to demonstrate that the intestinal stem cells do not divide asymmetrically. Rather, the 14 Lgr5+ve stem cells of each crypt are maintained by neutral competition for Paneth cell surface after the stem cells have divided (Lopez-Garcia et al, 2010; Snippert et al, 2010). The continuously and symmetrically dividing stem cells are dependent on niche signals from the adjacent Paneth cells (Sato et al, 2010), and have equal potential to maintain their stemness after each division. Our data suggest that the Lgr5+ve stem cells are not quiescent. Their cell cycle time, previously estimated at 1 day (Barker et al, 2007), implies that they go through 700–1000 divisions in the lifetime of a mouse. This feat is mirrored by the unimpeded expansion that can be accomplished in vitro with these cells (Sato et al, 2009). This unexpected behaviour challenges current dogmas and requires many logistical adaptations, in particular regarding maintenance of the integrity of the genome. Telomeres, highly repeated sequences located at chromosome ends, are believed to shorten with each somatic cell division, effectively limiting its lifespan. Telomere shortening is counteracted by telomerase, a RNA-dependent DNA polymerase complex. Telomerase activity has been detected in germline cells and embryonic stem cells, cancer cells (Kim et al, 1994) and most human fetal somatic tissues (Wright et al, 1996; Ulaner et al, 1998). However, in adult tissues telomerase activity has only been demonstrated in stem cells of the hair follicle (Ramirez et al, 1997) and in bone marrow-derived haematopoietic stem cells (Morrison et al, 1996). In the intestine, expression of telomerase has been published for mouse and human (Greenberg et al, 1998; Saleh et al, 2008), although the expression of telomerase as identified by a mTert-GFP expressing transgenic was found in only 1 cell of every 157 crypts (Breault et al, 2008). In a follow-up paper, Breault et al provide evidence that these rare Tert-GFP+ cells represent quiescent stem cells and that actively cycling crypt cells (that include Lgr5+ stem cells) do not contain telomerase activity (Montgomery et al, 2010). It is not directly clear why a quiescent cell would require telomerase activity. Conversely, antibody staining on human tissue located telomerase expressing cells in the bottom third of every colonic crypt, though only minor telomerase activity was found for whole colon extracts (Hiyama et al, 2001). Another way by which stem cells protect their DNA was suggested to be the so-called ‘immortal strand’ mechanism (Cairns, 1975). During mitosis, stem cells are suggested to retain the ‘old’ template DNA strand and transfer the newly synthesized strand to their daughter cells. Such label retention and selective chromosome segregation have been reported to occur post injury in hypothetical stem cells located at position +4 counting from the small intestinal crypt bottom (Potten et al, 2002). Recently, Nathke and co-workers described the occurrence of symmetric and asymmetric label retention in the stem cell compartment of mouse and human intestine (Quyn et al, 2010). On the other hand, double labelling experiments indicated that haematopoietic stem cells and hair follicle stem cells do not asymmetrically segregate their chromosomes (Kiel et al, 2007; Sotiropoulou et al, 2008). To address aspects of the logistical challenge of the maintenance of genome integrity in the face of a thousand consecutive cell divisions, we have studied telomerase activity and asymmetric chromosome segregation in Lgr5 stem cells in small intestinal crypts. Results Telomerase in Lgr5+ve stem cells In order to study the presence and activity of telomerase in intestinal stem cells, we isolated Lgr5+ve epithelial cells by FACS from isolated crypts of Lgr5-EGFP knock-in mice. With our sorting procedure we distinguished three different GFP-expressing populations (Figure 1B). Previous experiments have shown that the GFP-Hi cells are the real stem cells, which can generate ever-expanding epithelial organoids with all hallmarks of in vivo epithelial tissue (Sato et al, 2009). Micro array analysis indicates that the GFP-Hi population represents the stem cells and the other two GFP-positive populations represent their daughters (Muñoz et al, in preparation). The fold change between the populations is shown in Figure 1E for a selection of genes that mark the different lineages. Figure 1.Three different Lgr5-EGFP populations can be distinguished. (A) Isolated EGFP-Lgr5+ crypts. (B) FACS isolation of three different