FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1976471833> ?p ?o ?g. }

• W1976471833 endingPage "14471" @default.
• W1976471833 startingPage "14464" @default.
• W1976471833 abstract "In human cells, oxidative pyrimidine lesions are restored by the base excision repair pathway initiated by homologues of Endo III (hNTH1) and Endo VIII (hNEIL1 and hNEIL2). In this study we have quantitatively analyzed and compared their activity toward nine oxidative base lesions and an apurinic/apyrimidinic (AP) site using defined oligonucleotide substrates. hNTH1 and hNEIL1 but not hNEIL2 excised the two stereoisomers of thymine glycol (5R-Tg and 5S-Tg), but their isomer specificity was markedly different: the relative activity for 5R-Tg:5S-Tg was 13:1 for hNTH1 and 1.5:1 for hNEIL1. This was also the case for their Escherichia coli homologues: the relative activity for 5R-Tg:5S-Tg was 1:2.5 for Endo III and 3.2:1 for Endo VIII. Among other tested lesions for hNTH1, an AP site was a significantly better substrate than urea, 5-hydroxyuracil (hoU), and guanine-derived formamidopyrimidine (mFapyG), whereas for hNEIL1 these base lesions and an AP site were comparable substrates. In contrast, hNEIL2 recognized an AP site exclusively, and the activity for hoU and mFapyG was marginal. hNEIL1, hNEIL2, and Endo VIII but not hNTH1 and Endo III formed cross-links to oxanine, suggesting conservation of the -fold of the active site of the Endo VIII homologues. The profiles of the excision of the Tg isomers with HeLa and E. coli cell extracts closely resembled those of hNTH1 and Endo III, confirming their major contribution to the repair of Tg isomers in cells. However, detailed analysis of the cellular activity suggests that hNEIL1 has a significant role in the repair of 5S-Tg in human cells. In human cells, oxidative pyrimidine lesions are restored by the base excision repair pathway initiated by homologues of Endo III (hNTH1) and Endo VIII (hNEIL1 and hNEIL2). In this study we have quantitatively analyzed and compared their activity toward nine oxidative base lesions and an apurinic/apyrimidinic (AP) site using defined oligonucleotide substrates. hNTH1 and hNEIL1 but not hNEIL2 excised the two stereoisomers of thymine glycol (5R-Tg and 5S-Tg), but their isomer specificity was markedly different: the relative activity for 5R-Tg:5S-Tg was 13:1 for hNTH1 and 1.5:1 for hNEIL1. This was also the case for their Escherichia coli homologues: the relative activity for 5R-Tg:5S-Tg was 1:2.5 for Endo III and 3.2:1 for Endo VIII. Among other tested lesions for hNTH1, an AP site was a significantly better substrate than urea, 5-hydroxyuracil (hoU), and guanine-derived formamidopyrimidine (mFapyG), whereas for hNEIL1 these base lesions and an AP site were comparable substrates. In contrast, hNEIL2 recognized an AP site exclusively, and the activity for hoU and mFapyG was marginal. hNEIL1, hNEIL2, and Endo VIII but not hNTH1 and Endo III formed cross-links to oxanine, suggesting conservation of the -fold of the active site of the Endo VIII homologues. The profiles of the excision of the Tg isomers with HeLa and E. coli cell extracts closely resembled those of hNTH1 and Endo III, confirming their major contribution to the repair of Tg isomers in cells. However, detailed analysis of the cellular activity suggests that hNEIL1 has a significant role in the repair of 5S-Tg in human cells. DNA carrying vital genetic information of cells constantly suffers from spontaneous deamination and depurination, alkylation, and oxidation (1Lindahl T. Nature. 1993; 362: 709-715Google Scholar, 2Friedberg E.C. Walker G.C. Siede W. DNA Repair and Mutagenesis. American Society for Microbiology, Washington, D. C.1995Google Scholar, 3Friedberg E.C. Nature. 