FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2109935448> ?p ?o ?g. }

• W2109935448 endingPage "41460" @default.
• W2109935448 startingPage "41453" @default.
• W2109935448 abstract "During the initiation and progression of fibrosis there is extensive differentiation of cells to a myofibroblastic phenotype. Because the synthesis of hyaluronan (HA) was recently linked to oncogenic epithelial-mesenchymal transformation, the present study investigated whether increased HA synthesis was also associated with myofibroblastic differentiation. HA synthesis and size were measured by incorporation of [3H]glucosamine, ion exchange, and size exclusion chromatography. Hyaluronan synthase (HAS) or hyaluronidase (HYAL) mRNA levels were assessed by reverse transcription-PCR. HYAL was detected by immunoblotting and the degradation of [3H]HA. Between 2- and 3-fold more HA appeared in the conditioned medium and became associated with the cells upon myofibroblastic differentiation. Inhibition of HAS and examination of HAS mRNA expression demonstrated that this was not the result of increased synthesis of HA or the induction of HAS 2. After differentiation, however, myofibroblasts metabolized exogenously supplied [3H]HA at a slower rate than fibroblasts and expressed lower levels of both HYAL 1 and HYAL 2 mRNA. Immunoblotting revealed more HYAL 1 and 2 in the myofibroblast conditioned medium. After acidification, however, there was no difference in HA degradation. This suggests that much of the released HYAL is inactive and that the observed differences in HA degradation are caused by cell-associated rather than secreted activity. This was confirmed by immunohistochemical staining for HYAL 1 and HYAL 2. This finding indicates the potential importance of the HYAL enzymes in controlling fibrotic progression and contrasts HA synthesis as a mediator of oncogenic transformation with that of HA degradation controlling fibrogenic differentiation. During the initiation and progression of fibrosis there is extensive differentiation of cells to a myofibroblastic phenotype. Because the synthesis of hyaluronan (HA) was recently linked to oncogenic epithelial-mesenchymal transformation, the present study investigated whether increased HA synthesis was also associated with myofibroblastic differentiation. HA synthesis and size were measured by incorporation of [3H]glucosamine, ion exchange, and size exclusion chromatography. Hyaluronan synthase (HAS) or hyaluronidase (HYAL) mRNA levels were assessed by reverse transcription-PCR. HYAL was detected by immunoblotting and the degradation of [3H]HA. Between 2- and 3-fold more HA appeared in the conditioned medium and became associated with the cells upon myofibroblastic differentiation. Inhibition of HAS and examination of HAS mRNA expression demonstrated that this was not the result of increased synthesis of HA or the induction of HAS 2. After differentiation, however, myofibroblasts metabolized exogenously supplied [3H]HA at a slower rate than fibroblasts and expressed lower levels of both HYAL 1 and HYAL 2 mRNA. Immunoblotting revealed more HYAL 1 and 2 in the myofibroblast conditioned medium. After acidification, however, there was no difference in HA degradation. This suggests that much of the released HYAL is inactive and that the observed differences in HA degradation are caused by cell-associated rather than secreted activity. This was confirmed by immunohistochemical staining for HYAL 1 and HYAL 2. This finding indicates the potential importance of the HYAL enzymes in controlling fibrotic progression and contrasts HA synthesis as a mediator of oncogenic transformation with that of HA degradation controlling fibrogenic differentiation. Changes in cellular phenotype and differentiation occur in response to localized alterations in the cellular environment. At sites of inflammation and tissue damage these alterations may have fundamental effects on the phenotype of the resident cells, particularly fibroblasts (1Sappino A.P. Schurch W. Gabbiani G. Lab. Invest. 1990; 63: 144-161PubMed Google Scholar). Fibroblasts, characteristically, are able to undergo a range of phenotypic conversions between distinct but related cell types, and their phenotypic heterogeneity is well described (2Gabbiani G. J. Pathol. 