Lgr5+ve populations. (C) Single sorted cells are all GFP-positive. (D) FACS analysis of wild-type intestinal cells. (E) Gene expression analysis comparing the three sorted GFP populations. Expression of stem cell markers is highest in the GFP-Hi population. Download figure Download PowerPoint The stem cells and their progeny were analysed for the expression of the catalytic component of Telomerase Tert by RT–PCR (Figure 2A). We find that the Lgr5+ve populations all contain Tert mRNA at levels significantly higher then whole crypt samples. No Tert expression was detected in villus cells. Figure 2.Telomerase activity in stem cells but not in villus cells. (A). mTert expression analysed by RT–PCR. Stem cells express higher levels of mTert than average crypt or villus cells. Normalized for Lgr5-high stem cells, error bars represent s.e.m. (B) Telomerase activity of cell extracts measured by TRAPeze reaction, normalized for the telomerase-positive control cell line provided with the kit. Extract from the colorectal cancer cell line, DLD1, gives high activity. Lgr5-high cells have a higher telomerase activity than Lgr5-low cells, whereas villus cells possess no telomerase activity. Error bars represent s.e.m. Download figure Download PowerPoint To test for telomerase activity, cell extracts were analysed using a TRAPeze telomerase detection assay (Figure 2B). This shows that the activity of telomerase diminishes during differentiation. GFP-Hi Lgr5+ve stem cells have the highest level of activity, whereas extracts from the GFP-Lo population exerted telomerase activity at comparable levels to extracts from isolated crypts. Differentiated villus cells did not show telomerase activity anymore. The colorectal cancer cell line DLD1 was used as a positive control for telomerase activity (Hiyama et al, 2001). Stem cell telomeres are shorter in old mice After showing that Lgr5+ve stem cells contain telomerase activity, we were interested to see if this activity is sufficient to maintain the lengths of telomeres in these cells. Previous publications have shown that telomeres of epithelial cells in the intestine (Wang et al, 2009) and in stem cells of many other organs (Flores et al, 2008) shorten over time. Both studies used Q-FISH to quantify telomere length, but the epithelium was separated only into crypt and villus fractions (Wang et al, 2009), or the +4/+5 position was taken as the stem cell compartment (Flores et al, 2008). We analysed telomere length of sorted Lgr5+ve cells and villi of mice of 5, 30 and 70 weeks old by Flow Cytometry. Telomere length is presented relative to the length in DLD1 cells as shown in Figure 3. The data show that the telomeres shorten with age also in the Lgr5+ve stem cells. However, at any given time point, the telomeres of differentiated villus cells were shorter than the telomeres in Lgr5-high stem cells and their immediate daughters. Moreover, the average telomere length of Lgr5-low cells was substantially lower than in Lgr5-high cells. Figure 3.Telomeres in stem cells and daughters shorten over time. Telomere length is represented relative to telomere length of DLD1. Bars represent average values of relative telomere length. Error bars represent s.e.m. Download figure Download PowerPoint Determination of the average cell cycle length In order to determine what other measures the intestinal stem cells use to maintain the integrity of their genome we set out to validate the model of the immortal strand hypothesis. To do this, first the length of the cell cycle was determined accurately. Mice were injected with EdU and sacrificed at different time points after injection (Figure 4A). Agarose sections were stained for the mitosis marker phospho-histon H3 (PH3) and differential interference contrast was used to show the morphology of the tissue. As there is an almost geometrical distribution of Lgr5+ve stem cells and post-mitotic Paneth cells in the base of the crypt (Sato et al, 2010; Snippert et al, 2010), stem cells were identified as dividing cells adjacent to a Paneth cell. A quadruple staining for Lgr5-GFP, PH3, EdU and DAPI is given in Figure 4B. Figure 4.Crypt base columnar cells cycle once every 21.5 h. (A) Outline of experiment. (B) Co-staining of Lgr5-GFP antibodies (green), PH3 antibodies (white), which marks cells in mitosis, and incorporated EdU (red) together with DAPI. (C) Differential interference contrast visualization of cells in two crypts labelled with PH3 antibodies (green), which marks cells in mitosis, and incorporated EdU (red). CBCs in