FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2079752494> ?p ?o ?g. }

• W2079752494 endingPage "22881" @default.
• W2079752494 startingPage "22873" @default.
• W2079752494 abstract "The methylation of adenine in palindromic 5′-GATC-3′ sites by Escherichia coli Dam supports diverse roles, including the essential regulation of virulence genes in several human pathogens. As a result of a unique hopping mechanism, Dam methylates both strands of the same site prior to fully dissociating from the DNA, a process referred to as intrasite processivity. The application of a DpnI restriction endonuclease-based assay allowed the direct interrogation of this mechanism with a variety of DNA substrates. Intrasite processivity is disrupted when the DNA flanking a single GATC site is longer than 400 bp on either side. Interestingly, the introduction of a second GATC site within this flanking DNA reinstates intrasite methylation of both sites. Our results show that intrasite methylation occurs only when GATC sites are clustered, as is found in gene segments both known and postulated to undergo in vivo epigenetic regulation by Dam methylation. We propose a model for intrasite methylation in which Dam bound to flanking DNA is an obligate intermediate. Our results provide insights into how intrasite processivity, which appears to be context-dependent, may contribute to the diverse biological roles that are carried out by Dam.Background: The DNA adenine methyltransferase has several functions, including epigenetic gene regulation.Results: Processivity of Dam is influenced by the extent and sequence of flanking DNA.Conclusion: Activity of Dam is modulated by the clustering of GATC sites, which occurs in known regulatory regions.Significance: Differing mechanisms of Dam can help explain its diverse roles, including its participation in virulence regulation. The methylation of adenine in palindromic 5′-GATC-3′ sites by Escherichia coli Dam supports diverse roles, including the essential regulation of virulence genes in several human pathogens. As a result of a unique hopping mechanism, Dam methylates both strands of the same site prior to fully dissociating from the DNA, a process referred to as intrasite processivity. The application of a DpnI restriction endonuclease-based assay allowed the direct interrogation of this mechanism with a variety of DNA substrates. Intrasite processivity is disrupted when the DNA flanking a single GATC site is longer than 400 bp on either side. Interestingly, the introduction of a second GATC site within this flanking DNA reinstates intrasite methylation of both sites. Our results show that intrasite methylation occurs only when GATC sites are clustered, as is found in gene segments both known and postulated to undergo in vivo epigenetic regulation by Dam methylation. We propose a model for intrasite methylation in which Dam bound to flanking DNA is an obligate intermediate. Our results provide insights into how intrasite processivity, which appears to be context-dependent, may contribute to the diverse biological roles that are carried out by Dam. Background: The DNA adenine methyltransferase has several functions, including epigenetic gene regulation. Results: Processivity of Dam is influenced by the extent and sequence of flanking DNA. Conclusion: Activity of Dam is modulated by the clustering of GATC sites, which occurs in known regulatory regions. Significance: Differing mechanisms of Dam can help explain its diverse roles, including its participation in virulence regulation. The monomeric Escherichia coli Dam 2The abbreviation used is: DamDNA adenine methyltransferase. methylates adenines at the N6 position of palindromic 5′-GATC-3′ sites (1Herman G.E. Modrich P. Escherichia coli dam methylase: physical and catalytic properties of the homogeneous enzyme.J. Biol. Chem. 1982; 257: 2605-2612Abstract Full Text PDF PubMed Google Scholar). Unlike the majority of bacterial DNA methyltransferases, Dam lacks a cognate endonuclease. Dam is involved in the mismatch repair system (2Wion D. Casadesús J. N6-methyl-adenine: an epigenetic signal for DNA-protein interactions.Nat. Rev. Microbiol. 