FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034206299> ?p ?o ?g. }

• W2034206299 endingPage "10572" @default.
• W2034206299 startingPage "10562" @default.
• W2034206299 abstract "In fission yeast, nutrient starvation induces physiological, biochemical, and morphological changes that enable survival. Collectively these changes are referred to as stationary phase. We have used a green fluorescent protein random insertional mutagenesis system to isolate two novel stress-response proteins required in stationary phase. Ish1 is a nuclear envelope protein that is present throughout the cell cycle and whose expression is increased in response to stresses such as glucose and nitrogen starvation, as well as osmotic stress. Expression of Ish1 is regulated by the Spc1 MAPK pathway through the Atf1 transcription factor. Although overexpression of Ish1 is lethal, cells lackingish1 exhibit reduced viability in stationary phase. Bis1 is a novel interacting partner of Ish1. Bis1 is theSchizosaccharomyces pombe member of the ES2 nuclear protein family found in Mus musculus, Drosophila melanogaster, Homo sapiens, and Arabidopsis thaliana. Overexpression of Bis1 results in a cell elongation phenotype, whereas bis1− cells exhibit a reduced viability in stationary phase similar to that seen inish1− cells. In fission yeast, nutrient starvation induces physiological, biochemical, and morphological changes that enable survival. Collectively these changes are referred to as stationary phase. We have used a green fluorescent protein random insertional mutagenesis system to isolate two novel stress-response proteins required in stationary phase. Ish1 is a nuclear envelope protein that is present throughout the cell cycle and whose expression is increased in response to stresses such as glucose and nitrogen starvation, as well as osmotic stress. Expression of Ish1 is regulated by the Spc1 MAPK pathway through the Atf1 transcription factor. Although overexpression of Ish1 is lethal, cells lackingish1 exhibit reduced viability in stationary phase. Bis1 is a novel interacting partner of Ish1. Bis1 is theSchizosaccharomyces pombe member of the ES2 nuclear protein family found in Mus musculus, Drosophila melanogaster, Homo sapiens, and Arabidopsis thaliana. Overexpression of Bis1 results in a cell elongation phenotype, whereas bis1− cells exhibit a reduced viability in stationary phase similar to that seen inish1− cells. mitogen-activated protein kinase green fluorescent protein induced stationary phase protein binds to Ish1 open reading frame 4,6-diamidino-2-phenylindole glutathioneS-transferase 4-morpholinepropanesulfonic acid yellow fluorescent protein Edinburgh minimal medium late embryogenesis abundant The regulation of cellular growth and proliferation in response to environmental stress is important for development as well as for maintenance of cell viability. Nutritional limitation causes cells to arrest cell growth and enter stationary phase (1Egel R. Nasim A. Young P. Johnson F. Meiosis in Fission Yeast. Academic Press, New York1989: 31-73Google Scholar, 2Lillie S.H. Pringle J.R. J. Bacteriol. 1980; 143: 1384-1394Crossref PubMed Google Scholar, 3Johnston G.C. Singer R.A. McFarlane E.S. J. Bacteriol. 1977; 132: 723-730Crossref PubMed Google Scholar). This is a metabolically quiescent state where expression of genes required for survival is induced, whereas expression of cell cycle genes is repressed (4Bataille N. Regnacq M. Boucherie H. Yeast. 1991; 7: 367-378Crossref PubMed Scopus (26) Google Scholar, 5Werner-Washburne M. Braun E. Johnston G.C. Singer R.A. Microbiol. Rev. 1993; 57: 383-401Crossref PubMed Google Scholar). Fission yeast cells enter stationary phase from G2 upon glucose starvation and from G1 upon nitrogen starvation (6Costello G. Rodgers L. Beach D. Curr. Genet. 1986; 11: 119-125Crossref Scopus (146) Google Scholar). In eukaryotic organisms the mitogen-activated protein kinase (MAPK)1 pathways are ubiquitous for sensing and responding to environmental stresses (7Toone W.M. Jones N. Genes Cells. 