mitosis can be seen with (arrowhead) or without (arrow) incorporated EdU. (D) Graphic overview of counted stem cells. Individual data points were obtained from different mice. The line connecting the data points (optimal polynomial, R2=0.958) shows two peaks, representing the first and second wave of mitosis. The difference between the peaks gives the average cell cycle length. Download figure Download PowerPoint Cells incorporate EdU label only in S phase. Therefore, analysis at different time points after injection should reveal successive waves of EdU-positive mitotic nuclei. Indeed, such waves were observed upon counting the percentage of EdU-positive stem cells in mitosis (Figure 4D). The lapsed time between the first two peaks was found to be 21.5 h, representing the average cell cycle length of a stem cell. Sequential double labellings were performed with EdU and BrdU with a 21.5-h interval to show that cells in the second wave of mitosis indeed reentered the cell cycle (Supplementary Figure S1). Symmetric segregation of EdU label After determining the cell cycle length, we analysed the stem cell divisions in the second round of mitosis after EdU incorporation at 26.5 h. At this time asymmetric segregation of chromatin strands, as proposed by the immortal strand hypothesis, should be visible as asymmetric distribution of EdU label. Agarose sections were stained for incorporated EdU and the epithelial membrane marker E-cadherin, and counterstained with DAPI (Figure 5A). Figure 5.Random segregation of EdU label during stem cell mitosis. (A) Three colour overlay of intestinal crypt showing membrane marker E-cadherin (green), incorporated EdU label (red) and DNA (blue). A simplified representation of the division is given to accentuate the cell that is dividing. (B–I) Divisions at multiple positions in the crypt all show symmetric segregation of label. Download figure Download PowerPoint Three colour overlays clearly showed that dividing cells at all positions in the crypt segregate their chromatin in a symmetric manner. The E-cadherin staining proved to be essential to ensure that the observed condensed chromosomes indeed belonged to a single dividing cell before its cytokinesis. A total of 51 mitotic stem cells were identified for which E-cadherin staining completely lined the contours of the dividing cell in 3-dimensional reconstruction. Nine of these cells are shown in Figure 5A–I, and represent divisions in which DNA separation is orientated parallel as well as perpendicular to the basement membrane. In the 51 dividing cells, no asymmetric segregations of EdU-labelled chromatin and no preferential orientation of the plane of division were observed. Although we did not find asymmetric segregation of label, the possibility of asymmetric divisions in a minority of cells cannot formally be excluded. However, based on the 51 counted events, if 1 of the 14 stem cells in each crypt of the small intestine would asymmetrically segregate its chromatids, the P-value for failing to observe such a scenario is <0.025. Discussion Stem cells quiescence is often considered to be a central attribute of adult stem cells, as continuous cell divisions may challenge the genomic integrity (Cotsarelis et al, 1990; Arai et al, 2004). Limiting the number of cell divisions would also provide a means to minimize progressive telomere shortening (Forsyth et al, 2002). In this study, we find that Lgr5+ve stem cells divide on average every 21.5 h. This continuous cycling requires a mechanism to avoid telomere erosion. Indeed, we find that intestinal stem cells contain significant telomerase activity and that this activity is gradually lost in their progeny. The level of telomerase activity is comparable to the immortal diploid colorectal cancer cell line DLD1. This agrees with the finding that telomerase-deficient mice develop atrophies in proliferative organs such as the intestinal epithelium in the third generation (Lee et al, 1998). However, despite the presence of telomerase activity in stem cells, telomere shortening is not completely prevented. Interestingly, the average telomere length of Lgr5-low cells was substantially lower than in Lgr5-high cells at all ages. The degree of telomere shortening of several kilobases observed has occurred in only a limited number of cell divisions (4–5). It is unlikely that this telomere shortening is merely caused by an end-replication problem. Indeed, the possibility of active telomere degradation has been suggested before (Flores et al, 2008). Besides telomere