2006; 4: 183-192Crossref PubMed Scopus (382) Google Scholar), chromosome replication (3Marinus M.G. Casadesus J. Roles of DNA adenine methylation in host-pathogen interactions: mismatch repair, transcriptional regulation, and more.FEMS Microbiol. Rev. 2009; 33: 488-503Crossref PubMed Scopus (211) Google Scholar), nucleoid structure determination (4Touzain F. Petit M.A. Schbath S. El Karoui M. DNA motifs that sculpt the bacterial chromosome.Nat. Rev. Microbiol. 2011; 9: 15-26Crossref PubMed Scopus (41) Google Scholar), and gene regulation (5Broadbent S.E. Davies M.R. van der Woude M.W. Phase variation controls expression of Salmonella lipopolysaccharide modification genes by a DNA methylation-dependent mechanism.Mol. Microbiol. 2010; 77: 337-353Crossref PubMed Scopus (88) Google Scholar, 6Casadesús J. Low D. Epigenetic gene regulation in the bacterial world.Microbiol. Mol. Biol. Rev. 2006; 70: 830-856Crossref PubMed Scopus (403) Google Scholar). Known and putative dam genes are co-conserved with MutH, a key protein for mismatch repair (7Løbner-Olesen A. Skovgaard O. Marinus M.G. Dam methylation: coordinating cellular processes.Curr. Opin. Microbiol. 2005; 8: 154-160Crossref PubMed Scopus (195) Google Scholar). Immediately after replication, only the parental strand is methylated, which guides the mismatch repair system; these hemimethylated GATC sites are the substrate of Dam. Although nearly all of the 20,000 GATC sites in E. coli are involved in mismatch repair, ∼0.1% of these are excluded from this process (8Ringquist S. Smith C.L. The Escherichia coli chromosome contains specific, unmethylated dam dcm sites.Proc. Natl. Acad. Sci. U.S.A. 1992; 89: 4539-4543Crossref PubMed Scopus (63) Google Scholar) and can be heritably unmethylated. However, these sites can be methylated upon differing environmental conditions (9Tavazoie S. Church G.M. Quantitative whole-genome analysis of DNA-protein interactions by in vivo methylase protection in E. coli.Nat. Biotechnol. 1998; 16: 566-571Crossref PubMed Scopus (74) Google Scholar), suggesting that they may be involved in gene regulation. The methylation state of a subset of these GATC sites epigenetically regulates gene transcription (Fig. 1) such as the pap (10Hernday A.D. Braaten B.A. Low D.A. The mechanism by which DNA adenine methylase and PapI activate the pap epigenetic switch.Mol. Cell. 2003; 12: 947-957Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar), gtr (5Broadbent S.E. Davies M.R. van der Woude M.W. Phase variation controls expression of Salmonella lipopolysaccharide modification genes by a DNA methylation-dependent mechanism.Mol. Microbiol. 2010; 77: 337-353Crossref PubMed Scopus (88) Google Scholar), and agn43 (11Kaminska R. van der Woude M.W. Establishing and maintaining sequestration of Dam target sites for phase variation of agn43 in Escherichia coli.J. Bacteriol. 2010; 192: 1937-1945Crossref PubMed Scopus (13) Google Scholar) promoters, where GATC sites switch between the unmethylated to the fully methylated states. DNA adenine methyltransferase. GATC sites known and postulated to be involved in gene regulation are highly clustered (supplemental Fig. 1, supplemental Table 1) and have unique flanking sequences in comparison with the majority of genomic GATC sites (6Casadesús J. Low D. Epigenetic gene regulation in the bacterial world.Microbiol. Mol. Biol. Rev. 2006; 70: 830-856Crossref PubMed Scopus (403) Google Scholar). Some sites have a conserved A-tract 5′ to the GATC site, which affects the methylation rate and the intersite processive methylation of the enzyme (12Coffin S.R. Reich N.O. Modulation of Escherichia coli DNA methyltransferase activity by biologically derived GATC-flanking sequences.J. Biol. Chem. 2008; 283: 20106-20116Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar, 13Peterson S.N. Reich N.O. GATC flanking sequences regulate Dam activity: evidence for how Dam specificity may influence pap expression.J. Mol. Biol. 2006; 355: 459-472Crossref PubMed Scopus (51) Google Scholar). An A-tract is referred to as a nonpreferred flank, whereas most non-AT-rich flanks are referred to as preferred. Intersite processivity refers to the ability of an enzyme to modify two or more sites without dissociating. Other sites have AT-rich flanks, which have modestly lowered methylation rates, and most have A-tracts near and around the GATC sites. It appears as if these transiently unmethylated GATC sites are in similar DNA contexts, in the small minority of regulatory sites in the E. coli genome, distinguishable from the majority of other GATC sites. Upon more robust classifications, these sites may form a set of “molecular rules” (14van der Woude M.W. Phase variation: how to create and coordinate population diversity.Curr. Opin. Microbiol. 