1998; 3: 485-498Crossref PubMed Scopus (123) Google Scholar). In fission yeast the stress-activated MAPK, Spc1, like the mammalian p38 kinase responds to a variety of stresses including osmotic stress, heat stress, oxidative stress, nutritional limitation, UV radiation, and DNA damage. Spc1 (also known as Sty1 or Phh1) is activated by the Wis1 MAPK kinase, which is in turn activated by two MAPK kinase kinases, Wak1 (also known as Wik1 and Wis4) or Win1 (7Toone W.M. Jones N. Genes Cells. 1998; 3: 485-498Crossref PubMed Scopus (123) Google Scholar, 8Banuett F. Microbiol. Mol. Biol. Rev. 1998; 62: 249-274Crossref PubMed Google Scholar, 9Degols G. Shiozaki K. Russell P. Mol. Cell. Biol. 1996; 16: 2870-2877Crossref PubMed Scopus (259) Google Scholar, 10Kato T. Okazaki K. Murakami H. Stettler S. Fantes P. Okayama H. FEBS Lett. 1996; 378: 207-212Crossref PubMed Scopus (155) Google Scholar, 11Miller J.B.A. Buck V. Wilkinson M.G. Genes Dev. 1995; 9: 2117-2130Crossref PubMed Scopus (311) Google Scholar, 12Shiozaki K. Russell P. Nature. 1995; 378: 739-743Crossref PubMed Scopus (397) Google Scholar). Attenuation of Spc1 activity is accomplished by the actions of two tyrosine phosphatases, Pyp1 and Pyp2 (11Miller J.B.A. Buck V. Wilkinson M.G. Genes Dev. 1995; 9: 2117-2130Crossref PubMed Scopus (311) Google Scholar, 12Shiozaki K. Russell P. Nature. 1995; 378: 739-743Crossref PubMed Scopus (397) Google Scholar). Pyp2 is regulated at the transcriptional level by the Atf1 transcription factor and participates in a down-regulation of the Spc1 MAPK via a negative feedback loop (8Banuett F. Microbiol. Mol. Biol. Rev. 1998; 62: 249-274Crossref PubMed Google Scholar). Inactivation of Pyp1 activates the Spc1 pathway. One Spc1-regulated transcription factor, Atf1 (12Shiozaki K. Russell P. Nature. 1995; 378: 739-743Crossref PubMed Scopus (397) Google Scholar, 13Shiozaki K. Russell P. Genes Dev. 1996; 10: 2276-2288Crossref PubMed Scopus (367) Google Scholar), is essential for the response of cells to nitrogen starvation, osmotic stress, conjugation, meiosis, entry into stationary phase, and even DNA damage (13Shiozaki K. Russell P. Genes Dev. 1996; 10: 2276-2288Crossref PubMed Scopus (367) Google Scholar, 14Kanoh J. Watanabe Y. Ohsugi M. Iino Y. Yamamoto M. Genes Cells. 1996; 1: 391-408Crossref PubMed Scopus (116) Google Scholar, 15Takeda T. Toda T. Kominami K. Kohnosu A. Yanagida M. Jones N. EMBO J. 1995; 14: 6193-6208Crossref PubMed Scopus (230) Google Scholar, 16Taricani L. Feilotter H.E. Weaver C. Young P.G. Nucleic Acids Res. 2001; 29: 3030-3040Crossref PubMed Scopus (26) Google Scholar). Atf1 is highly homologous to mammalian ATF-2, which is itself involved in stress response (8Banuett F. Microbiol. Mol. Biol. Rev. 1998; 62: 249-274Crossref PubMed Google Scholar). The completion of the fission yeast genome sequencing project has revealed the existence of a large number of open reading frames (ORFs) of no known function or apparent homologues. To provide information regarding the localization of some of these gene products in the cell, we have developed a GFP random insertional mutagenesis system (17Chua G. Taricani L. Stangle W. Young P.G. Nucleic Acids Res. 2000; 138: E53Crossref Scopus (35) Google Scholar). This system utilizes GFP-ura4+ PCR-generated cassettes randomly integrated into the genome. GFP in-frame fusion integrants are expressed under the control of native promoters allowing us to examine expression levels and intracellular localization of their protein products under a variety of growth conditions. The affected genes from cells displaying specific intracellular GFP localizations are isolated by inverse PCR and are sequenced (17Chua G. Taricani L. Stangle W. Young P.G. Nucleic Acids Res. 2000; 138: E53Crossref Scopus (35) Google Scholar, 18Ochman H. Gerber A.S. Hartl D.L. Genetics. 1988; 120: 621-623Crossref PubMed Google Scholar). To search for novel genes expressed in stationary phase, we screened for GFP in-frame fusions that had increased expression under glucose limiting conditions. We report the isolation of a novel stress protein named Ish1+ (induced in stationary phase) localized to the nuclear envelope and the plasma membrane. Ish1 expression is elevated in response to a number of environmental stimuli including glucose starvation and osmotic stress and is regulated by the Spc1 MAPK pathway through Atf1. We also report the isolation of a novel nuclear protein, Bis1 (binds toish1), isolated by two-hybrid screening, and we show that it specifically