2003; 200: 500-503Crossref PubMed Scopus (1270) Google Scholar). At sites of tissue damage and wound healing, fibroblasts with a contractile phenotype are essential for the synthesis of the collagen-rich scar and for providing the force for wound contraction (3Grinnell F. J. Cell Biol. 1994; 124: 401-404Crossref PubMed Scopus (980) Google Scholar). In such circumstances, these “myofibroblasts” are normally a transient cell population. In contrast to wound healing, however, a persistent accumulation of myofibroblasts is associated with the pathological reorganization and expansion of the extracellular matrix (4Desmouliere A. Darby I.A. Gabbiani G. Lab. Invest. 2003; 83: 1689-1707Crossref PubMed Scopus (302) Google Scholar). This fibrotic response includes the synthesis and accumulation of extracellular matrix components that may not normally be present or are present at only low levels in normal tissue. One of the earliest of these to be deposited is hyaluronan (HA) 1The abbreviations used are: HA, hyaluronan; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; BSA, bovine serum albumin; CM, conditioned medium extract; HAS, hyaluronan synthase; HBSS, Hanks' balanced salt solution; HYAL, hyaluronidase; 4-MU, 4-methylumbelliferone; PBS, phosphate-buffered saline; RT, reverse transcription; TGF, transforming growth factor. (5Li Y. Rahmanian M. Widstrom C. Lepperdinger G. Frost G.I. Heldin P. Am. J. Respir. Cell Mol. Biol. 2000; 23: 411-418Crossref PubMed Scopus (86) Google Scholar, 6Jones S. Phillips A.O. Kidney Int. 2001; 59: 1739-1749Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 7Goransson V. Hansell P. Moss S. Alcorn D. Johnsson C. Hallgren R. Maric C. Matrix Biol. 2001; 20: 129-136Crossref PubMed Scopus (25) Google Scholar). HA is a negatively charged, linear, nonsulfated glycosaminoglycan consisting of repeating disaccharide units of glucuronic acid and N-acetylglucosamine. Unlike other glycosaminoglycans its synthesis does not take place in the Golgi. Rather it is extruded from the plasma membrane as a chain, which may reach a size of as much as 107 Da. Three vertebrate HA synthase (HAS) genes have been described (8Meyer M.F. Kreil G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4543-4547Crossref PubMed Scopus (88) Google Scholar, 9Spicer A.P. McDonald J.A. J. Biol. Chem. 1998; 273: 1923-1932Abstract Full Text Full Text PDF PubMed Scopus (291) Google Scholar). The HAS enzymes they transcribe are bound to the inner, cytoplasmic face of the plasma membrane. The expression of each of these is cell type-specific, and each is regulated differentially in response to extracellular mediators. Under normal conditions there is a tightly regulated equilibrium between the synthesis of HA and its turnover. Different tissues, however, turn over HA at different rates, varying from a half-life of less than 5 min in blood to between 1 and 3 weeks in cartilage (10Stern R. Glycobiology. 2003; 13: 105R-115RCrossref PubMed Scopus (290) Google Scholar). HA normally exists as a high molecular weight molecule that is involved in matrix stability and maintenance of cell homeostasis. In contrast, lower molecular weight oligosaccharides of HA stimulate gene expression and protein synthesis of a variety of proinflammatory molecules and mediators (11Noble P.W. Matrix Biol. 2002; 21: 25-29Crossref PubMed Scopus (471) Google Scholar). Many of the responses initiated by HA binding to its receptors have been investigated (12Turley E.A. Noble P.W. Bourguignon L.Y. J. Biol. Chem. 2002; 277: 4589-4592Abstract Full Text Full Text PDF PubMed Scopus (882) Google Scholar), although a detailed understanding of the mechanisms whereby HA influences specific aspects of cellular function is lacking. Recently Zoltan-Jones et al. (13Zoltan-Jones A. Huang L. Ghatak S. Toole B.P. J. Biol. Chem. 2003; 278: 45801-45810Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar) demonstrated that overexpression of HAS 2 leading to the increased synthesis of HA, initiated the acquisition of mesenchymal and transformed characteristics in Madin-Darby canine kidney and MCF-10A epithelial cells. Because an increase in myofibroblast numbers in fibrotic tissue is associated with the accumulation of HA, we examined the hypothesis that a change in the synthesis and catabolism of HA is also a major factor contributing to the profibrotic differentiation of fibroblasts to myofibroblasts. Materials—All