erosion, the acquisition of mutations may pose another challenge in rapid cycling cells (Cairns, 1975). Selective segregation of chromosomes has been proposed as a mechanism to avoid replication induced mutations. Asymmetric distribution of label in label-retaining cells in the intestine has been suggested but is still under debate (Potten et al, 2002; Quyn et al, 2010). In our study, we do not find asymmetric segregation of chromosomes in intestinal stem cells. A possible explanation for this disparity could be that no membrane marking was used in previous studies, which makes it difficult to discriminate between two dividing neighbouring cells and a single dividing cell. This study demonstrates that the Lgr5-high cells, which represent the ‘workhorse’ stem cells of the small intestinal crypt, actively express telomerase. The Lgr5 crypt stem cells are likely the first described somatic cells that will complete many hundreds of cell divisions in the lifetime of a mouse, in essence defying the Hayflick limit (Hayflick and Moorhead, 1961). Against this backdrop, it remains mysterious why telomerase-mutant knockout mice only reach ‘telomere-crisis’ in the intestinal epithelium in the third generation. It should be noted, however, that each generation starts ‘afresh’ with the telomere length of germline cells, which will be substantially longer than the telomeres of an Lgr5 stem cell after its numerous somatic divisions. How exactly stem cells handle the mutational challenge posed by the hundreds of cell divisions they go through remains to be determined. Asymmetric segregation of chromatids as defined by the ‘immortal strand’ hypothesis does not appear to represent the mechanism by which these cells accomplish this feat. Materials and methods Lgr5+ve cell sorting The generation of Lgr5-EGFP mice and isolation of intestinal crypt and villus fractions were described earlier (Barker et al, 2007). Freshly isolated small intestines were incised along their length and villi were scraped off. The intestinal tissue was washed in PBS/EDTA (5 mM) for 5 min, and subsequently incubated in fresh PBS/EDTA for 30 min at 4°C. Vigorous shaking yielded free crypts, which were incubated in SMEM supplemented with Trypsine (1 mg/ml) and DNase (0.8 U/μl) for 30 min at 37°C. After incubation, cells were spun down, resuspended in SMEM (Invitrogen) and filtered through a 40-mm mesh. Single GFP-expressing cells were isolated using a MoFlo cell sorter (Beckman Coulter). Propidium iodide was used to exclude dead cells. EdU injection Adult mice were injected intraperitoneally with 350 μl 3 mM EdU solution in PBS. Confocal analysis For confocal analysis, intestines were fixed in 4% formaldehyde. After washing, the intestines were embedded in 4% agarose and 175 μm sections were prepared using a vibratome. After click-it staining for EdU (Click-iT™ EdU, Invitrogen), antibody staining for phospho-histone H3 (Upstate) or E-cadherin (Transduction Laboratories) and counterstain with DAPI (Vector Vectashield), the sections were analysed by confocal microscopy (Leica SP2 AOBS). Telomerase activity TRAPeze: standard TRAP reaction was performed with fluorescent probes (TRAPEZE, Chemicon) on isolated cells from 100 weeks old Lgr5-EGFP mice according to manufacturer's instructions. Briefly, sorted cells were lysed in CHAPS lysis buffer. Protein levels were measured using the Bradford method, and equal amounts of protein were evaluated. Cell extracts were incubated for 30 min, adding a varied number of telomeric repeats onto the substrate oligonucleotide corresponding to telomerase activity. Positive and negative controls were examined simultaneously. PCR amplification was then performed with fluorescent probes and fluorescence was measured on a Flexstation2 (Molecular Devices). Telomere length Telomere length was analysed using the Telomere PNA Kit/FITC for Flow Cytometry from DAKO, following the manufacturer's protocol. DLD1 colorectal cancer cells were used as a reference. Cells from two mice were pooled before sorting. Three pooled samples of sorted cells were analysed for each age group. RT–PCR primers To analyse the expression of Tert mRNA by RT–PCR, the following primers were used: Tert fwd: TGGCTTGCTGCTGGACACTC, rev: TGAGGCTCGTCTTAATTGAGGTCTG. Actb fwd: GCTTCTTTGCAGCTCCTTC, rev: GACCAGCGCAGCGATATC. Supplementary data Supplementary data are available at The EMBO Journal Online (http://www.embojournal.org). Conflict of Interest The authors declare that they have no conflict of interest. Supporting Information Supplementary