interacts with Ish1 in vivo. Bis1 is the fission yeast homologue of the strongly conserved ES2 family of proteins known from Homo sapiens, Drosophila melanogaster, Arabidopsis thaliana, andCaenorhabditis elegans. They are of unknown function although we show that both ish1 and bis1contribute to viability in stationary phase. Strains (TableI) were grown in yeast extract medium (YE) or Edinburgh minimal medium (EMM) supplemented as required (19Alfa C. Fantes P. Hyams J. McLeod M. Warbrick E. Experiments with Fission Yeast: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1993Google Scholar,20Moreno S. Klar A. Nurse P. Methods Enzymol. 1991; 194: 795-823Crossref PubMed Scopus (3148) Google Scholar). Double mutants were identified in nonparental ditype tetrads, and genotypes were confirmed by out-crossing as well as by PCR.Table ISchizosaccharomyces pombe strains used in this studyStrainsGenotypeSourceQ250h − wild typeLab collectionQ868h−leu1–32Lab collectionQ1411h− ura4-D18Lab collectionQ1166h− ura4-D18 leu1–32Lab collectionQ1667h+ ura4-D18 leu1–31 ade1-D25 ade6–216 his3/h+ ura4-D18 leu1–32 ade1-D25 ade6–210 his2This studyQ1814h90 ltl3–26This studyQ1951h− ish1∷ura4+ ura4-D18This studyQ1894h− bis1∷ura4+ura4-D18This studyQ1935h−ish1∷ura4+ bis1∷ura4+ura4-D18This studyQ1751h+ish1∷ura4+ spc1∷ura4+ura4-D18 leu1–32This studyQ1622h−atf1∷ura4+ leu1–32 ura4-D18 his3-D1W. WahlsQ1510h− spc1∷ura4+ leu1–32K. Shiozaki and P. RussellQ1699h+spc1∷ura4+ ura4-D18This studyQ910h− pyp1∷ura4+ ura4-D18S. OttilieQ1757h− ish1∷ura4+pyp1∷ura4+ ura4-D18 leu1–32This studyQ1785h+ ish1∷ura4+atf1∷ura4+ ura4-D18 leu1–32This studyQ1752h− ish1-GFP(S65T)-ura4+spc1∷ura4+ ura4-D18 leu1–32This studyQ1756h− ish1-GFP(S65T)-ura4+pyp1∷ura4+ ura4-D18 leu1–32This studyQ1765h− ish1-GFP(S65T)-ura4+atf1∷ura4+ ura4-D18 leu1–32This studyQ1777h+ ish1-GFP(S65T)-ura4+atf1∷ura4+ pyp1∷ura4+ura4-D18This studyQ1779h− leu1–32/pLT1–2 (nmt1:ish1-GFP leu2)This studyQ1789h+ish1∷ura4+ spc1∷ura4+ura4-D18 leu1–32/pLT1–2 (nmt1:ish1-GFP leu2)This studyQ1790h− ish1∷ura4+pyp1∷ura4+ ura4-D18 leu1–32/pLT1–2 (nmt1:ish1-GFP leu2)This studyQ1791h+ish1∷ura4+ atf1∷ura4+ura4-D18 leu1–32/pLT1–2 (nmt1:ish1-GFP leu2)This studyQ1794h− leu1–32/pLT1–3 (nmt1:ish1ΔC104-GFP leu2)This studyQ1795h− leu1–32/pLT1–4 (nmt1:ΔN278ish1-GFP leu2)This studyQ1798h−leu1–32/pLT2–1 (ish1-GFP leu2)This studyQ1807h−leu1–32/pLT1–1 (nmt1:ish1 leu2)This studyQ1808h− ish1∷ura4+ leu1–32 ura4-D18/pLT1–1 (nmt1:ish1 leu2)This studyQ1809h− spc1∷ura4+leu1–32/pLT1–1 (nmt1:ish1 leu2)This studyQ1836h− ura4-D18/pLT3–1(nmt2:bis1 ura4)This studyQ1837h− ura4-D18/pLT3–2(nmt2:bis1-YFP ura4)This studyQ1841h− ura4-D18 leu1–32/pLT1–2 (nmt1:ish1-GFP leu2) pLT3–1(nmt2:bis1-YFP ura4)This studyQ1847h− ura4-D18 leu1–32/pLT1–3 (nmt1:ish1ΔC104-GFP leu2) pLT3–1(nmt2:bis1-YFP ura4)This studyQ1926h− bis1∷ura4+ ura4-D18 leu1–32/pLT1–2 (nmt1:ish1-GFP leu2)This studyQ1852h− ish1∷ura4+ leu1–32 ura4-D18/pLT3–2(nmt1:bis1-YFP leu2)This study Open table in a new tab Standard genetic methods and molecular biology techniques were used (1Egel R. Nasim A. Young P. Johnson F. Meiosis in Fission Yeast. Academic Press, New York1989: 31-73Google Scholar, 37Hoffman C.S. Winston F. Genetics. 1990; 124: 807-816Crossref PubMed Google Scholar). The ish1gene was isolated using our GFP insertional mutagenesis screen (17Chua G. Taricani L. Stangle W. Young P.G. Nucleic Acids Res. 2000; 138: E53Crossref Scopus (35) Google Scholar).ish1 was previously reported as an ORF upstream of thehba1 gene (21Turi T.G. Mueller U.W. Sazer S. Rose J.K. J. Biol. Chem. 1996; 271: 9166-9171Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar) and by the fission yeast genome project (Sanger data base). The ish1 gene was PCR-amplified using High Fidelity Taq polymerase (Roche Molecular Biochemicals) with genomic DNA as template and primers sporf9 and sporf12 (TableII). The 2052-bp fragment was cloned into pREP1 under the control of the thiamine-repressible nmt1promoter (22Basi G. Schmid E. Maundrell K. Gene (Amst.). 1993; 123: 131-136Crossref PubMed Scopus (570) Google Scholar, 23Maundrell K. Gene (Amst.). 