2011; 14: 205-211Crossref PubMed Scopus (112) Google Scholar), providing a basis for identifying new epigenetically regulated operons and giving insight into the function of the other unmethylated GATC sites in the E. coli genome. We want to explore how Dam behaves at these unique regions. Initial studies on unmethylated DNA showed that Dam is able to methylate the adenines on both DNA strands within a single cognate site before dissociation, which was referred to as intrasite processivity (15Coffin S.R. Reich N.O. Escherichia coli DNA adenine methyltransferase: intrasite processivity and substrate-induced dimerization and activation.Biochemistry. 2009; 48: 7399-7410Crossref PubMed Scopus (16) Google Scholar). To accomplish this, the enzyme must switch strands and reorient itself, breaking and reforming its contacts with the DNA (Fig. 2A). The restriction endonucleases BfiI (16Sasnauskas G. Zakrys L. Zaremba M. Cosstick R. Gaynor J.W. Halford S.E. Siksnys V. A novel mechanism for the scission of double-stranded DNA: BfiI cuts both 3′-5′ and 5′-3′ strands by rotating a single active site.Nucleic Acids Res. 2010; 38: 2399-2410Crossref PubMed Scopus (23) Google Scholar) and BcnI (17Sasnauskas G. Kostiuk G. Tamulaitis G. Siksnys V. Target site cleavage by the monomeric restriction enzyme BcnI requires translocation to a random DNA sequence and a switch in enzyme orientation.Nucleic Acids Res. 2011; 39: 8844-8856Crossref PubMed Scopus (15) Google Scholar), which cleave both strands of DNA within one cognate site, appear to rely on a similar reorientation of a single active site. The phenomenon of intrasite processivity is suggestive of hopping, where proteins interact with and move along DNA not only by one-dimensional sliding, but by using several dissociation-reassociation steps (18Halford S.E. Marko J.F. How do site-specific DNA-binding proteins find their targets?.Nucleic Acids Res. 2004; 32: 3040-3052Crossref PubMed Scopus (710) Google Scholar, 19Stanford N.P. Szczelkun M.D. Marko J.F. Halford S.E. One- and three-dimensional pathways for proteins to reach specific DNA sites.EMBO J. 2000; 19: 6546-6557Crossref PubMed Scopus (155) Google Scholar). Although diverse techniques have been used to show that several proteins rely on mechanisms other than sliding (20Tafvizi A. Mirny L.A. van Oijen A.M. Dancing on DNA: kinetic aspects of search processes on DNA.Chem. Phys. Chem. 2011; 12: 1481-1489Crossref Scopus (106) Google Scholar, 21Vuzman D. Azia A. Levy Y. Searching DNA via a “Monkey Bar” mechanism: the significance of disordered tails.J. Mol. Biol. 2010; 396: 674-684Crossref PubMed Scopus (121) Google Scholar), there are limited details about how hopping works. Hopping has generated significant interest as a way to understand how proteins can efficiently find their recognition sites when an overwhelming excess of nonspecific DNA is present (22Zhou H.X. Rapid search for specific sites on DNA through conformational switch of nonspecifically bound proteins.Proc. Natl. Acad. Sci. U.S.A. 2011; 108: 8651-8656Crossref PubMed Scopus (70) Google Scholar). Hopping has also been used to explain how an enzyme can processively modify DNA when two or more sites have the opposite strand orientation, requiring the enzyme to reorient itself between modifying the first and subsequent sites (Fig. 2B). Importantly, during this process, the enzyme has a greater probability of rebinding the original DNA molecule than binding to another DNA molecule. Several enzymes display this activity, including T4 Dam (23Zinoviev V.V. Evdokimov A.A. Malygin E.G. Sclavi B. Buckle M. Hattman S. Differential methylation kinetics of individual target site strands by T4 Dam DNA methyltransferase.Biol. Chem. 2007; 388: 1199-1207Crossref PubMed Scopus (5) Google Scholar), uracil DNA glycosylase (24Porecha R.H. Stivers J.T. Uracil DNA glycosylase uses DNA hopping and short-range sliding to trap extrahelical uracils.Proc. Natl. Acad. Sci. U.S.A. 2008; 105: 10791-10796Crossref PubMed Scopus (115) Google Scholar), human alkyladenine DNA glycosylase (25Hedglin M. O'Brien P.J. Hopping enables a DNA repair glycosylase to search both strands and bypass a bound protein.ACS Chem. Biol. 2010; 5: 427-436Crossref PubMed Scopus (55) Google Scholar), and BbvcI restriction endonucleases (26Gowers D.M. Wilson G.G. Halford S.E. Measurement of the contributions of one-dimensional and three-dimensional pathways to the translocation of a protein along DNA.