Figure S1 (PDF document, 1.4 MB) Review Process File (PDF document, 330.6 KB) References Arai F, Hirao A, Ohmura M, Sato H, Matsuoka S, Takubo K, Ito K, Koh GY, Suda T (2004) Tie2/angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell 118: 149–161CrossrefCASPubMedWeb of Science®Google Scholar Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, Cozijnsen M, Haegebarth A, Korving J, Begthel H, Peters PJ, Clevers H (2007) Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449: 1003–1007CrossrefCASPubMedWeb of Science®Google Scholar Breault DT, Min IM, Carlone DL, Farilla LG, Ambruzs DM, Henderson DE, Algra S, Montgomery RK, Wagers AJ, Hole N (2008) Generation of mTert-GFP mice as a model to identify and study tissue progenitor cells. Proc Natl Acad Sci USA 105: 10420–10425CrossrefCASPubMedWeb of Science®Google Scholar Cairns J (1975) Mutation selection and the natural history of cancer. Nature 255: 197–200CrossrefCASPubMedWeb of Science®Google Scholar Cheng H, Leblond CP (1974a) Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. I. Columnar cell. Am J Anat 141: 461–479Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Cheng H, Leblond CP (1974b) Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. V. Unitarian theory of the origin of the four epithelial cell types. Am J Anat 141: 537–561Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Cotsarelis G, Sun TT, Lavker RM (1990) Label-retaining cells reside in the bulge area of pilosebaceous unit: implications for follicular stem cells, hair cycle, and skin carcinogenesis. Cell 61: 1329–1337CrossrefCASPubMedWeb of Science®Google Scholar Flores I, Canela A, Vera E, Tejera A, Cotsarelis G, Blasco MA (2008) The longest telomeres: a general signature of adult stem cell compartments. Genes Dev 22: 654–667CrossrefCASPubMedWeb of Science®Google Scholar Forsyth NR, Wright WE, Shay JW (2002) Telomerase and differentiation in multicellular organisms: turn it off, turn it on, and turn it off again. Differentiation 69: 188–197Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Greenberg RA, Allsopp RC, Chin L, Morin GB, DePinho RA (1998) Expression of mouse telomerase reverse transcriptase during development, differentiation and proliferation. Oncogene 16: 1723–1730CrossrefCASPubMedWeb of Science®Google Scholar Hayflick L, Moorhead PS (1961) The serial cultivation of human diploid cell strains. Exp Cell Res 25: 585–621CrossrefCASPubMedWeb of Science®Google Scholar He XC, Zhang J, Tong WG, Tawfik O, Ross J, Scoville DH, Tian Q, Zeng X, He X, Wiedemann LM, Mishina Y, Li L (2004) BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt-beta-catenin signaling. Nat Genet 36: 1117–1121CrossrefCASPubMedWeb of Science®Google Scholar Hiyama E, Hiyama K, Yokoyama T, Shay JW (2001) Immunohistochemical detection of telomerase (hTERT) protein in human cancer tissues and a subset of cells in normal tissues. Neoplasia 3: 17–26CrossrefCASPubMedWeb of Science®Google Scholar Ireland H, Houghton C, Howard L, Winton DJ (2005) Cellular inheritance of a Cre-activated reporter gene to determine Paneth cell longevity in the murine small intestine. Dev Dyn 233: 1332–1336Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Kiel MJ, He S, Ashkenazi R, Gentry SN, Teta M, Kushner JA, Jackson TL, Morrison SJ (2007) Haematopoietic stem cells do not asymmetrically segregate chromosomes or retain BrdU. Nature 449: 238–242CrossrefCASPubMedWeb of Science®Google Scholar Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL, Coviello GM, Wright WE, Weinrich SL, Shay JW (1994) Specific association of human telomerase activity with immortal cells and cancer. Science 266: 2011–2015CrossrefCASPubMedWeb of Science®Google Scholar Lee HW, Blasco MA, Gottlieb GJ, Horner JW, Greider CW, DePinho RA (1998) Essential role of mouse telomerase in highly proliferative organs. Nature 392: 569–574CrossrefCASPubMedWeb of Science®Google Scholar Lopez-Garcia C, Klein AM, Simons BD, Winton DJ (2010) Intestinal stem cell replacement follows a pattern of neutral drift. Science 330: 822–825CrossrefCASPubMedWeb of Science®Google Scholar Montgomery RK, Carlone DL, Richmond CA, Farilla L, Kranendonk ME, Henderson DE, Baffour-Awuah NY, Ambruzs DM, Fogli LK, Algra S, Breault DT (2010) Mouse telomerase reverse transcriptase (mTert) expression marks slowly cycling intestinal stem cells. Proc Natl Acad Sci USA 108: 179–184CrossrefPubMedWeb of Science®Google Scholar Morrison SJ, Wandycz AM, Akashi K, Globerson A, Weissman IL (1996) The aging of hematopoietic stem cells. Nat Med 2: 1011–1016CrossrefCASPubMedWeb