1993; 123: 127-130Crossref PubMed Scopus (931) Google Scholar), resulting in pLT1-1. pLT1-1 was transformed intoSchizosaccharomyces pombe strains, and transformants were selected under repressing conditions (15 μmthiamine).Table IISequence of oligonucleotides used in this studyPrimerSequencessporf15′-CAAGAGGAATAATTTATATTTTTTATTTTCCTTCTTATCTATCTTCTTTTTGTGATATTTATTTATTTTGA TTTGTAAAAAGCTTAGCTACAAATCCCAC-3′sporf25′-AGTCGCCTGCTGAAGATACAGCAGATGAGGCTTTTAGAGGCAGTATCTTTTACCTTTTGAATGTTTTCTCCT AGCTTAATTAGCTTGTGATATTGACGAAAC-3′sporf35′-AGTAGGGTTTACTTTTTTAGTTCCCTC-3′sporf45′-CATGAACAATTTACAAAACCCTTTGG-3′sporf55′-AACTGCAGGGAGGTTATTGTCTCTATAATCC-3′sporf95′-ACGCATTAATATGCGTTCTCGATCAGTGGCATC-3′sporf105′-ACGCGTCGACAGCAAAACCCTTTGGGCTTTCTTTAC-3′sporf115′-ACGCCATATGGAAGAAGCTGGTGAACTTC-3′sporf125′-ACGCGTCGACTTACAAAACCCTTTGGGCTTTCTTTAC-3′lan1ko15′-GTCGACCTGTTTAATCCCCATAAC-3′lanko25′-GTTGACATTACGAGCAAGGTTGGTAAC-3′lan15′-ACGCCATATGTCCTTGGCAAAAAAGATCGATG-3′lan25′-ACGCGTCGAGGCTTAAACCCTTTTAGGTGTAGGGGC-3′lan35′-ACGCGTCGACGCAACCCTTTTAGGTGTAGGGGC-3′Ish1lexA15′-GGGGGATCCTGATGTCCGCTGTAAAGACTTGGTTAGAG-3′Ish1lexA25′-GGGGCGGCCGCTTACAAAACCCTTTGGGCTTTCTTTAC-3′Bis1lexA(Δ90 aa)2-aaa, amino acids.5′-GGGAGATCTTGTTGAGAAAGAGGCTTCCATCGTTAGC-3′Bis1lexA35′-GGGAGATCTTGTCCCTGTCTCAGATAAAAAAGCAAAGC-3′2-a aa, amino acids. Open table in a new tab pREP1-GFP was constructed by removing the NdeI restriction site residing in the GFP(S65T) open reading frame using a silent mutation created by overlap extension PCR (24Horton R.M. Ho S.N. Pullen J.K. Hunt H.D. Cai Z. Pease L.R. Methods Enzymol. 1993; 217: 270-279Crossref PubMed Scopus (432) Google Scholar). The resulting fragment with BamHI and XmaI sites added by PCR was subcloned into pREP1. The ish1 ORF was PCR-amplified using primers sporf9 and sporf10 (Table II) that incorporated AseI andSalI restriction sites, and the product was cloned into pREP1-GFP, resulting in pREP-ish1-GFP and is referred to as pLT1-2. pLT1-2 was digested with BglII and BamHI to excise a fragment encoding Ish1 amino acids 581–684. The remaining vector backbone was gel-purified and then self-ligated to create pREP1-ish1ΔC104-GFP and is referred to as pLT1-3. An N-terminal deletion of Ish1 comprising amino acids 279–684 was made using primers sporf11 and sporf10 (Table II) that incorporateNdeI and SalI restriction sites. The productΔN278ish1 was then cloned into pREP1-GFP to create pREP1-ΔN278ish1-GFP and is referred to as pLT1-4. The entire ish1 gene from −351 to +2052 bp was PCR-amplified using primers sporf5 with sporf12 or sporf10 (Table II) incorporating PstI and SalI restriction sites. pREP1 was digested with PstI andSalI to excise the 1200-bp fragment encoding thenmt1 promoter sequence. The ish1 PCR products were cloned into the gel-purified vector backbones pREP1 or pREP1-GFP to create pLT2-1 or pLT2-2, respectively. PCR-based gene targeting (25Bahler J. Wu J.Q. Longtine M.S. Shah N.G. McKenzie III, A. Steever A.B. Wach A. Philippsen P. Pringle J.R. Yeast. 1998; 14: 943-951Crossref PubMed Scopus (1771) Google Scholar, 26Baudin A. Ozier-Kalogeropoulos O. Denouel A. Lacroute F. Cullin C. Nucleic Acids Res. 1993; 21: 3329-3330Crossref PubMed Scopus (1127) Google Scholar, 27Kaur R. Ingavale S.S. Bachhawat A.K. Nucleic Acids Res. 1997; 25: 1080-1081Crossref PubMed Scopus (25) Google Scholar) was used to replace a 1934-bp fragment of the ish1coding region with the ura4+ gene leaving 118 bp of the C-terminal ORF of ish1 (Fig.1 A). The PCR primers used, sporf1 and sporf2 (Table II), included 80 bp of flanking sequence homologous to the ish1 sequence in the genome. Gene replacement was confirmed by PCR using primers sporf3 and sporf4 (TableII) and Southern blot analysis. Sporulation of the diploid and extensive out-crossing (6 times) was performed to ensure that no background mutations were present. Bis1 was identified as a two-hybrid target interacting with Ish1. The bis1 gene from −254 to +1330 base pairs relative to the 1154-bp ORF was PCR-amplified using primers lanko1 and lanko2 (Table II) with High FidelityTaq polymerase (Roche Molecular Biochemicals). The PCR product was subcloned into pGEM-T (Promega) to create pGEM-T-bis1. pGEM-T-bis1 was digested withXbaI, and the ends were filled in using the Klenow fragment of DNA polymerase, and then the plasmid was digested withClaI. The ura4+ gene was excised from pZA25 using SmaI and ClaI restriction enzymes and subcloned into the XbaI (blunt-ended)/ClaI site of pGEM-T-bis1 to generate pGEM-T-bis1::ura4+ . Thebis1::ura4+ cassette in this recombinant vector was then PCR-amplified using High FidelityTaq polymerase (Roche Molecular Biochemicals) and used to replace bis1 in a haploid strain (ura4-D18 h− ) by one-step gene disruption (20Moreno S. Klar A. Nurse P. Methods Enzymol. 