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 15883-15888Crossref PubMed Scopus (198) Google Scholar). Given the diversity of enzymes that can switch DNA strands and the general lack of mechanistic understanding of the underlying processes, we sought to explore the factors that regulate the intrasite hopping mechanism of Dam. Our original description of intrasite methylation by Dam relied on short, single site synthetic double-stranded DNA (15Coffin S.R. Reich N.O. Escherichia coli DNA adenine methyltransferase: intrasite processivity and substrate-induced dimerization and activation.Biochemistry. 2009; 48: 7399-7410Crossref PubMed Scopus (16) Google Scholar). In contrast, prior work with plasmids showed that this activity is largely suppressed (1Herman G.E. Modrich P. Escherichia coli dam methylase: physical and catalytic properties of the homogeneous enzyme.J. Biol. Chem. 1982; 257: 2605-2612Abstract Full Text PDF PubMed Google Scholar), suggesting that flanking DNA segments longer than those used in our original studies may regulate this activity. Although the majority of GATC sites on the bacterial genome are predicted to be separated by ∼260 bp, GATC sites known and postulated to be involved in gene regulation are generally separated by ∼10–100 bp (supplemental Fig. 1). The purpose of this study is to characterize how the sequence contexts of GATC sites, specifically their clustering, regulate the intrasite processivity of Dam, with the goal of better understanding the mechanisms of the varied roles of Dam in the cell. We also want to explore how proteins are able to processively modify their cognate sites by switching strands. All restriction endonucleases were obtained from New England Biolabs. All synthetic DNA substrates and primers were obtained from Integrated DNA Technologies and Midland Certified Reagent and were resuspended in TE buffer (10 mm Tris, pH 7.5, 1 mm EDTA). They were annealed with their reverse complements in a 1:1 mixture for 5 min at 95 °C and allowed to cool to room temperature (∼5 h). Annealing was verified by PAGE. Substrate 1A (see Table 1) is 5′-GTTCGTCATGCATGCAATGGAAAAGATCAGGTACCTGAATCACGAACGTTAGGCATTCGC-3′. The substrate used in the mutant analysis (see Fig. 6) is: 5′-ATCGTGGACTTCTACTTGGATGGAGGATCGGATGACACGTATTCCAGGAATTCACGTTAC-3′. The production of several PCR amplicons used the following strategy. A synthetic oligonucleotide with two GATC sites and two restriction sites between the GATC sites was cloned into plasmid pBR322 (New England Biolabs). 362- and 777-bp spacers were generated by PCR and cloned into the plasmid, generating different distances between the GATC sites. These plasmids were PCR-amplified with different primers to adjust the spacings from the GATC sites to the ends of the DNA. The same strategy applied to an engineered vector with a single GATC site.TABLE 1Intrasite processivity is modulated by lengths of flanking DNAFIGURE 6Intrasite processivity of Dam mutants. The tritium data (closed circle) and DpnI data (inverted gray triangle) for Dam mutants with a 60-bp substrate are shown. A, K139A; B, N132A; C, R116A; D, R95A; E, N126A. Only E is sequential. Error bars represent between 2 and 5 replicates, mean ± S.D.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The following substrates were cloned into the plasmid pBR322 at the EcoRI and HindIII sites: double site, 5′-AATTCGGTGATCTTTTCGACCCGGGAGCTGGTAGTATGCCCATGGTTCGATCTTTTGCCA-3′, and single site, 5′AATTCGGTGATCTTTTCGACCCGGGAGCTGGTAGTATGCCCATGGTTCGGTCTTTTGCCA-3′, making new plasmids called pBRMut0double and pBRMut0single. The cloned, synthetic insert had additional cloning sites within it: XmaI and NcoI (bolded and italicized). These sites were used to insert PCR-purified spacers between the two GATC site(s) (underlined). Upon PCR amplification, the spacers were digested with XmaI and NcoI to generate overhangs. The spacers were generated by PCR from the plasmid pBR322 with restriction sites using the same forward primer: 