general reagents were from Sigma, and all tissue culture reagents were purchased from Invitrogen unless stated otherwise. Radioisotopes were purchased from Amersham Biosciences. Cell Culture—Human lung fibroblasts (AG02262) were purchased from Coriell Cell Repositories (Coriell Institute for Medical Research, NJ). The cells were cultured in Dulbecco's modified Eagle's medium and F-12 medium containing 2 mm l-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin, supplemented with 10% fetal calf serum (Hyclone). The cells were maintained at 37 °C in a humidified incubator in an atmosphere of 5% CO2. For differentiation to myofibroblasts, confluent monolayers of fibroblasts were growth arrested in serum-free medium for 72 h and then treated with the optimized concentration of 10 ng/ml transforming growth factor (TGF)-β1 (R&D Systems) for 72 h. TGF-β1 was then removed and incubations continued in serum-free medium (14Evans R.A. Tian Y.C. Steadman R. Phillips A.O. Exp. Cell Res. 2003; 282: 90-100Crossref PubMed Scopus (331) Google Scholar). Immunohistochemical identification of α-smooth muscle actin and the ED-A isoform of fibronectin together with the visualization of stress fibers were used as confirmation of phenotypic change (14Evans R.A. Tian Y.C. Steadman R. Phillips A.O. Exp. Cell Res. 2003; 282: 90-100Crossref PubMed Scopus (331) Google Scholar). Immunohistochemistry—Subconfluent monolayers of cells grown in 8-well glass chamber slides were fixed in acetone:methanol (1:1 v/v) (Fisher Scientific) for 10 min, then washed in calcium/magnesium-free phosphate-buffered saline, pH 7.4 (PBS) (Invitrogen). Nonspecific sites on the fixed cells were blocked with 1% bovine serum albumin (BSA) in Hanks' balanced salt solution (HBSS). The fixed cells were then washed thoroughly in 0.1% BSA in HBSS. The slides were incubated with the primary antibody diluted in 0.1% BSA in HBSS for 2 h at room temperature. The source and dilution of the antibodies were as follows: mouse monoclonal anti-α-smooth muscle actin (Sigma), 1:80; mouse monoclonal anti-cytokeratin (DAKO, Cambridgeshire, UK), 1:80; mouse monoclonal anti-ED-A fibronectin (Oxford Biotechnology, Oxford, UK), 1:50; mouse monoclonal anti-vimentin (DAKO), 1:50; rabbit polyclonal anti-HYAL 1 and rabbit polyclonal anti-HYAL 2 (a kind gift from Dr. Robert Stern, Department of Pathology, University of California, San Francisco), 1:20. The cells were washed repeatedly in 0.1% BSA in HBSS and then incubated with the appropriate secondary antibody for 1 h at room temperature: fluorescein isothiocyanate-conjugated rabbit anti-mouse IgG (DAKO) or fluorescein isothiocyanate-conjugated swine anti-rabbit IgG (DAKO) diluted 1:40 in 0.1% BSA in HBSS. The cells were washed extensively with 0.1% BSA in HBSS, mounted in Vectashield fluorescent mountant (Vecta Laboratories, Peterborough, UK), and examined on a Leica Dialux 20 fluorescent microscope or by confocal laser scanning microscopy on a Leica TCS 4D (Leica Microsystems (UK) Ltd., Milton Keynes, UK). Semiquantitative Reverse Transcription (RT)-PCR—Confluent monolayers of cells grown in 35-mm dishes were washed once with PBS and then lysed in 1 ml of Tri-Reagent and RNA purified according to the manufacturer's protocol. RT was performed using the random hexamer method. 1 μg of RNA was added to 1 μl of 100 μm random hexamers (hexadeoxyribonucleotides, pd[N]6, Amersham Biosciences), 5 μl of 10 mm dNTPs (Amersham Biosciences), 2 μl of 10× PCR buffer (Applied Biosystems), and 2 μl of 0.1 m dithiothreitol (Invitrogen). The solution was heated to 95 °C for 5 min followed by 4 °C for 2 min. 1 μl of (40 units/μl) ribonuclease inhibitor RNasin (Promega) and 1 μl of (200 units/μl) Superscript (Rnase H-reverse transcriptase) (Invitrogen) were added to each sample and mixed. The solutions were incubated at 20 °C for 10 min, 42 °C for 40 min, and then 95 °C for 5 min on a GeneAmp PCR system 9700 (Applied Biosystems). As a negative control (–RT) reverse transcription was performed with sterile H2O replacing the RNA sample. The cDNA products were stored at –20 °C. The PCR was carried out in a final volume of 50 μl/sample, 2 μlofRT product, 37.25 μl of sterile H2O, 25 pmol of each primer (Table I), 3 μl of 10 mm dNTPs, 5 μl of 10× PCR buffer, and 0.25 unit of Amplitaq Gold. Thermal cycling was carried out using GeneAmp PCR system 