1991; 194: 795-823Crossref PubMed Scopus (3148) Google Scholar) (Fig.1 B). Stable ura4+ haploids were selected, and exact gene replacement was confirmed by PCR. The strain was out-crossed extensively to ensure that no background mutations were present. The bis1 ORF was PCR-amplified from genomic DNA using primers lan1 and lan2 or lan1 and lan3 (Table II), incorporating NdeI and SalI restriction sites, with High Fidelity Taq polymerase (Roche Molecular Biochemicals). The PCR products were cloned into pREP2 or pREP2-YFP containing the ura4-selectable marker (23Maundrell K. Gene (Amst.). 1993; 123: 127-130Crossref PubMed Scopus (931) Google Scholar), resulting in pREP2-bis1 and pREP2-bis1-YFPreferred to as pLT3-1 and pLT3-2, respectively. pLT3-1 and pLT3-2 were transformed into cells, and positive transformants were selected in the presence of 15 μm thiamine. The YFP gene from pEYFP (Invitrogen) was excised from the vector by digesting with EcoRI and blunt-ended using the Klenow fragment of DNA polymerase. The pREP2 vector was digested withSalI, and the blunt-ended YFP fragment was cloned into the SalI/SmaI sites of pREP2 to create pREP2-YFP. The full-length GST-Bis1 protein fusion was degraded in Escherichia coli.Therefore, a 354-bp fragment encoding amino acids 267–384 of the C-terminal region of bis1 was fused to the C terminus of GST in pGEX-2T (Amersham Biosciences). Expression was induced in E. coli with 1 mmisopropyl-1-thio-β-d-galactopyranoside at 37 °C for 1 h because this fusion protein was also rapidly degraded by proteases. The GST-Bis1 fusion protein was purified on a glutathione-agarose column and eluted with 10 mm reduced glutathione in 50 mm Tris-HCl, pH 8.0, as described in the manufacturer's manual (Amersham Biosciences). To generate polyclonal antibodies against Bis1, the GST-Bis1 fragment was separated on a 12% SDS-polyacrylamide gel, excised, eluted, and mixed with Titer Max Gold Adjuvant (Cedarlane) as described in the manufacturer's instructions. The rabbit was boosted at day 28 and day 40. Serum was collected on day 50 and used as a source of antibody for Western blot analysis and immunofluorescence experiments. A Leica fluorescence microscope equipped with a high performance CCD camera (Sensicam) and Slidebook software (Intelligent Imaging System) was used for all imaging. Cells were collected onto Whatman 934-AH glass microfiber filters (Fisher) and fixed with 100% ice-cold methanol at −20 °C for 20 min. The immunofluorescence protocol used is described in Sawin and Nurse (28Sawin K.E. Nurse P. J. Cell Sci. 1998; 97: 509-516Google Scholar). Rabbit GST-Bis1 polyclonal antiserum generated in the lab (1:5000) was used with AlexaTM 488 goat anti-rabbit IgG (H + L) conjugate (1:250) (Molecular Probes). Stained cells were counterstained with 1 μg/ml DAPI. Protein extracts (29Rhind N. Russell P. Mol. Cell. Biol. 1998; 18: 3782-3787Crossref PubMed Scopus (95) Google Scholar) (20 μg or 50 μg, Bio-Rad protein assay) were separated by 7.5 or 10% SDS-PAGE, electroblotted to a polyvinylidene difluoride membrane (Santa Cruz Biotechnology), and detected by polyclonal anti-GST-Bis1 antibody or monoclonal anti-GFP antibody (1:1000) (Roche Molecular Biochemicals). Immunoreactive bands were detected with a horseradish peroxidase-conjugated secondary goat anti-rabbit IgG antibody (Santa Cruz Biotechnology) or goat anti-mouse IgG antibody (1:2000) and the luminol-based ECL detection kit (Santa Cruz Biotechnology). Protein loading was monitored by Coomassie Blue staining of gels. Harvested cells in HB buffer (25 mm MOPS, pH 7.2, 60 mm β-glycerophosphate, 15 mm p-nitrophenyl phosphate, 15 mmMgCl2, 15 mm EGTA, 1 mmdithiothreitol, 0.1 mm sodium vanadate, 1% Triton X-100) (20Moreno S. Klar A. Nurse P. Methods Enzymol. 