5′-ATTCCCGGGGGCTACCCTGTGGAACACCT-3′,with different reverse primers for each sized spacer: substrates 2C and 2D from Table 1, 5′-TAATCCATGGGCAGCTGCGGTAAAGCTCAT-3′, substrate 2E from Table 1, 5′-TAATCCATGGCATGTTCTTTCCTGCGTTATCCCC-3′.Plasmid pBRMut0 was digested, and the spacers were inserted, making plasmids pBRMut2 and pBRMut3. Amplicons with 115/119-bp flanking GATC sites were amplified from plasmid pBRMut0,2,3 using primers: forward, 5′-GGGTTCCGCGCACATTTCCC-3′ and reverse, 5′-CCAGGGTGACGGTGCCGAGG-3′. Amplicons with 300-bp flanking GATC sites were amplified from plasmid pBRMut0,2,3 using primers: forward, 5′-GCATCTTTTACTTTCACCAGCG-3′, and reverse, 5′-GGCTCCAAGTAGCGAAGCGAGC-3′. PCR amplicons were purified using the Agilent PCR clean-up kit and ethanol-precipitated to achieve the desired concentrations. All single turnover reactions were done in methylation reaction buffer (100 mm Tris, pH 8.0, 1 mm EDTA, 1 mm DTT, 0.2 mg/ml BSA) with 400 nm DNA, 420 nm Dam, 0.2 mg/ml BSA, and 30 μm S-adenosylmethionine (6 Ci/mmol mixture of unlabeled and [3H]methyl-labeled, PerkinElmer Life Sciences). Reactions were initiated with DNA with a total volume ranging from 60 to 80 μl and were done at 15 °C. 8-μl reaction fractions were quenched with 8 μl of 1% SDS. 14.5-μl quenched fractions were spotted on DE81 filter paper. The paper was washed three times with a 50 mm KH2PO4 buffer, washed once in 80% ethanol, washed once in 95% ethanol, and dried in diethyl-ether; all washing steps were for 5 min. Papers were dried and submerged in Bio-Safe II scintillation fluid. Tritium levels were quantified using a Beckman Coulter LS6500 scintillation counter and converted to nm of DNA product. Plateau levels of 100% were defined by the complete methylation-available adenines in the reaction mixture. All single turnover tritium reactions were fit to a single exponential (Equation 1, A0 is the plateau level, which is 100%).Percentage of Conversion=A0(1−e−kt)(Eq. 1) 2.5 μl of the single turnover (here, 30 μm of unlabeled S-adenosylmethionine) assay was heat-inactivated in 14.8 μl of 75 °C water for 20 min. After slow cooling, 2 μl of NEBuffer 4 was added, and the mixture was incubated at 37 °C for ∼20 min. 0.7 μl of DpnI was added to NEBuffer (14 units), and the solution was rapidly mixed. The cutting reaction proceeded for 10 min at 37 °C until it was heat-inactivated in an 80 °C water bath for 20 min and slow-cooled to room temperature for subsequent gel analysis. The reaction products were analyzed using PAGE (20–5% 29:1 acrylamide:bisacrylamide, depending on substrate length) for 2 h at 300 V in Tris-boric acid EDTA. Gels were stained with SybrAu and scanned on a Typhoon PhosphorImager (GE Healthcare). Nucleic acids were quantified using the software provided with the Typhoon. The densities of the different nucleic acid bands after several hours of reaction incubation (complete methylation) and subsequent digestion with the DpnI restriction endonuclease are defined as having the reaction being 100% complete (supplemental Figs. 2 and 4, which include sample gels). The competition experiment consisted of a single turnover reaction with substrate 1A, to which an equimolar amount of a 500-bp nonspecific (no GATC sites) piece of DNA was added. The reaction was initiated with a mixture of substrate 1A and the nonspecific DNA. The nonspecific DNA was generated by PCR using plasmid pBR322 as a template and the forward primer 5′-ATTCCCGGGGGCTACCCTGTGGAACACCT-3′ and the reverse primer 5′-TAATCCATGGCCCGGCATCCGCTTACAGAC-3′. Dam was expressed and purified as described previously (27Mashhoon N. Carroll M. Pruss C. Eberhard J. Ishikawa S. Estabrook R.A. Reich N. Functional characterization of Escherichia coli DNA adenine methyltransferase, a novel target for antibiotics.J. Biol. Chem. 2004; 279: 52075-52081Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). In summary, Dam was overexpressed in XL2 Blue (Stratagene) E. coli cells grown at 37 °C in LB media with 25 μg/ml kanamycin and 12.5 μg/ml tetracycline. After reaching an optical density of 0.4–0.6, the cells were induced with 1 mm isopropyl-1-thio-β-d-galactopyranoside and 0.05% l-arabinose and grown for 2 h. The pellets were resuspended in 40 ml of P11 buffer (50 mm potassium phosphate, pH 7.4, 10 mm β-mercaptoethanol, 1 mm EDTA, 1 mm PMSF, 0.2 mm NaCl, 10% glycerol) and lysed by sonication: 