9700. Amplification was carried out using a cycle of 94 °C for 40 s, 55 °C for 60 s, and 72 °C for 60 s.Table IDetails of primers usedPrimer sequencesCyclesProduct sizeβ-Actin control26204F-GGAGCAATGATCTTGATCTTR-CCTTCCTGGGCATGGAGTCCTα-sma28369F- ATCTGGCACCACTCTTTCTAR- TCTCACGCTCAGCAGTAGTAHAS 1Up to 40395F- TCTACGGGGCCTTCCTTTCAGCR- CTCCGCCTCCACCTCCCGATAGHAS 236313F- GCAGGCGGAAGAAGGGACAACR-TCAGGCGGATGCACAGTAAGGAHAS 334453F- AGTGCAGCTTCGGGGATGAR- TGATGGTAGCAATGGCAAAGATHYAL 136400F- CAGGCGTGAGCTGGATGGAGAR- GTATGTGCAACACCGTGTGGCHYAL 232446F- GAGTTCGCAGCACAGCAGTTCR- CACCCCAGAGGATGACACCAGHYAL 336150F- GATCCAGGACAGATGGAAGCR- CCTGGCTTTATACTGCTTCTTTAGGC Open table in a new tab A negative control (–PCR) was included with H2O replacing the cDNA sample. 5 μl of each PCR product plus 3 μl of loading buffer (40% sucrose and 0.1% bromphenol blue) were then separated on 1.5% agarose gels (ultrapure agarose) containing 0.5 mg/ml ethidium bromide at 90 V for 1 h. 3 μl of a 123-bp ladder (Invitrogen) plus 3 μl of loading buffer were also loaded onto the gel. The gels were visualized and photographed under UV light using a Chemi Doc™ Gel Documentation system (Bio-Rad Laboratories). The ratio of each product to that of the β-actin housekeeping gene was calculated by scanning densitometry and the results expressed as the mean ± S.D. for each group of five. The results were analyzed using the Mann-Whitney U test, and statistical significance was taken as a p value < 0.05. Metabolic Labeling and Analysis of HA—Confluent monolayers of cells grown in T75 flasks were incubated in serum-free medium containing 20 μCi/ml [3H]glucosamine for 24 h. The medium was removed, and the cells were washed with PBS. The wash and medium were combined to form the conditioned medium extract (CM). The CM was then treated with an equal volume of 200 μg/ml Pronase in 100 mm Tris-HCl, pH 8, 0.05% sodium azide for 24 h. To remove any surface/CD44-associated HA, the cells were treated with 10 μg/ml trypsin in PBS for 10 min at room temperature; this was designated the trypsin extract. The trypsin extract was then treated with an equal volume of 200 μg/ml Pronase for 24 h. The cells remaining in the culture flask were incubated directly with 100 μg/ml Pronase for 24 h. The supernatant was decanted and designated the cell extract. Each extract was passed over DEAE-Sephacel ion exchange columns (Amersham Biosciences), equilibrated with 8 m urea in 20 mm BisTris buffer, pH 6, containing 0.2% Triton X-100. This removed any low molecular weight peptides and unincorporated radiolabel. HA was eluted in 8 m urea buffer containing 0.3 m NaCl. Sulfated glycosylaminoglycans remained bound and were subsequently eluted in 4 m guanidine buffer (4 m guanidine HCl, 50 mm sodium acetate, 0.5% Triton X-100, and 0.05% sodium azide). Each sample was split into two, and the HA was precipitated with 3 volumes of 1% potassium acetate in 95% ethanol in the presence of 50 μg/ml of each HA, heparin, and chondroitin sulfate as coprecipitants. The first half of each sample was resuspended in 500 μl of 4 m guanidine buffer and analyzed on a Sephacryl S-500 column, equilibrated with 4 m guanidine buffer. To confirm that the chromatography profile generated was the result of radiolabeled HA, the second half of each sample was digested at 37 °C overnight with 1 unit of Streptomyces hyalurolyticus hyaluronidase (HYAL) (ICN Pharmaceuticals Ltd.) in 200 μl of 20 mm sodium acetate, pH 6, containing 0.05% sodium azide and 0.15 m sodium chloride. The sample was then mixed with an equal volume of 4 m guanidine buffer and analyzed on the same Sephacryl S-500 column equilibrated with 4 m guanidine buffer. To produce the chromatography profile the 3H activity (dpm) for each half of the sample was normalized, corrected for dilution, and then the HYAL-resistant counts were subtracted. The chromatography profiles only depict HYAL-sensitive activity in each fraction plotted against fraction number. The column was calibrated with (a) [3H]glucosamine hydrochloride, Mr 215; (b) [35S]chondroitin sulfate glycosaminoglycans, Mr 25 × 103; (c) [35S]decorin, Mr 10 × 104; (d) [35S]versican, Mr 1.3 × 106 (15Thomas G.J. Shewring L. McCarthy K.J. Couchman J.R. Mason R.M. Davies M. Kidney Int. 1995; 48: 1278-1289Abstract Full Text PDF PubMed Scopus (26) Google Scholar). Purification of [3H]HA—The