1991; 194: 795-823Crossref PubMed Scopus (3148) Google Scholar), supplemented with complete protease inhibitor mixture (Roche Molecular Biochemicals), were broken by vortexing with glass beads and centrifuged to prepare a cleared whole-cell extract. Cell extracts (300 μg, Bio-Rad protein assay) were incubated with 10 μl of polyclonal anti-GST-Bis1 antibody in a 500-μl volume in HB buffer at 4 °C for 3 h, and 60 μl of protein G-Sepharose beads (Amersham Biosciences) were added for 1 h at 4 °C. Beads were washed extensively with HB buffer, resuspended in 2× SDS loading buffer, and analyzed by SDS-PAGE. For immunoblot analysis, 25 μg of total protein was loaded for detection of proteins in the total yeast lysate; 10% of total immunoprecipitated material was loaded for detection of the immunoprecipitated protein, and 90% was loaded for detection of the coimmunoprecipitate. The proteins were subjected to immunoblot analysis as described above. Cells were grown to stationary phase in YEA or EMM medium, and incubation was continued for 6 days. A portion of each culture was removed at day 0, 1, 2, 4, and 6 and plated on YEA or EMM after appropriate dilution to determine cell viability. Samples were taken in duplicate over a 6-day period, and the experiment was independently repeated two times. DNA encoding amino acids 34–684 of ish1 (ΔN33ish1) was PCR-amplified with primers ish1lexA1 and ish1lexA2 (Table II) incorporating BamHI and NotI restriction sites using High Fidelity Taq polymerase (Roche Molecular Biochemicals). The ΔN33ish1 ORF was fused to the 3′ end of the LexA DNA-binding domain in pEG202 (30Gyuris J. Golemis E. Chertkov H. Brent R. Cell. 1993; 75: 791-803Abstract Full Text PDF PubMed Scopus (1324) Google Scholar) by cloning into theBamHI and NotI sites of pEG202 to construct pEG202-ΔN33ish1lexA. An S. pombe cDNA library (obtained from ATCC 87289) was screened (31Durfee T. Becherer K. Chen P.-L. Yeh S.-H. Yang Y. Kilburn A.E. Lee W.-H. Elledge S.J. Genes Dev. 1993; 7: 555-569Crossref PubMed Scopus (1300) Google Scholar). The two-hybrid experiments were performed with Saccharomyces cerevisiaestrain Y1003 (MAT a/MAT α URA3::lexAop-lacZ/8lexA-ADE2::URA3 ura3-1/ura3-1 leu2-2/leu2-3 his3-11/his3-11 trp1-1/trp1-1 ade2-1/ade2-1 can1-100/can1-100) (32Evangelista M. Blundell K. Longtine M.S. Chow C.J. Adams N. Pringle J.R. Peter M. Boone C. Science. 1997; 276: 118-122Crossref PubMed Scopus (532) Google Scholar). Approximately 3,000,000 cDNA clones were screened against the Ish1 bait. DNA encoding amino acids 91–384 of bis1 was PCR-amplified with primers bis1lexA(ΔN90) and bis1lexA3 (Table II) with High Fidelity Taq polymerase incorporating BamHI andNotI restriction sites. pEG202-ΔN90bis1lexA was constructed as outlined above. Approximately 2,000,000 cDNA clones were screened using this bait. An insertional mutagenesis cassette containing GFP on the 5′ terminus was used to isolate in-frame insertional mutants that expressed GFP (17Chua G. Taricani L. Stangle W. Young P.G. Nucleic Acids Res. 2000; 138: E53Crossref Scopus (35) Google Scholar). A GFP fusion, lt13-26, was isolated based on the localization of the GFP to the nuclear envelope and the plasma membrane under glucose starvation conditions. In zygotic asci the GFP localized only to the nuclear envelope (17Chua G. Taricani L. Stangle W. Young P.G. Nucleic Acids Res. 2000; 138: E53Crossref Scopus (35) Google Scholar). GFP expression increased by ∼5-fold following glucose and nitrogen starvation as well as during hyper- and hypo-osmotic stress (data not shown).lt13-26 is expressed throughout the cell cycle in growing cultures (Fig. 2 A). Sequencing revealed that lt13-26 was a single copy chromosomal fusion with an 873-bp 3′-truncation of the ish1 gene and expression remaining under the control of the ish1 native promoter. Cells expressing lt13-26 were indistinguishable from wild type cells with respect to growth and morphology. We will refer to the original integrant, lt13-26, as ish1ΔC291-GFPfrom this point. The predicted full-length ish1 gene product was a 684-amino acid protein of unknown function and a calculated molecular mass of 76 kDa (GenBank™ accession number AL07867.1, locus SPBC365.12c). Computer searches revealed a late embryogenesis abundant (LEA) motif from amino acids 227–285 and 366–452 (ProDom data base). LEA motif proteins are induced in plants by a variety of stresses including dessication, heat stress, and osmotic stress (33Dure III, L. Inclose T.J. Bray E.A. Plant Responses to Cellular Dehydration during Environmental Stress. American Society of Plant Physiology, Riverside, CA1993: 91-103Google Scholar, 34Ingram J. Bartels D. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1996; 47: 377-403Crossref PubMed Scopus (1777) Google Scholar). The LEA motif has also been identified in LEA-1, F25H58.5, and K08H10.2, proteins of unknown function in C. elegans. Ish1 exhibits 21–23% overall identity to these proteins (Proteome data base). Additionally, searches revealed a similarity to the C terminus of S. pombeSPAC23C4.05c (identity = 44:159 (27%), positives = 74:159 (45%)) as well as the N terminus of S. cerevisiae probable membrane protein YML128c (also known as Gin3p or Msc1p) (35Thompson D.A. Stahl F.W. Genetics. 1999; 153: 621-641PubMed Google Scholar) (identity = 46:362 (19%), positives = 87:362 (36%)). Ish1, SPAC23C4.05c, and YML128c have one putative transmembrane domain near their N termini. In the presence of thiamine to repress the nmt1 promoter, cells containingish1, ish1-GFP, ΔN278ish1-GFP, orish1ΔC104-GFP expression constructs displayed normal growth and morphology (Fig. 2 B). In the absence of thiamine, overexpression of ish1, ish1-GFP, andish1ΔC104-GFP was toxic, arresting cell proliferation (Fig. 2 B). Microscopic examination showed no obvious morphological changes, and arrest appears to be in G2 based on morphological criteria. Examination of the cells 15 h after induction showed similar localization of Ish1-GFP to that seen in the original integrant, ish1ΔC291-GFP (Fig.2 A). Overexpression of ΔN278ish1-GFP was not toxic. ΔN278Ish1-GFP appears to be retained in the endoplasmic reticulum (Fig. 2 C). This suggests that the N-terminal region is necessary for nuclear envelope and plasma membrane targeting and/or localization of Ish1. Deletion of the N-terminal sequence renders the protein incapable of normal localization thus sparing the toxic effects observed with the full-length protein. We speculate that Ish1 at high concentration somehow interferes with membrane function or the function of some protein in the membrane and that the observed toxicity is the result. Deletion of the N terminus of Ish1 renders the protein incapable of being correctly targeted, and the toxicity is thus not observed. Expression of ish1ΔC291-GFP is under the control of its native promoter; therefore, it was used to examine the expression of the Ish1 protein in various mutant backgrounds. Western blotting performed using a monoclonal anti-GFP antibody shows that Ish1ΔC291-GFP has a molecular mass of ∼90 kDa, whereas Ish1-GFP migrates at ∼120 kDa (Fig. 3,A and B). The other bands in the Western blot are the result of nonspecific binding of the GFP antibody, which are detected in wild type cells not expressing GFP. Ish1ΔC291-GFP expression was examined in a Δspc1 mutant strain to inactivate the MAPK pathway (14Kanoh J. Watanabe Y. Ohsugi M. Iino Y. Yamamoto M. Genes Cells. 1996; 1: 391-408Crossref PubMed Scopus (116) Google Scholar) and in a Δpyp1mutant strain, an inhibitor of Spc1, to activate it (12Shiozaki K. Russell P. Nature. 1995; 378: 739-743Crossref PubMed Scopus (397) Google Scholar). Ish1ΔC291-GFP protein expression is almost undetectable in aΔspc1 mutant strain (Fig. 3 A). However, increased activity of Spc1 as occurs in a Δpyp1 mutant strain resulted in an ∼10-fold increase in Ish1 expression (Fig.3 A). Because expression and activity of Atf1 are regulated by Spc1 MAPK (13Shiozaki K. Russell P. Genes Dev. 1996; 10: 2276-2288Crossref PubMed Scopus (367) Google Scholar), we examined Ish1 expression in a Δatf1 mutant background. There is no detectable level of Ish1 protein in theΔatf1 mutant background (Fig. 3 A) showing that Ish1 is regulated by the Spc1 MAPK pathway via Atf1. In a Δatf1 Δpyp1 mutant background, Ish1 is detectable but very low, suggesting that when Spc1 is hyperactivated a second transcription factor might make a small contribution. The response to osmotic stress occurs at least in part throughatf1 (13Shiozaki K. Russell P. Genes Dev. 1996; 10: 2276-2288Crossref PubMed Scopus (367) Google Scholar). Under 1.2 m KCl stress, Ish1 expression in a Δpyp1 mutant background is similar to that in" @default.
• W2034206299 created "2016-06-24" @default.
• W2034206299 creator A5020210255 @default.