70% amplitude, 2 s on, 15 s off, total time 1 min. Lysate was centrifuged for 60 min at 15,000 rpm at 4 °C. Supernatant was loaded onto a 60-ml phosphocellulose (Whatman) column. The protein was eluted with a salt gradient from 0.2 and 0.8 m NaCl, and fractions with Dam were pooled and dialyzed in Blue Sepharose buffer (20 mm potassium phosphate buffer, pH 7.0, 10 mm β-mercaptoethanol, 1 mm EDTA, 1 mm PMSF, 10% glycerol). Upon overnight dialysis, the protein was loaded onto a 20-ml Blue Sepharose 6 FastFlow (GE Healthcare) column and eluted with a salt gradient between 0 and 1.5 m NaCl. Fractions were pooled and flash frozen at −80 °C. The protein concentration was determined using the extinction coefficient of 1.16 mg−1cm−1 at 280 nm. The original evidence for intrasite processive methylation relied on single turnover experiments and a tritiated S-adenosylmethionine assay with a single site 21-bp double-stranded DNA substrate (15Coffin S.R. Reich N.O. Escherichia coli DNA adenine methyltransferase: intrasite processivity and substrate-induced dimerization and activation.Biochemistry. 2009; 48: 7399-7410Crossref PubMed Scopus (16) Google Scholar). For Dam, product release is rate-limiting, and the observed rate constant from a single turnover reaction is the methyl transfer rate constant, kchem (27Mashhoon N. Carroll M. Pruss C. Eberhard J. Ishikawa S. Estabrook R.A. Reich N. Functional characterization of Escherichia coli DNA adenine methyltransferase, a novel target for antibiotics.J. Biol. Chem. 2004; 279: 52075-52081Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). Our experiments are defined as single turnover because enzyme is in excess of DNA molecules, but not available adenines, and the addition of more enzyme does not alter kchem (data not shown). The tritium assay measures total methylation, which can be both single and double methylation (of a single site, which has two adenines); it cannot be used to directly monitor the formation of double methylation. Here, we sought to track double methylation events exclusively. To address this, we developed an assay using the restriction endonuclease DpnI, which cuts doubly methylated GATC sites significantly more efficiently than hemimethylated sites. We optimized conditions so that no hemimethylated DNA was cut and >85% of doubly methylated DNA was cut (supplemental Materials and Methods, supplemental Fig. 2). This was done to confirm that the reaction defined as intrasite processive involved no hemimethylated intermediates. To validate this assay, the DpnI cutting profile was compared with the tritium assay, giving the same rate constant (Fig. 3A). This confirms that for this substrate (1B from Table 1), both experimental methods, which are identical except for the readout, measure the rate of double methylation, the action defined as intrasite processivity. Dam does not always display intrasite processivity, as demonstrated by a delay in the DpnI cutting profile in comparison with the tritium data (Fig. 3B, substrate 1C, Table 1). The discrepancy in the observed activity of the two methods is attributed to the presence of a hemimethylated intermediate, which is enumerated in the tritium assay, but not by DpnI. Using the tritium data, the DpnI data, and kinetic modeling, we confirmed that this delay represents an almost completely non-intrasite processive mechanism, which will be referred to as sequential. For the sequential reaction, Dam methylates one strand and then completely dissociates from the DNA before returning to methylate the second strand. The ability of Dam to fully methylate a GATC site can be simplified into the reaction scheme in Fig. 3C, and the individual components can be tracked by (Eq. 2), (Eq. 3), (Eq. 4) (k1 and k2 are as described in Fig. 3; A0 is the plateau level, which is 100%) regardless of its methylation mechanism (28Fersht A. Structure and Mechanism in Protein Science. W. H. Freeman, New York1998: 143-145Google Scholar). These equations are used to relate the tritium data to the DpnI data, both of which are read-outs for the same reaction. Although k1 and k2 represent observed rates of methylation, imbedded in each term are several other events, such as DNA binding, translocation, and methylation. Several groups have used the strategy employed here of directly monitoring activity, not including the other microscopic rate constants, to model processive, nonprocessive, and partially processive events (24Porecha R.H. Stivers J.T. Uracil DNA glycosylase uses DNA hopping and short-range sliding to trap extrahelical uracils.Proc. Natl. Acad. Sci. U.S.A. 2008; 105: 10791-10796Crossref PubMed Scopus (115) Google Scholar, 26Gowers D.M. Wilson G.G. Halford S.E. Measurement of the contributions of one-dimensional and three-dimensional pathways to the translocation of a protein along DNA.