2003; 421: 436-440Google Scholar). These reactions lead to modifications of the DNA backbone and bases, with the latter predominating. The resulting aberrant bases are potentially genotoxic because of the loss or alteration of base pairing information (4Kunkel T.A. Bebenek K. Annu. Rev. Biochem. 2000; 69: 497-529Google Scholar), and hence need to be restored by the cellular repair system (2Friedberg E.C. Walker G.C. Siede W. DNA Repair and Mutagenesis. American Society for Microbiology, Washington, D. C.1995Google Scholar, 3Friedberg E.C. Nature. 2003; 421: 436-440Google Scholar, 5Lindahl T. Wood R.D. Science. 1999; 286: 1897-1905Google Scholar). The major repair mechanism for such damage is the base excision repair (BER) 1The abbreviations used are: BER, base excision repair; Endo, endonuclease; hNTH1, human Nth homologue; hNEIL1 and hNEIL2, human Nei-like 1 and 2; Tg, thymine glycol; hoU, 5-hydroxyuracil; hoC, 5-hydroxycytosine; fU, 5-formyluracil; hmU, 5-hydroxymethyluracil; AP, apurinic/apyrimidinic site; 8-oxoG, 7,8-dihydro-8-oxoguanine; mFapyG, 2,6-diamino-4-hydroxy-5-N-methylformamidopyrimidine; Oxa, oxanine; BSA, bovine serum albumin. 1The abbreviations used are: BER, base excision repair; Endo, endonuclease; hNTH1, human Nth homologue; hNEIL1 and hNEIL2, human Nei-like 1 and 2; Tg, thymine glycol; hoU, 5-hydroxyuracil; hoC, 5-hydroxycytosine; fU, 5-formyluracil; hmU, 5-hydroxymethyluracil; AP, apurinic/apyrimidinic site; 8-oxoG, 7,8-dihydro-8-oxoguanine; mFapyG, 2,6-diamino-4-hydroxy-5-N-methylformamidopyrimidine; Oxa, oxanine; BSA, bovine serum albumin. pathway (6Scharer O.D. Jiricny J. Bioessays. 2001; 23: 270-281Google Scholar), which is conserved from bacteria to humans. In the first step of BER, DNA glycosylases with distinct damage specificities detect the aberrant base in the vast sea of normal bases and remove it from the DNA backbone, leaving an apurinic/apyrimidinic (AP) site. The resulting AP site is further processed and repaired by the subsequent action of AP endonuclease (Endo), DNA polymerase, and DNA ligase through the short patch or long patch BER pathway. The initial search for DNA glycosylases involved in the repair of oxidatively damaged bases in Escherichia coli identified Endo III, Endo VIII, and formamidopyrimidine-DNA glycosylase (7Wallace S.S. Free Radic. Biol. Med. 2002; 33: 1-14Google Scholar, 8Gros L. Saparbaev M.K. Laval J. Oncogene. 2002; 21: 8905-8925Google Scholar). The principal substrates of Endo III and Endo VIII are oxidative pyrimidine lesions. They exhibit redundant damage specificity and catalyze the hydrolysis of the N-glycosidic bond (N-glycosylase activity) and the subsequent incision of an AP site by AP lyase activity via β-elimination (Endo III) or β,δ-elimination (Endo VIII). The E. coli mutants deficient in both Endo III and Endo VIII are strong spontaneous mutators (9Jiang D. Hatahet Z. Blaisdell J.O. Melamede R.J. Wallace S.S. J. Bacteriol. 1997; 179: 3773-3782Google Scholar, 10Blaisdell J.O. Hatahet Z. Wallace S.S. J. Bacteriol. 1999; 181: 6396-6402Google Scholar) and hypersensitive to the agents that generate reactive oxygen species such as ionizing radiation and hydrogen peroxide (9Jiang D. Hatahet Z. Blaisdell J.O. Melamede R.J. Wallace S.S. J. Bacteriol. 1997; 179: 3773-3782Google Scholar, 11Saito Y. Uraki F. Nakajima S. Asaeda A. Ono K. Kubo K. Yamamoto K. J. Bacteriol. 1997; 179: 3783-3785Google Scholar). The principal substrates of formamidopyrimidine-DNA glycosylase are oxidative purine lesions, and it exhibits N-glycosylase and β,δ-AP lyase activities. The E. coli mutants deficient in formamidopyrimidine-DNA glycosylase are not sensitive to ionizing radiation but exhibit a mild spontaneous mutator phenotype (12Cabrera M. Nghiem Y. Miller J.H. J. Bacteriol. 1988; 170: 5405-5407Google Scholar, 13Michaels M.L. Cruz C. Grollman A.P. Miller J.H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7022-7025Google Scholar). Interestingly, while showing distinct substrate specificity, Endo VIII and formamidopyrimidine-DNA glycosylase belong to the same structural family, the Endo VIII/formamidopyrimidine-DNA glycosylase superfamily (14Wallace S.S. Bandaru V. Kathe S.D. Bond J.P. DNA Repair (Amst.). 