of Science®Google Scholar Potten CS (1998) Stem cells in gastrointestinal epithelium: numbers, characteristics and death. Philos Trans R Soc Lond B Biol Sci 353: 821–830CrossrefCASPubMedWeb of Science®Google Scholar Potten CS, Owen G, Booth D (2002) Intestinal stem cells protect their genome by selective segregation of template DNA strands. J Cell Sci 115 (Part 11): 2381–2388CrossrefCASPubMedWeb of Science®Google Scholar Quyn AJ, Appleton PL, Carey FA, Steele RJ, Barker N, Clevers H, Ridgway RA, Sansom OJ, Nathke IS (2010) Spindle orientation bias in gut epithelial stem cell compartments is lost in precancerous tissue. Cell Stem Cell 6: 175–181CrossrefCASPubMedWeb of Science®Google Scholar Ramirez RD, Wright WE, Shay JW, Taylor RS (1997) Telomerase activity concentrates in the mitotically active segments of human hair follicles. J Invest Dermatol 108: 113–117CrossrefCASPubMedWeb of Science®Google Scholar Saleh S, Lam AK, Ho YH (2008) Real-time PCR quantification of human telomerase reverse transcriptase (hTERT) in colorectal cancer. Pathology 40: 25–30CrossrefCASPubMedWeb of Science®Google Scholar Sato T, van Es JH, Snippert HJ, Stange DE, Vries RG, van den Born M, Barker N, Shroyer NF, van de Wetering M, Clevers H (2010) Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts. Nature 469: 415–418CrossrefCASPubMedWeb of Science®Google Scholar Sato T, Vries RG, Snippert HJ, van de Wetering M, Barker N, Stange DE, van Es JH, Abo A, Kujala P, Peters PJ, Clevers H (2009) Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 459: 262–265CrossrefCASPubMedWeb of Science®Google Scholar Snippert HJ, van der Flier LG, Sato T, van Es JH, van den Born M, Kroon-Veenboer C, Barker N, Klein AM, van Rheenen J, Simons BD, Clevers H (2010) Intestinal crypt homeostasis results from neutral competition between symmetrically dividing Lgr5 stem cells. Cell 143: 134–144CrossrefCASPubMedWeb of Science®Google Scholar Snippert HJ, van Es JH, van den Born M, Begthel H, Stange DE, Barker N, Clevers H (2009) Prominin-1/CD133 marks stem cells and early progenitors in mouse small intestine. Gastroenterology 136: 2187–2194 e2181CrossrefCASPubMedWeb of Science®Google Scholar Sotiropoulou PA, Candi A, Blanpain C (2008) The majority of multipotent epidermal stem cells do not protect their genome by asymmetrical chromosome segregation. Stem Cells 26: 2964–2973Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Ulaner GA, Hu JF, Vu TH, Giudice LC, Hoffman AR (1998) Telomerase activity in human development is regulated by human telomerase reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT transcripts. Cancer Res 58: 4168–4172CASPubMedWeb of Science®Google Scholar Wang C, Jurk D, Maddick M, Nelson G, Martin-Ruiz C, von Zglinicki T (2009) DNA damage response and cellular senescence in tissues of aging mice. Aging Cell 8: 311–323Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Wright WE, Piatyszek MA, Rainey WE, Byrd W, Shay JW (1996) Telomerase activity in human germline and embryonic tissues and cells. Dev Genet 18: 173–179Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Previous ArticleNext Article Read MoreAbout the coverClose modalView large imageVolume 30,Issue 6,March 16, 2011“Silverwaterdropletbowl” - This photograph taken by Walter-Wielant Wiersdorff was one of the top-scoring entries in the EMBO Journal Cover Contest 2010. The photographer writes, “A dew drop, mirroring the bright sky above. The droplet spent the day on the leaf of an Epimedium plant outside of our front door. The next morning it had moved on.” Volume 30Issue 616 March 2011In this issue FiguresReferencesRelatedDetailsLoading ..." @default.
• W1874198492 created "2016-06-24" @default.
• W1874198492 creator A5018755733 @default.
• W1874198492 creator A5024060936 @default.
• W1874198492 creator A5062248785 @default.
• W1874198492 creator A5064765659 @default.
• W1874198492 creator A5081582414 @default.
• W1874198492 date "2011-02-04" @default.
• W1874198492 modified "2023-10-18" @default.
• W1874198492 title "Lgr5 intestinal stem cells have high telomerase activity and randomly segregate their chromosomes" @default.
• W1874198492 cites W1612842202 @default.
• W1874198492 cites W1894632965 @default.
• W1874198492 cites W1965157206 @default.
• W1874198492 cites W1967802833 @default.
• W1874198492 cites W1980332250 @default.
• W1874198492 cites W1982603620 @default.
• W1874198492 cites W1985801522 @default.
• W1874198492 cites W2000971601 @default.
• W1874198492 cites W2004314923 @default.
• W1874198492 cites W2022507419 @default.