HK2 cell line was used to prepare large quantities of [3H]HA. Confluent monolayers of HK2 cells grown in T75 flasks were incubated with [3H]glucosamine for 72 h in serum-free medium. The CM was removed, [3H]HA isolated, and each extract was processed and analyzed as under “Metabolic Labeling and Analysis of HA,” above. After size separation on Sephacryl S-500, the fractions corresponding to [3H]HA with a size greater than 1,000 kDa were pooled. Triton X-100 was removed from the sample by passing over DEAE-Sephacel and washing the bound [3H]HA extensively with water. The [3H]HA was eluted with 4 m guanidine buffer without Triton X-100. Before addition of exogenous [3H]HA to confluent monolayers of cells it was dialyzed repeatedly against serum-free medium to remove the 4 m guanidine buffer. For the estimate of cell-free HYAL activity, [3H]HA (50 × 103 dpm) was dialyzed against water and lyophilized. Addition of Exogenous [3H]HA to Confluent Monolayers of Cells— Serum-free medium containing 100,000 dpm of [3H]HA/ml was added to confluent monolayers of cells grown in T25 flasks and incubated at 37 °C in a humidified incubator in an atmosphere of 5% CO2 for 24 and 72 h. Controls consisted of serum-free medium containing 100,000 dpm/ml of [3H]HA/ml incubated for the appropriate time points. The CM was removed, freeze-dried, and then reconstituted in 4 m guanidine buffer and analyzed by size exclusion chromatography on a Sephacryl S-500 column equilibrated with 4 m guanidine buffer. The recovery of HA-specific counts varied between 91 and 95% in the CM and 3 and 5% in the cell layer in these experiments compared with 100% recovery of the cell-free control. Assay of Cell-free HYAL Activity—The CM decanted from confluent monolayers of cells grown in T25 flasks was passed over DEAE-Sephacel ion exchange columns in 50 mm Tris-HCl, pH 7.8. The flow-through (containing HYAL) was then dialyzed against water and freeze-dried. The samples were reconstituted in 0.1 m sodium formate buffer, pH 3.7, and incubated with 50 × 103 dpm [3H]HA for 72 h at 37 °C. HYAL activity was not detectable at neutral pH (not shown). Controls consisted of 0.1 m sodium formate buffer, pH 3.7, containing 50 × 103 dpm [3H]HA incubated for 72 h. The HA size distribution was then examined by size exclusion chromatography on a Sephacryl S-500 column equilibrated with 4 m guanidine buffer. HA Turnover by Pulse-Chase—Confluent monolayers of cells grown in T75 flasks were incubated in serum-free medium containing 20 μCi/ml [3H]glucosamine for 24 h. The medium was then removed at times up to 12 h, and the cells were washed with PBS, and fresh medium without radiolabel was added. The wash and medium were combined to form the CM as above. The CM was then treated with an equal volume of 200 μg/ml Pronase in 100 mm Tris-HCl, pH 8, 0.05% sodium azide for 24 h. The remaining cell/matrix layer was incubated directly with 100 μg/ml Pronase for 24 h. The supernatant was decanted and designated the cell layer extract. Each extract was processed and analyzed as under “Metabolic Labeling and Analysis of HA,” above. Particle Exclusion Assay—The exclusion of horse erythrocytes was used to visualize the HA pericellular coat. Subconfluent layers of cells grown in 35-mm dishes were washed repeatedly in PBS. Formalized horse erythrocytes were washed in PBS and centrifuged at 1,000 × g for 7 min at 4 °C. The pellet was resuspended in serum-free medium, approximate density 1 × 108/ml. 500 μl of formalized horse erythrocyte suspension was added to each 35-mm dish and swirled gently to distribute the cell suspension evenly. The dishes were incubated at 37 °C for 15 min to allow the formalized horse erythrocyte to settle around the cell layer. Controls cells were incubated with 200 μg/ml HYAL from bovine testes in serum-free medium for 60 min prior to the addition formalized horse erythrocytes. Zones of exclusion were visualized on a Zeiss Axiovert 135 inverted microscope (Carl Zeiss; Light Microscopy, Gottingen, Germany) with a Hamamatsu C5985 chilled CCD camera (Hamamatsu Photonics UK Ltd., Hertfordshire, UK) and OpenLab software 3.0.8 (Improvision, Coventry, UK). Because of the elongated shape of many of the cell processes, the exclusion zone at some areas of the cell was not visible, making calculation of areas difficult. Therefore, the width of the