2003; 2: 441-453Google Scholar, 15Zharkov D.O. Shoham G. Grollman A.P. DNA Repair (Amst.). 2003; 2: 839-862Google Scholar). The mammalian Endo III homologue (NTH1) and a functional homologue of formamidopyrimidine-DNA glycosylase (OGG1) have been identified previously, and their functions in BER have been assessed using purified proteins (16Ikeda S. Biswas T. Roy R. Izumi T. Boldogh I. Kurosky A. Sarker A.H. Seki S. Mitra S. J. Biol. Chem. 1998; 273: 21585-21593Google Scholar, 17Dizdaroglu M. Karahalil B. Senturker S. Buckley T.J. Roldan-Arjona T. Biochemistry. 1999; 38: 243-246Google Scholar, 18Asagoshi K. Odawara H. Nakano H. Miyano T. Terato H. Ohyama Y. Seki S. Ide H. Biochemistry. 2000; 39: 11389-11398Google Scholar, 19Asagoshi K. Yamada T. Okada Y. Terato H. Ohyama Y. Seki S. Ide H. J. Biol. Chem. 2000; 275: 24781-24786Google Scholar, 20Dherin C. Radicella J.P. Dizdaroglu M. Boiteux S. Nucleic Acids Res. 1999; 27: 4001-4007Google Scholar, 21Asagoshi K. Yamada T. Terato H. Ohyama Y. Monden Y. Arai T. Nishimura S. Aburatani H. Lindahl T. Ide H. J. Biol. Chem. 2000; 275: 4956-4964Google Scholar, 22Zharkov D.O. Rosenquist T.A. Gerchman S.E. Grollman A.P. J. Biol. Chem. 2000; 275: 28607-28617Google Scholar), knockout mice (23Takao M. Kanno S. Shiromoto T. Hasegawa R. Ide H. Ikeda S. Sarker A.H. Seki S. Xing J.Z. Le X.C. Weinfeld M. Kobayashi K. Miyazaki J. Muijtjens M. Hoeijmakers J.H. van der Horst G. Yasui A. EMBO J. 2002; 21: 3486-3493Google Scholar, 24Ocampo M.T. Chaung W. Marenstein D.R. Chan M.K. Altamirano A. Basu A.K. Boorstein R.J. Cunningham R.P. Teebor G.W. Mol. Cell. Biol. 2002; 22: 6111-6121Google Scholar, 25Karahalil B. de Souza-Pinto N.C. Parsons J.L. Elder R.H. Bohr V.A. J. Biol. Chem. 2003; 278: 33701-33707Google Scholar, 26Klungland A. Rosewell I. Hollenbach S. Larsen E. Daly G. Epe B. Seeberg E. Lindahl T. Barnes D.E. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13300-13305Google Scholar, 27Minowa O. Arai T. Hirano M. Monden Y. Nakai S. Fukuda M. Itoh M. Takano H. Hippou Y. Aburatani H. Masumura K. Nohmi T. Nishimura S. Noda T. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4156-4161Google Scholar, 28Arai T. Kelly V.P. Komoro K. Minowa O. Noda T. Nishimura S. Cancer Res. 2003; 63: 4287-4292Google Scholar), and x-ray crystallographic analysis (29Bruner S.D. Norman D.P. Verdine G.L. Nature. 2000; 403: 859-866Google Scholar, 30Fromme J.C. Bruner S.D. Yang W. Karplus M. Verdine G.L. Nat. Struct. Biol. 2003; 10: 204-211Google Scholar). It has recently been shown that mammals have Endo VIII homologues (31Bandaru V. Sunkara S. Wallace S.S. Bond J.P. DNA Repair (Amst.). 2002; 1: 517-529Google Scholar, 32Hazra T.K. Izumi T. Boldogh I. Imhoff B. Kow Y.W. Jaruga P. Dizdaroglu M. Mitra S. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 3523-3528Google Scholar); they are designated NEIL1, NEIL2, and NEIL3 (after Nei-like), demonstrating the conserved organization of DNA glycosylases involved in the repair of oxidatively damaged pyrimidine and purine lesions. Studies into the repair function of the mammalian Endo VIII homologues reveal that like Endo III and Endo VIII, NTH1 and NEIL1/NEIL2 exhibit, albeit not fully, redundant damage specificity and primarily recognize oxidative pyrimidine lesions (14Wallace S.S. Bandaru V. Kathe S.D. Bond J.P. DNA Repair (Amst.). 2003; 2: 441-453Google Scholar, 31Bandaru V. Sunkara S. Wallace S.S. Bond J.P. DNA Repair (Amst.). 2002; 1: 517-529Google Scholar, 32Hazra T.K. Izumi T. Boldogh I. Imhoff B. Kow Y.W. Jaruga P. Dizdaroglu M. Mitra S. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 3523-3528Google Scholar, 33Hazra T.K. Kow Y.W. Hatahet Z. Imhoff B. Boldogh I. Mokkapati S.K. Mitra S. Izumi T. J. Biol. Chem. 2002; 277: 30417-30420Google Scholar, 34Takao M. Kanno S. Kobayashi K. Zhang Q.M. Yonei S. van der Horst G.T. Yasui A. J. Biol. Chem. 2002; 277: 42205-42213Google Scholar, 35Morland I. Rolseth V. Luna L. Rognes T. Bjoras M. Seeberg E. Nucleic Acids Res. 2002; 30: 4926-4936Google Scholar, 36Rosenquist T.A. Zaika E. Fernandes A.S. Zharkov D.O. Miller H. Grollman A.P. DNA Repair (Amst.). 2003; 2: 581-591Google Scholar, 37Dou H. Mitra S. Hazra T.K. J. Biol. Chem. 2003; 278: 49679-49684Google Scholar). However, their activities toward oxidized base lesions have been assessed using different substrates (oligonucleotides with different sequence contexts or calf thymus DNA) and assay methods (nicking assays of DNA and release assays of damaged bases), making the quantitative comparison of activity data rather difficult. In light of this fact, we measured and quantitatively compared the activity of human NTH1, NEIL1, and NEIL2 (hNTH1, hNEIL1, and hNEIL2) and that of their E. coli homologues (Endo III and Endo VIII) using common oligonucleotide substrates. We report here that hNTH1, hNEIL1, and hNEIL2 exhibit significantly different activities toward the stereoisomers of thymine glycol (Tg) and other oxidative base lesions, and that this is also the case for Endo III and Endo VIII. These results, together with those obtained from cell extracts, indicate that base lesions generated by reactive oxygen species are removed from DNA at distinct rates in cells, and hence that their genotoxic effects can be differentially attenuated in keeping with their repair kinetics. Oligonucleotide Substrates—The substrates used in this study are listed in Table I. 30TG5R and 30TG5S containing the diastereoisomers 5R-Tg and 5S-Tg, respectively, were synthesized using the corresponding phosphoramidite monomers as described previously (38Iwai S. Angew. Chem. Int. Ed. Engl. 2000; 39: 3874-3876Google Scholar, 39Iwai S. Chem. Eur. J. 2001; 7: 4343-4351Google Scholar). Tg has four diastereoisomers with respect to the configurations at C5 and C6: two cis isomers, (5R,6S)-Tg and (5S,6R)-Tg; and two trans isomers, (5R,6R)-Tg and (5S,6S)-Tg. The pair of 5R cis-trans isomers is in equilibrium because of epimerization in aqueous solution (abundance ratio, (5R,6S)-Tg:(5R,6R)-Tg = 87:13), and so is the pair of 5S cis-trans isomers ((5S,6R)-Tg:(5S,6S)-Tg = 80:20) (40Lustig M.J. Cadet J. Boorstein R.J. Teebor G.W. Nucleic Acids Res. 1992; 20: 4839-4845Google Scholar). Accordingly, the pair of 5R cis-trans isomers are abbreviated as 5R-Tg, and the pair of 5S cis-trans isomers as 5S-Tg throughout this paper. 30UR containing a urea residue was prepared by mild alkaline treatment of 30TG5R and 30TG5S (18Asagoshi K. Odawara H. Nakano H. Miyano T. Terato H. Ohyama Y. Seki S. Ide H. Biochemistry. 2000; 39: 11389-11398Google Scholar, 41Ide H. Kow Y.W. Wallace S.S. Nucleic Acids Res. 1985; 13: 8035-8052Google Scholar). 25FU, 25HMU, and 25OG containing 5-formyluracil (fU), 5-hydroxymethyluracil (hmU), and 7,8-dihydro-8-oxoguanine (8-oxoG), respectively, were chemically synthesized (42Masaoka A. Terato H. Kobayashi M. Ohyama Y. Ide H. J. Biol. Chem. 2001; 276: 16501-16510Google Scholar, 43Matsubara M. Masaoka A. Tanaka T. Miyano T. Kato N. Terato H. Ohyama Y. Iwai S. Ide H. Biochemistry. 2003; 42: 4993-5002Google Scholar, 44Masaoka A. Matsubara M. Hasegawa R. Tanaka T. Kurisu S. Terato H. Ohyama Y. Karino N. Matsuda A. Ide H. Biochemistry. 2003; 42: 5003-5012Google Scholar). 25HOU, 25HOC, 34FP, and 25OXA containing 5-hydroxyuracil (hoU), 5-hydroxycytosine (hoC), 2,6-diamino-4-hydroxy-5-N-methylformamidopyrimidine (mFapyG), and oxanine (Oxa), respectively, were prepared by DNA polymerase reactions with modified 2′-deoxynucleoside 5′-triphosphates as reported previously (19Asagoshi K. Yamada T. Okada Y. Terato H. Ohyama Y. Seki S. Ide H. J. Biol. Chem. 2000; 275: 24781-24786Google Scholar, 43Matsubara M. Masaoka A. Tanaka T. Miyano T. Kato N. Terato H. Ohyama Y. Iwai S. Ide H. Biochemistry. 