• W1874198492 cites W2023649138 @default.
• W1874198492 cites W2024790458 @default.
• W1874198492 cites W2043234866 @default.
• W1874198492 cites W2046409965 @default.
• W1874198492 cites W2047151533 @default.
• W1874198492 cites W2049792810 @default.
• W1874198492 cites W2060610551 @default.
• W1874198492 cites W2064248337 @default.
• W1874198492 cites W2065220128 @default.
• W1874198492 cites W2073723117 @default.
• W1874198492 cites W2073928750 @default.
• W1874198492 cites W2084359613 @default.
• W1874198492 cites W2096587251 @default.
• W1874198492 cites W2098278242 @default.
• W1874198492 cites W2112364863 @default.
• W1874198492 cites W2132606465 @default.
• W1874198492 cites W2148914667 @default.
• W1874198492 cites W2154938844 @default.
• W1874198492 cites W2157010562 @default.
• W1874198492 cites W2162096092 @default.
• W1874198492 cites W2168901267 @default.
• W1874198492 cites W4247382314 @default.
• W1874198492 doi "https://doi.org/10.1038/emboj.2011.26" @default.
• W1874198492 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3061032" @default.
• W1874198492 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21297579" @default.
• W1874198492 hasPublicationYear "2011" @default.
• W1874198492 type Work @default.
• W1874198492 sameAs 1874198492 @default.
• W1874198492 citedByCount "183" @default.
• W1874198492 countsByYear W18741984922012 @default.
• W1874198492 countsByYear W18741984922013 @default.
• W1874198492 countsByYear W18741984922014 @default.
• W1874198492 countsByYear W18741984922015 @default.
• W1874198492 countsByYear W18741984922016 @default.
• W1874198492 countsByYear W18741984922017 @default.
• W1874198492 countsByYear W18741984922018 @default.
• W1874198492 countsByYear W18741984922019 @default.
• W1874198492 countsByYear W18741984922020 @default.
• W1874198492 countsByYear W18741984922021 @default.
• W1874198492 countsByYear W18741984922022 @default.
• W1874198492 countsByYear W18741984922023 @default.
• W1874198492 crossrefType "journal-article" @default.
• W1874198492 hasAuthorship W1874198492A5018755733 @default.
• W1874198492 hasAuthorship W1874198492A5024060936 @default.
• W1874198492 hasAuthorship W1874198492A5062248785 @default.
• W1874198492 hasAuthorship W1874198492A5064765659 @default.
• W1874198492 hasAuthorship W1874198492A5081582414 @default.
• W1874198492 hasBestOaLocation W18741984921 @default.
• W1874198492 hasConcept C10116572 @default.
• W1874198492 hasConcept C104317684 @default.
• W1874198492 hasConcept C125593758 @default.
• W1874198492 hasConcept C177336024 @default.
• W1874198492 hasConcept C28328180 @default.
• W1874198492 hasConcept C54355233 @default.
• W1874198492 hasConcept C552990157 @default.
• W1874198492 hasConcept C55427017 @default.
• W1874198492 hasConcept C86803240 @default.
• W1874198492 hasConcept C94581717 @default.
• W1874198492 hasConcept C95444343 @default.
• W1874198492 hasConceptScore W1874198492C10116572 @default.
• W1874198492 hasConceptScore W1874198492C104317684 @default.
• W1874198492 hasConceptScore W1874198492C125593758 @default.
• W1874198492 hasConceptScore W1874198492C177336024 @default.
• W1874198492 hasConceptScore W1874198492C28328180 @default.
• W1874198492 hasConceptScore W1874198492C54355233 @default.
• W1874198492 hasConceptScore W1874198492C552990157 @default.
• W1874198492 hasConceptScore W1874198492C55427017 @default.
• W1874198492 hasConceptScore W1874198492C86803240 @default.
• W1874198492 hasConceptScore W1874198492C94581717 @default.
• W1874198492 hasConceptScore W1874198492C95444343 @default.
• W1874198492 hasIssue "6" @default.
• W1874198492 hasLocation W18741984921 @default.
• W1874198492 hasLocation W18741984922 @default.
• W1874198492 hasLocation W18741984923 @default.
• W1874198492 hasLocation W18741984924 @default.
• W1874198492 hasOpenAccess W1874198492 @default.
• W1874198492 hasPrimaryLocation W18741984921 @default.
• W1874198492 hasRelatedWork W146190332 @default.

• next