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 15883-15888Crossref PubMed Scopus (198) Google Scholar). Processivity is defined simply as the relative enhancement in k2 over k1. Knowing the values of k1 and k2 allows one to profile individual species of the reaction separately, showing the amount of single methylation, double methylation, and total methylation (which is a combination of single and double methylation) at any time point. The double methylation product profile is equivalent to the DpnI data. Total methylation, reflecting the sum of hemimethylation (B, Equation 2) and double methylation (C, Equation 3), is equivalent to the tritium data (Equation 4). Therefore, k1 and k2 can be modeled using a least squares fit such that the tritium data match the trace from Equation 4 and the DpnI data match the trace for Equation 3 (Fig. 3D). In summary, the legitimacy of the DpnI assay is confirmed by deriving rate constants from the DpnI data and matching the trace with the tritium data. Hemimethylation (B)=(A0k1/(k2−k1))(e−k1t−e−k2t)(Eq. 2) Double methylation (C)=A0[1+(1/(k1−k2))(k2e−k1t−k1e−k2t)](Eq. 3) Total methylation=B+2C(Eq. 4) For an intrasite processive event, k2 is much faster than k1; the initial methylation is followed by a rapid methylation of the opposite strand with no detectable hemimethylated products. The enhancement in k2 comes from the enzyme maintaining contact with the DNA during both methylations, foregoing dissociation and rebinding steps. Alternatively, for a sequential reaction, each methylation event involves free enzyme poised to bind DNA, and the first methylation event would not affect the second methylation. Because the rate of the methylation of hemimethylated to fully methylated is close to that of nonmethylated to fully methylated, k1 would be predicted to be similar to k2 for a sequential process (15Coffin S.R. Reich N.O. Escherichia coli DNA adenine methyltransferase: intrasite processivity and substrate-induced dimerization and activation.Biochemistry. 2009; 48: 7399-7410Crossref PubMed Scopus (16) Google Scholar). Because enzymes can display a gradient of processivity, several ratios of k2:k1 were modeled to predict the DpnI traces of partially processive scenarios (supplemental Fig. 3). Notably, when k2 is only 10-fold larger than k1, the DpnI trace matches the tritium trace. This suggests that there is a narrow window of possible rate constants between sequential and intrasite methylation. A sequential process requires the enzyme to undergo product dissociation, the rate-limiting step, and release of the cofactor product before the second methylation step can occur. These processes could make k2 slower than the observed rate of k1. Given this reasoning, it is impossible to define what ratio of k1:k2 would constitute a truly sequential process. Interestingly, the tritium data fit to a single exponential (one observable rate constant) for both sequential and intrasite methylation. This observation can be rationalized. If the site is methylated entirely via an intrasite mechanism, the second rate constant is too fast to be detectable; when sequential, the two rate constants approach each other, again resulting in what appears to be a single exponential. Intrasite proce" @default.
• W2079752494 created "2016-06-24" @default.
• W2079752494 creator A5064531954 @default.
• W2079752494 creator A5066521467 @default.
• W2079752494 date "2012-06-01" @default.
• W2079752494 modified "2023-09-27" @default.
• W2079752494 title "Proximal Recognition Sites Facilitate Intrasite Hopping by DNA Adenine Methyltransferase" @default.
• W2079752494 cites W1501289131 @default.
• W2079752494 cites W1697620700 @default.
• W2079752494 cites W1896820664 @default.
• W2079752494 cites W1966400112 @default.
• W2079752494 cites W1971422980 @default.
• W2079752494 cites W1981296068 @default.