2003; 42: 4993-5002Google Scholar, 44Masaoka A. Matsubara M. Hasegawa R. Tanaka T. Kurisu S. Terato H. Ohyama Y. Karino N. Matsuda A. Ide H. Biochemistry. 2003; 42: 5003-5012Google Scholar, 45Nakano T. Terato H. Asagoshi K. Masaoka A. Mukuta M. Ohyama Y. Suzuki T. Makino K. Ide H. J. Biol. Chem. 2003; 278: 25264-25272Google Scholar). The oligonucleotides containing the base lesions were 5′-end labeled with [γ-32P]ATP (110 TBq/mmol, Amersham Biosciences) and T4 polynucleotide kinase (New England BioLabs) and purified by a Sep-Pak cartridge (Waters). The labeled oligonucleotides were annealed to appropriate complementary strands and used for activity assays. Duplex substrates are expressed as the combination of an oligonucleotide containing the lesion and the base opposite it (e.g. 30TG5R/A) throughout the paper. For the preparation of 19AP/A, a duplex oligonucleotide containing uracil at the position of the AP site was treated with uracil-DNA glycosylase (New England BioLabs).Table IOligonucleotide substrates used in this studySubstrateDamage (X)Sequence (5′ → 3′)Paired baseaG, A, and C indicate the base opposite the damage (X) in double-stranded substrates. The length of the complementary strand was the same as the lesion strand for each substrate.30TG5R5R-TgCTCGTCAGCATCTXCATCATACAGTCAGTGA30TG5S5S-TgCTCGTCAGCATCTXCATCATACAGTCAGTGA30URUreaCTCGTCAGCATCTXCATCATACAGTCAGTGA25HOUhoUGAAACACTACTATCAXGGAAGAGAGG25HOChoCGAAACACTACTATCAXGGAAGAGAGG25FUfUCATCGATAGCATCCGXCACAGGCAGA25HMUhmUGAAACACTACTATCAXGGAAGAGAGA19APAPACAGACGCCAXCAACCAGGA25OG8-OxoGGAAACACTACTATCGXTCTCCTCTTC34FPmFapyGGAAACACTACTXTCACCCTCCATACCCACATCCTC250XAOxaCATCGATAGCATCCTXCCTTCTCTCCa G, A, and C indicate the base opposite the damage (X) in double-stranded substrates. The length of the complementary strand was the same as the lesion strand for each substrate. Open table in a new tab DNA Glycosylases—The purification of Endo III, Endo VIII, and hNTH1 were reported previously (19Asagoshi K. Yamada T. Okada Y. Terato H. Ohyama Y. Seki S. Ide H. J. Biol. Chem. 2000; 275: 24781-24786Google Scholar, 43Matsubara M. Masaoka A. Tanaka T. Miyano T. Kato N. Terato H. Ohyama Y. Iwai S. Ide H. Biochemistry. 2003; 42: 4993-5002Google Scholar). The native form of hNEIL1 and hNEIL2 proteins were purified as follows. Briefly, based on published sequences (31Bandaru V. Sunkara S. Wallace S.S. Bond J.P. DNA Repair (Amst.). 2002; 1: 517-529Google Scholar, 32Hazra T.K. Izumi T. Boldogh I. Imhoff B. Kow Y.W. Jaruga P. Dizdaroglu M. Mitra S. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 3523-3528Google Scholar), hNEIL1 and hNEIL2 cDNAs were amplified from the human liver cDNA library (Nippon Gene) using the polymerase chain reaction. The amplified DNA fragments were ligated into the NdeI/XhoI site of pET-22b(+) (Novagen). The recombinant plasmids for hNEIL1 and hNEIL2 were designated phNEIL1 and phNEIL2, respectively. E. coli BL21-CodonPlus (DE3)-RIL (Stratagene) was transformed with phNEIL1 or phNEIL2. The original sequence of the inserts was confirmed by sequencing phNEIL1 and phNEIL2 isolated from the host cell. E. coli BL21-CodonPlus (DE3)-RIL harboring phNEIL1 or phNEIL2 was grown in LB media containing chloramphenicol (50 μg/ml) and ampicillin (50 μg/ml) at 37 °C until A600 reached 0.6. After the addition of isopropyl-β-d-thiogalactopyranoside (final concentration, 1 mm), the cell culture was continued at 30 °C for 3 h. The following procedures were performed at 4 °C or on ice. Harvested cells were disrupted by sonication. The cell lysate was centrifuged, and proteins in the supernatant were collected by ammonium sulfate precipitation (60% saturation). The hNEIL1 protein was purified by SP Sepharose CL-4B, MonoS, and Superdex 75 XK16/50 columns (all from Amersham