exclusion zone was calculated at the widest point of the cell (usually at the nucleus). Nonparametric statistical analysis (Mann-Whitney U test) was then carried out on the measurements from each cell type. SDS-PAGE and Immunoblotting—The CM decanted from confluent monolayers of cells grown in T25 flasks was passed over DEAE-Sephacel ion exchange columns in 50 mm Tris-HCl, pH 7.8. The flow-through (containing HYAL) was then dialyzed against water, freeze-dried, and reconstituted in 0.5 m Tris-HCl, pH 6.8. The sample was added to an equal volume of loading buffer, and proteins were separated on discontinuous 7.5% polyacrylamide gels followed by transfer to nitrocellulose. After transfer, blots were blocked with 5% skimmed milk, 0.5% Tween 20 in 50 mm Tris-HCl-buffered saline for 1 h. Rabbit polyclonal anti-HYAL 1 and rabbit polyclonal anti-HYAL 2 (a kind gift from Dr. Robert Stern, Department of Pathology, University of California, San Francisco) diluted 1:200 were added to the blots in 0.1% Tween 20 and 1% BSA in Tris-HCl-buffered saline and incubated at 4 °C overnight. After washing, the blots were incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody. Antibody binding was visualized by ECL (Amersham Biosciences). Negative controls consisted of incubation with normal rabbit serum (diluted 1:1,000) in place of the primary antibody. HA Synthesis after Myofibroblast Differentiation—Exposure of human lung fibroblasts to TGF-β1 resulted in their differentiation to a myofibroblast phenotype with the induction of α-smooth muscle actin and ED-A fibronectin, which was maximal by 72 h at concentrations above 10 ng/ml (Fig. 1). As reported previously (14Evans R.A. Tian Y.C. Steadman R. Phillips A.O. Exp. Cell Res. 2003; 282: 90-100Crossref PubMed Scopus (331) Google Scholar, 16Thannickal V.J. Lee D.Y. White E.S. Cui Z. Larios J.M. Chacon R. Horowitz J.C. Day R.M. Thomas P.E. J. Biol. Chem. 2003; 278: 12384-12389Abstract Full Text Full Text PDF PubMed Scopus (502) Google Scholar), this was not reversed by removal of TGF-β1 (not shown), indicative of stably differentiated cells. Both cell types stained positively for vimentin and were negative for cytokeratin. Labeling the cells with [3H]glucosamine for 24 h after their differentiation resulted in an augmented accumulation of HA compared with fibroblasts. Analysis of HA by size exclusion chromatography indicated that there was between 2- and 3-fold more HA present in the CM of myofibroblasts compared with fibroblasts (Fig. 2A). Myofibroblasts also had more HA associated with the cell surface (Fig. 2B) and with the cell layer (Fig. 2C) than fibroblasts. In addition, although the majority of the HA from each of these three compartments had a high molecular weight, both the MC and the cell layer also contained lower molecular weight forms, which were not found in the trypsin-accessible cell surface extract.Fig. 2Size exclusion chromatography of HA purified from fibroblasts compared with that from myofibroblasts. Myofibroblasts (•) and fibroblasts (○) were metabolically labeled for 24 h with [3H]glucosamine. The radiolabeled HA was isolated from the CM (A), the trypsin extract (B), and the cell layer extract (C) and subjected to size exclusion chromatography on a Sephacryl S-500 column. The column was calibrated as described under “Experimental Procedures” with [3H]glucosamine hydrochloride, Mr 215 (a); [35S]chondroitin sulfate glycosaminoglycans, Mr 25 × 103 (b); [35S]decorin, Mr 10 × 104 (c); [35S]versican, Mr 1.3 × 106 (d). The results shown are representative of more than 10 preparations from each cell type. Three arbitrary sizes of HA are indicated, high molecular weight (HMW), >1.5 × 106; medium (MMW), 0.4–1.5 × 106; and low (LMW), <40 × 104.View Large Image Figure ViewerDownload (PPT) Effect of Manipulation of HA Synthesis and Turnover on Cell Phenotype—The increased synthesis of HA through the induction of HAS 2 has been described previously as a stimulus-initiating epithelial-mesenchymal transformation (13Zoltan-Jones A. Huang L. Ghatak S. Toole B.P. J. Biol. Chem. 2003; 278: 45801-45810Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar). To investigate the possibility that a similar mechanism was involved after fibroblast to myofibroblast differentiation, the expression of each of the HAS isoforms was examined by semiquantitative RT-PCR. mRNA for both HAS 2 and HAS 3 was detected in each of five separate cultures of fibroblasts and five cultures of myofibroblasts (Fig. 3). Densitometric analysis of the bands, corrected for the expression of β-actin, however, revealed significantly lower expression of both mRNA species in myofibroblasts (for HAS 2: fibroblast 1.07 ± 0.20, myofibroblast 0.84 ± 0.12 with p = 0.028; for HAS 3: fibroblast 1.02 ± 0.07, myofibroblast 0.72 ± 0.17 with p = 0.009). HAS 1 mRNA was not detected in either cell. 4-Methylumbelliferone (4-MU), an inhibitor of the HAS (17Nakamura T. Takagaki K. Shibata S. Tanaka K. Higuchi T. Endo M. Biochem. Biophys. Res. Commun. 