• W2079752494 cites W1984447503 @default.
• W2079752494 cites W1985509058 @default.
• W2079752494 cites W1988480619 @default.
• W2079752494 cites W2002153924 @default.
• W2079752494 cites W2005321747 @default.
• W2079752494 cites W2015281347 @default.
• W2079752494 cites W2020463001 @default.
• W2079752494 cites W2023013684 @default.
• W2079752494 cites W2026730015 @default.
• W2079752494 cites W2033930845 @default.
• W2079752494 cites W2045686993 @default.
• W2079752494 cites W2055579049 @default.
• W2079752494 cites W2056496298 @default.
• W2079752494 cites W2076168498 @default.
• W2079752494 cites W2085777743 @default.
• W2079752494 cites W2086936138 @default.
• W2079752494 cites W2086978674 @default.
• W2079752494 cites W2100435712 @default.
• W2079752494 cites W2101002270 @default.
• W2079752494 cites W2103009708 @default.
• W2079752494 cites W2109091206 @default.
• W2079752494 cites W2115638851 @default.
• W2079752494 cites W2143527741 @default.
• W2079752494 cites W2150750072 @default.
• W2079752494 cites W2168208027 @default.
• W2079752494 cites W2169708194 @default.
• W2079752494 cites W2170862894 @default.
• W2079752494 doi "https://doi.org/10.1074/jbc.m111.332502" @default.
• W2079752494 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3391122" @default.
• W2079752494 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/22570478" @default.
• W2079752494 hasPublicationYear "2012" @default.
• W2079752494 type Work @default.
• W2079752494 sameAs 2079752494 @default.
• W2079752494 citedByCount "5" @default.
• W2079752494 countsByYear W20797524942014 @default.
• W2079752494 countsByYear W20797524942015 @default.
• W2079752494 countsByYear W20797524942017 @default.
• W2079752494 crossrefType "journal-article" @default.
• W2079752494 hasAuthorship W2079752494A5064531954 @default.
• W2079752494 hasAuthorship W2079752494A5066521467 @default.
• W2079752494 hasBestOaLocation W20797524941 @default.
• W2079752494 hasConcept C12554922 @default.
• W2079752494 hasConcept C185592680 @default.
• W2079752494 hasConcept C2779979206 @default.
• W2079752494 hasConcept C33288867 @default.
• W2079752494 hasConcept C552990157 @default.
• W2079752494 hasConcept C55493867 @default.
• W2079752494 hasConcept C86803240 @default.
• W2079752494 hasConcept C91965660 @default.
• W2079752494 hasConceptScore W2079752494C12554922 @default.
• W2079752494 hasConceptScore W2079752494C185592680 @default.
• W2079752494 hasConceptScore W2079752494C2779979206 @default.
• W2079752494 hasConceptScore W2079752494C33288867 @default.
• W2079752494 hasConceptScore W2079752494C552990157 @default.
• W2079752494 hasConceptScore W2079752494C55493867 @default.
• W2079752494 hasConceptScore W2079752494C86803240 @default.
• W2079752494 hasConceptScore W2079752494C91965660 @default.
• W2079752494 hasIssue "27" @default.
• W2079752494 hasLocation W20797524941 @default.
• W2079752494 hasLocation W20797524942 @default.
• W2079752494 hasLocation W20797524943 @default.
• W2079752494 hasLocation W20797524944 @default.
• W2079752494 hasOpenAccess W2079752494 @default.
• W2079752494 hasPrimaryLocation W20797524941 @default.
• W2079752494 hasRelatedWork W1980265640 @default.
• W2079752494 hasRelatedWork W2026073754 @default.
• W2079752494 hasRelatedWork W2059346522 @default.
• W2079752494 hasRelatedWork W2068444385 @default.
• W2079752494 hasRelatedWork W2080102916 @default.
• W2079752494 hasRelatedWork W2204647341 @default.
• W2079752494 hasRelatedWork W2319204232 @default.
• W2079752494 hasRelatedWork W2400132286 @default.
• W2079752494 hasRelatedWork W2480507215 @default.
• W2079752494 hasRelatedWork W3173284929 @default.
• W2079752494 hasVolume "287" @default.
• W2079752494 isParatext "false" @default.
• W2079752494 isRetracted "false" @default.
• W2079752494 magId "2079752494" @default.
• W2079752494 workType "article" @default.