Biosciences). The hNEIL2 protein was purified by SP Sepharose CL-4B (two cycles) and Superdex 75 XK16/50 (two cycles) columns. The pooled fraction containing hNEIL1 or hNEIL2 was dialyzed against 20 mm Hepes-KOH (pH 7.5), 150 mm NaCl, 1 mm dithiothreitol, 1 mm EDTA, and 50% glycerol, and stored at -80 °C (hNEIL1) or -20 °C (hNEIL2). The protein concentration was determined with the BCA protein assay kit (Pierce) using BSA as a standard. Cell Extracts—Cell extracts were prepared on ice or at 4 °C. The HeLa cell extract was prepared from confluent cells. The cell pellet was suspended in three volumes of 50 mm Tris-HCl (pH 7.5), 3 mm EDTA, 5 mm Mg(CH3COO)2, 3 mm 2-mercaptoethanol, 300 mm KCl, 1 mm phenylmethanesulfonyl fluoride, 1 μg/ml leupeptin, and 1 μg/ml pepstatin. The cells were disrupted with 30 strokes of a tight-fitting Dounce homogenizer and centrifuged at 100,000 × g for 30 min. The proteins in the supernatant were collected by ammonium sulfate precipitation (60% saturation). The proteins were resuspended in 20 mm Tris-HCl (pH 7.5), 20 mm NaCl, 1 mm dithiothreitol, and 1 mm EDTA, dialyzed against the same buffer, and used for activity assays. The E. coli cell extract was prepared from exponentially growing E. coli AB1157. The cell pellet was suspended in 10 volumes of 10 mm Tris-HCl (pH 8.0), 1 mm EDTA, 1 mm phenylmethanesulfonyl fluoride, and 0.1 mg/ml lysozyme, and allowed to stand for 30 min. The cells were disrupted by sonication. The cell lysate was centrifuged, and the supernatant was used for activity assays. The protein concentration was determined with the BCA protein assay kit. Activity Assays—The substrates (all 50 fmol, Table I) were incubated with DNA glycosylases in appropriate buffer (10 μl) at 37 °C for 30 min. The amount of proteins was varied depending on the activity of enzymes, and is indicated in the figures. The buffer used for assays with Endo III, Endo VIII, and hNEIL1 was 10 mm Tris-HCl (pH 7.5), 1 mm EDTA, 100 mm NaCl, and 0.1 mg/ml BSA. The buffer for hNTH1 was 20 mm Hepes-KOH (pH 8.0), 0.25 mm dithiothreitol, 0.25 mm EDTA, 50 mm KCl, and 0.1 mg/ml BSA, and that for hNEIL2 was 10 mm Tris-HCl (pH 7.5), 1 mm EDTA, 50 mm NaCl, and 0.1 mg/ml BSA. The reaction was terminated by the addition of gel loading buffer (0.05% xylene cyanol, 0.05% bromphenol blue, 20 mm EDTA, and 98% formamide). After heating at 70 °C for 5 min, products were separated by 16% denaturing PAGE and the radioactivity in the gel was analyzed on a phosphorimaging analyzer BAS2000 (Fuji). For assays with the cell extracts, the substrates (30TG5R and 30TG5S, both 50 fmol) were incubated with the E. coli or HeLa cell extracts (0.5-4 μg) in 10 mm Tris-HCl (pH 7.5), 1 mm EDTA, 100 mm NaCl, and 0.1 mg/ml BSA (10 μl) at 37 °C for 30 (HeLa extracts) or 10 min (E. coli extracts). Products were analyzed as described for purified DNA glycosylases. NaBH4 Trapping Reactions—NaBH4 trapping reactions were performed under conditions similar to those for the activity assay using 19AP/A as a substrate and Endo VIII, hNEIL1, and hNEIL2 (all 200 ng) as enzymes. In the reaction buffer for Endo VIII and hNEIL1, 100 mm NaCl was replaced by 50 mm NaCl plus 50 mm NaBH4, and for hNEIL2, 50 mm NaCl was replaced by 50 mm NaBH4. The sample was incubated at 37 °C for 30 min. After incubation, the sample was mixed with SDS loading buffer (100 mm Tris, 8% SDS, 24% (v/v) glycerol, 4% 2-mercaptoethanol, and 0.02% SERVA Blue G), heated, and separated by 10% SDS-PAGE. Autoradiography and quantitation of the radioactivity were performed as described above. Cross-link Reactions with 25OXA—The duplex of 25OXA/C (10 fmol) was incubated with hNEIL1 or hNEIL2 (200 ng) in the activity assay buffer described above (10 μl) at 37 °C for up to 1 h. The sample was mixed with SDS-loading buffer, heated, and separated by 10% SDS-PAGE. Purification of hNEIL1 and hNEIL2—The hNEIL1 and hNEIL2 proteins were overexpressed in E. coli and purified by several chromatographic steps. SDS-PAGE analysis of the purified hNEIL1 protein showed a single band with the expected molecular mass 43.6 kDa (Fig. 1A) (31Bandaru V. Sunkara S. Wallace S.S. Bond J.P. DNA Repair (Amst.). 