1995; 208: 470-475Crossref PubMed Scopus (88) Google Scholar, 18Nakamura T. Funahashi M. Takagaki K. Munakata H. Tanaka K. Saito Y. Endo M. Biochem. Mol. Biol. Int. 1997; 43: 263-268PubMed Google Scholar, 19Kakizaki I. Takagaki K. Endo Y. Kudo D. Ikeya H. Miyoshi T. Baggenstoss B.A. Tlapak-Simmons V.L. Kumari K. Nakane A. Weigel P.H. Endo M. Eur. J. Biochem. 2002; 269: 5066-5075Crossref PubMed Scopus (40) Google Scholar), was used to investigate HA further as a potential mediator of myofibroblast differentiation. Metabolic labeling and size exclusion chromatography were used to establish 0.2 mm as the optimal effective concentration of 4-MU. At this concentration there was a maximum 70% inhibition of total HA, and this was used in all subsequent experiments (Fig. 4).Fig. 4Inhibition of HA synthesis in fibroblasts by the optimal concentration of 4-MU. Fibroblasts were metabolically labeled for 24 h with[3H]glucosamine in the absence (○) or presence (•) of 0.2 mm 4-MU. The labeled HA was isolated from the CM (A), the trypsin extract (B), and the cell layer extract (C) and subjected to size exclusion chromatography on a Sephacryl S-500 column as described under “Experimental Procedures.” HMW, MMW, and LMW, as in Fig. 2.View Large Image Figure ViewerDownload (PPT) The HA pericellular coat was visualized using the exclusion of formalized erythrocytes (Fig. 5). Myofibroblasts had a well established coat of HA that was ∼3-fold thicker than that of fibroblasts (Fig. 5F compared with 5B). Taking measurements of the coat thickness at the widest point of 30 randomly chosen cells of each phenotype gave a mean thickness for the myofibroblast coat of 1.61 ± 0.72 μm and for the fibroblast coat of 0.52 ± 0.15 μm (mean ± S.D.) (Z –6.661, p < 0001 Mann-Whitney U test). Incubation with 4-MU inhibited coat assembly in both cell types (Fig. 5, C and G) without affecting cell morphology or viability (not shown). Control cells incubated with bovine testicular HYAL (Fig. 5, D and H) had no pericellular coats. HYAL Activity in Fibroblasts and Myofibroblasts—The observation that there was lower expression of HAS 2 and HAS 3 in myofibroblasts, combined with the metabolic labeling data, suggested that the greater accumulation of HA by myofibroblasts may be the result of decreased HA degradation. The mRNA level for each of the HYAL enzymes was, therefore, examined by RT-PCR. The mRNA for HYAL 1, HYAL 2, and HYAL 3 was detected in each of five separate cultures of each cell type. Although there was no difference between the levels of expression of HYAL 3, both HYAL 1 and HYAL 2 were expressed at lower levels in myofibroblasts than in fibroblasts. This was statistically significant, however, only for HYAL 2 (Table II).Table IIExpression of HYAL mRNA by fibroblasts and myofibroblastsIsoformFibroblastsMyofibroblastsSignificanceaMann-Whitney U test, n = 5. NS, not significant.HYAL 11.14 ± 0.190.84 ± 0.24NSHYAL 20.97 ± 0.050.84 ± 0.06p = 0.008HYAL 31.07 ± 0.091.08 ± 0.16NSa Mann-Whitney U t" @default.
• W2109935448 created "2016-06-24" @default.
• W2109935448 creator A5001679374 @default.
• W2109935448 creator A5005587537 @default.
• W2109935448 creator A5016299316 @default.
• W2109935448 creator A5029931631 @default.
• W2109935448 date "2004-10-01" @default.
• W2109935448 modified "2023-09-26" @default.
• W2109935448 title "Myofibroblastic Differentiation Leads to Hyaluronan Accumulation through Reduced Hyaluronan Turnover" @default.
• W2109935448 cites W1589714231 @default.
• W2109935448 cites W1598472111 @default.
• W2109935448 cites W1964195356 @default.
• W2109935448 cites W1966422114 @default.
• W2109935448 cites W1969108243 @default.
• W2109935448 cites W1971300919 @default.