• W2034206299 creator A5084345191 @default.
• W2034206299 creator A5086930071 @default.
• W2034206299 date "2002-03-01" @default.
• W2034206299 modified "2023-09-30" @default.
• W2034206299 title "The Fission Yeast ES2 Homologue, Bis1, Interacts with the Ish1 Stress-responsive Nuclear Envelope Protein" @default.
• W2034206299 cites W1519084876 @default.
• W2034206299 cites W1537669298 @default.
• W2034206299 cites W1588570062 @default.
• W2034206299 cites W1798315881 @default.
• W2034206299 cites W1910125601 @default.
• W2034206299 cites W1912625738 @default.
• W2034206299 cites W1965102448 @default.
• W2034206299 cites W1968586346 @default.
• W2034206299 cites W1976730377 @default.
• W2034206299 cites W1980881084 @default.
• W2034206299 cites W1990265320 @default.
• W2034206299 cites W1993051064 @default.
• W2034206299 cites W2012600705 @default.
• W2034206299 cites W2018876412 @default.
• W2034206299 cites W2019125570 @default.
• W2034206299 cites W2019308686 @default.
• W2034206299 cites W2019797615 @default.
• W2034206299 cites W2032241710 @default.
• W2034206299 cites W2038862228 @default.
• W2034206299 cites W2042368221 @default.
• W2034206299 cites W2058582467 @default.
• W2034206299 cites W2063826622 @default.
• W2034206299 cites W2071497657 @default.
• W2034206299 cites W2071636295 @default.
• W2034206299 cites W2071993841 @default.
• W2034206299 cites W2074699467 @default.
• W2034206299 cites W2079818352 @default.
• W2034206299 cites W2080408951 @default.
• W2034206299 cites W2100254469 @default.
• W2034206299 cites W2101288641 @default.
• W2034206299 cites W2103678110 @default.
• W2034206299 cites W2104818427 @default.
• W2034206299 cites W2113576985 @default.
• W2034206299 cites W2115816976 @default.
• W2034206299 cites W2125239190 @default.
• W2034206299 cites W2128175005 @default.
• W2034206299 cites W2136891997 @default.
• W2034206299 cites W2137683543 @default.
• W2034206299 cites W2142946131 @default.
• W2034206299 cites W2151311269 @default.
• W2034206299 cites W2151625863 @default.
• W2034206299 cites W2159686532 @default.
• W2034206299 cites W2171885241 @default.
• W2034206299 cites W2181469541 @default.
• W2034206299 cites W2194986544 @default.
• W2034206299 cites W297648665 @default.
• W2034206299 cites W79957767 @default.
• W2034206299 doi "https://doi.org/10.1074/jbc.m110686200" @default.
• W2034206299 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11751918" @default.
• W2034206299 hasPublicationYear "2002" @default.
• W2034206299 type Work @default.
• W2034206299 sameAs 2034206299 @default.
• W2034206299 citedByCount "29" @default.
• W2034206299 countsByYear W20342062992012 @default.
• W2034206299 countsByYear W20342062992013 @default.
• W2034206299 countsByYear W20342062992014 @default.
• W2034206299 countsByYear W20342062992015 @default.
• W2034206299 countsByYear W20342062992016 @default.
• W2034206299 countsByYear W20342062992017 @default.
• W2034206299 countsByYear W20342062992018 @default.
• W2034206299 countsByYear W20342062992019 @default.
• W2034206299 countsByYear W20342062992020 @default.
• W2034206299 countsByYear W20342062992021 @default.
• W2034206299 countsByYear W20342062992022 @default.
• W2034206299 crossrefType "journal-article" @default.
• W2034206299 hasAuthorship W2034206299A5020210255 @default.
• W2034206299 hasAuthorship W2034206299A5084345191 @default.
• W2034206299 hasAuthorship W2034206299A5086930071 @default.
• W2034206299 hasBestOaLocation W20342062991 @default.
• W2034206299 hasConcept C104317684 @default.
• W2034206299 hasConcept C121332964 @default.
• W2034206299 hasConcept C12294094 @default.
• W2034206299 hasConcept C152568617 @default.
• W2034206299 hasConcept C185592680 @default.
• W2034206299 hasConcept C2777576037 @default.
• W2034206299 hasConcept C2779222958 @default.
• W2034206299 hasConcept C29512474 @default.
• W2034206299 hasConcept C41008148 @default.
• W2034206299 hasConcept C554190296 @default.
• W2034206299 hasConcept C55493867 @default.
• W2034206299 hasConcept C62520636 @default.
• W2034206299 hasConcept C65155139 @default.
• W2034206299 hasConcept C76155785 @default.
• W2034206299 hasConcept C86339819 @default.
• W2034206299 hasConcept C86803240 @default.
• W2034206299 hasConcept C95444343 @default.
• W2034206299 hasConceptScore W2034206299C104317684 @default.
• W2034206299 hasConceptScore W2034206299C121332964 @default.
• W2034206299 hasConceptScore W2034206299C12294094 @default.
• W2034206299 hasConceptScore W2034206299C152568617 @default.

• next