2002; 1: 517-529Google Scholar, 32Hazra T.K. Izumi T. Boldogh I. Imhoff B. Kow Y.W. Jaruga P. Dizdaroglu M. Mitra S. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 3523-3528Google Scholar). The purified hNEIL2 protein (36.7 kDa) also showed a single band (Fig. 1A), but its mobility was comparable with that of a 42.4-kDa marker (aldolase). The unusual mobility of the hNEIL2 protein in SDS-PAGE agrees with the previous report (33Hazra T.K. Kow Y.W. Hatahet Z. Imhoff B. Boldogh I. Mokkapati S.K. Mitra S. Izumi T. J. Biol. Chem. 2002; 277: 30417-30420Google Scholar). No bands were evident that indicated the contamination of Endo III or Endo VIII from the E. coli host. hNEIL1 and hNEIL2 were incubated with 19AP/A containing an AP site in the presence of NaBH4, and the trapped reaction intermediate (a Schiff base formed between DNA and enzyme) was analyzed by SDS-PAGE (Fig. 1B). hNEIL1 and hNEIL2 gave rise to a single trapped species, which migrated slower than that formed with Endo VIII (29.6 kDa). This result further confirmed that the hNEIL1 and hNEIL2 preparations were free from Endo VIII and Endo III (23.4 kDa). Activity of Purified Enzymes for Tg Isomers—hNTH1, hNEIL1, hNEIL2, and their E. coli homologues (Endo III and Endo VIII) were incubated with 30TG5R/A and 30TG5S/A containing 5R-Tg and 5S-Tg, respectively, and the products were analyzed by denaturing PAGE (Fig. 2). Fig. 3 shows plots of the amount of nicked products (average of two experiments) against that of enzyme used for the assay, which was varied depending on the activity. hNTH1 and hNEIL1 recognized both 5R-Tg and 5S-Tg isomers, but their specificity for the isomers differed significantly. hNTH1 excised 5R-Tg much more preferentially compared with 5S-Tg (Fig. 3A), whereas hNEIL1 excised 5R-Tg only slightly better than 5S-Tg (Fig. 3B). When 5R-Tg and 5S-Tg in 30TG5R and 30TG5S, respectively, were converted to urea residues by mild alkaline treatment, hNTH1 and hNEIL1 exhibited the same activity toward urea residues derived from the two Tg isomers (data not shown). These results confirmed that the differential specificities of hNTH1 and hNEIL1 toward the Tg isomers originate from the distinct configurations at C-5 and C-6 of the pyrimidine ring. The activity of hNEIL2 for the Tg isomers was below the detection limit (Fig. 3C). From the slope of the essentially linear part of the plot in Fig. 3, the activity for the two Tg isomers was calculated as [nicked substrate]/[enzyme]/min, where square brackets denote the molar concentration, and is summarized in Table II. According to the data in Table II, the specificity ratio toward 5R-Tg versus 5S-Tg is 13:1 for hNTH1 (i.e. 1.4 × 10-2 min-1 versus 1.1 × 10-3 min-1) and 1.5:1 for hNEIL1 (i.e. 5.1 × 10-3 min-1 versus 3.3 × 10-3 min-1), demonstrating marked differences in the isomer specificity between hNTH1 and hNEIL1. It can also be deduced from the activity data (Table II) that for 5R-Tg, hNTH1 exhibits a higher turnover rate than hNEIL1 (hNTH1:hNEIL1 = 2.7:1), whereas for 5S-Tg, hNEIL1 exhibits a higher turnover rate than hNTH1 (hNTH1:hNEIL1 = 1:3). These results are in contrast to those reported recently for mouse NTH1 (mNTH1) and NEIL1 (mNEIL1) (36Rosenquist T.A. Zaika E. Fernandes A.S. Zharkov D.O. Miller H. Grollman A.P. DNA Repair (Amst.). 