• W2109935448 cites W2002552794 @default.
• W2109935448 cites W2013472084 @default.
• W2109935448 cites W2018128871 @default.
• W2109935448 cites W2020487872 @default.
• W2109935448 cites W2026757718 @default.
• W2109935448 cites W2029545202 @default.
• W2109935448 cites W2030337803 @default.
• W2109935448 cites W2033864841 @default.
• W2109935448 cites W2035536358 @default.
• W2109935448 cites W2037562476 @default.
• W2109935448 cites W2043362010 @default.
• W2109935448 cites W2046245538 @default.
• W2109935448 cites W2050333516 @default.
• W2109935448 cites W2051696368 @default.
• W2109935448 cites W2053837765 @default.
• W2109935448 cites W2054092161 @default.
• W2109935448 cites W2065895195 @default.
• W2109935448 cites W2066306706 @default.
• W2109935448 cites W2067408124 @default.
• W2109935448 cites W2069305370 @default.
• W2109935448 cites W2074215143 @default.
• W2109935448 cites W2077034347 @default.
• W2109935448 cites W2084092470 @default.
• W2109935448 cites W2085642033 @default.
• W2109935448 cites W2088018333 @default.
• W2109935448 cites W2093803256 @default.
• W2109935448 cites W2095470962 @default.
• W2109935448 cites W2095515872 @default.
• W2109935448 cites W2107214690 @default.
• W2109935448 cites W2126659405 @default.
• W2109935448 cites W2138083101 @default.
• W2109935448 cites W2146505397 @default.
• W2109935448 cites W2164021363 @default.
• W2109935448 doi "https://doi.org/10.1074/jbc.m401678200" @default.
• W2109935448 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15271981" @default.
• W2109935448 hasPublicationYear "2004" @default.
• W2109935448 type Work @default.
• W2109935448 sameAs 2109935448 @default.
• W2109935448 citedByCount "55" @default.
• W2109935448 countsByYear W21099354482012 @default.
• W2109935448 countsByYear W21099354482013 @default.
• W2109935448 countsByYear W21099354482014 @default.
• W2109935448 countsByYear W21099354482015 @default.
• W2109935448 countsByYear W21099354482016 @default.
• W2109935448 countsByYear W21099354482017 @default.
• W2109935448 countsByYear W21099354482018 @default.
• W2109935448 countsByYear W21099354482019 @default.
• W2109935448 countsByYear W21099354482020 @default.
• W2109935448 countsByYear W21099354482021 @default.
• W2109935448 countsByYear W21099354482022 @default.
• W2109935448 countsByYear W21099354482023 @default.
• W2109935448 crossrefType "journal-article" @default.
• W2109935448 hasAuthorship W2109935448A5001679374 @default.
• W2109935448 hasAuthorship W2109935448A5005587537 @default.
• W2109935448 hasAuthorship W2109935448A5016299316 @default.
• W2109935448 hasAuthorship W2109935448A5029931631 @default.
• W2109935448 hasBestOaLocation W21099354481 @default.
• W2109935448 hasConcept C105702510 @default.
• W2109935448 hasConcept C12554922 @default.
• W2109935448 hasConcept C153074725 @default.
• W2109935448 hasConcept C185592680 @default.
• W2109935448 hasConcept C2777529286 @default.
• W2109935448 hasConcept C55493867 @default.
• W2109935448 hasConcept C86803240 @default.
• W2109935448 hasConcept C95444343 @default.
• W2109935448 hasConceptScore W2109935448C105702510 @default.
• W2109935448 hasConceptScore W2109935448C12554922 @default.
• W2109935448 hasConceptScore W2109935448C153074725 @default.
• W2109935448 hasConceptScore W2109935448C185592680 @default.
• W2109935448 hasConceptScore W2109935448C2777529286 @default.
• W2109935448 hasConceptScore W2109935448C55493867 @default.
• W2109935448 hasConceptScore W2109935448C86803240 @default.
• W2109935448 hasConceptScore W2109935448C95444343 @default.
• W2109935448 hasIssue "40" @default.
• W2109935448 hasLocation W21099354481 @default.
• W2109935448 hasOpenAccess W2109935448 @default.
• W2109935448 hasPrimaryLocation W21099354481 @default.
• W2109935448 hasRelatedWork W1498990732 @default.
• W2109935448 hasRelatedWork W1982188216 @default.
• W2109935448 hasRelatedWork W2019825145 @default.
• W2109935448 hasRelatedWork W2042216829 @default.
• W2109935448 hasRelatedWork W2070860250 @default.
• W2109935448 hasRelatedWork W2095741501 @default.

• next