2003; 2: 581-591Google Scholar), although the isomer specificities of mNTH1 and mNEIL1 for the two Tg isomers are similar to those observed for hNTH1 and hNEIL1 in this study. The ratio of the turnover rates for 5R-Tg (estimated from the reported data) is mNTH1:mNEIL1 = 1:29, and that for 5S-Tg is 1:570, indicating that mNEIL1 is an extremely efficient enzyme as compared with mNTH1 for both Tg isomers, which was not the case for hNEIL1 (see above).Fig. 3Differential activities of Endo III and Endo VIII homologues for the 5R-Tg and 5S-Tg isomers. The percentage of nicked products was determined by the PAGE analysis as shown in Fig. 2, and is plotted against the amount of enzyme used for the assay (average of two experiments). Symbols: •, 5R-Tg; ▴, 5S-Tg. The enzyme used is indicated above each panel.View Large Image Figure ViewerDownload (PPT)Table IIActivity of Endo III and Endo VIII homologues for oxidative base lesionsEnzymeActivity5R-Tg5S-TgfUhmUUreahoUhoC8-OxoGmFapyGAPmin−1hNTH11.4 × 10−21.1 × 10−3NDaND, activity was not determined.ND1.1 × 10−24.0 × 10−31.7 × 10−3ND6.8 × 10−32.3 × 10−2hNEIL15.1 × 10−33.3 × 10−33.5 × 10−4<1 × 10−54.2 × 10−33.6 × 10−35.9 × 10−43.8 × 10−44.4 × 10−33.5 × 10−3hNEIL2<1 × 10−5<1 × 10−5<1 × 10−5<1 × 10−5<1 × 10−5<1 × 10−5<1 × 10−12.7 × 10−52.7 × 10−3Endo III1.9 × 10−14.7 × 10−1NDND1.8 × 10−15.0 × 10−43.5 × 10−2ND8.8 × 10−31.1Endo VIII3.0 × 10−29.3 × 10−3NDND2.0 × 10−21.6 × 10−41.7 × 10−3ND3.6 × 10−41.6 × 10−2a ND, activity was not determined. Open table in a new tab The activity of E. coli Endo III and Endo VIII for the two Tg isomers was determined in a similar manner (Figs. 2 and 3). Like hNTH1 and hNEIL1, Endo III and Endo VIII exhibited significantly different specificity for the two isomers. However, Endo III excised 5S-Tg better than 5R-Tg (Fig. 3D), and the specificity ratio toward 5R-Tg versus 5S-Tg was 1:2.5 (i.e. 1.9 × 10-1 min-1 versus 4.7 × 10-1 min-1, Table II). Thus, despite being homologues, hNTH1 and Endo III have an opposite preference for the Tg isomers. Endo VIII preferentially excised 5R-Tg as compared with 5S-Tg (Fig. 3E), and the specificity ratio toward 5R-Tg versus 5S-Tg was 3.2:1 (i.e. 3.0 × 10-2 min-1 versus 9.3 × 10-3 min-1, Table II). Although hNEIL1 has a slight preference of 5R-Tg over 5S-Tg, the difference in the isomer specificity of Endo VIII (3.2-fold) is greater than that of hNEIL1 (1.5-fold). It is likely from the activity data (Table II) that Endo III exhibits higher turnover rates than Endo VIII for both 5R-Tg (6.3-fold) and 5S-Tg (51-fold). Activity of Purified Enzymes for Other Oxidative Base Lesions—hNTH1, hNEIL1, hNEIL2, Endo III, and Endo VIII were incubated with the substrates containing hoU (25HOU/G), hoC (25HOC/G), mFapyG (34FP/C), an AP site (19AP/A), a urea residue (19UR/A), fU (25FU/A), hmU (25HMU/A), and 8-oxoG (25OG/C), and products were analyzed by denaturing PAGE (data not shown). Fig. 4 shows typical plots of the amount of nicked product (average of two experiments) against that of e" @default.
• W1976471833 created "2016-06-24" @default.
• W1976471833 creator A5017284430 @default.
• W1976471833 creator A5031960613 @default.
• W1976471833 creator A5037158933 @default.
• W1976471833 creator A5053086822 @default.
• W1976471833 creator A5067677903 @default.
• W1976471833 creator A5069829919 @default.
• W1976471833 creator A5075490359 @default.
• W1976471833 date "2004-04-01" @default.
• W1976471833 modified "2023-10-16" @default.
• W1976471833 title "Differential Specificity of Human and Escherichia coli Endonuclease III and VIII Homologues for Oxidative Base Lesions" @default.
• W1976471833 cites W1562498242 @default.
• W1976471833 cites W1593685083 @default.
• W1976471833 cites W1833739857 @default.
• W1976471833 cites W1966631359 @default.
• W1976471833 cites W1972437107 @default.
• W1976471833 cites W1976586299 @default.
• W1976471833 cites W1979266902 @default.
• W1976471833 cites W1985154852 @default.
• W1976471833 cites W1992142601 @default.
• W1976471833 cites W2006377201 @default.
• W1976471833 cites W2010521341 @default.
• W1976471833 cites W2010827142 @default.
• W1976471833 cites W2020095967 @default.
• W1976471833 cites W2022120140 @default.
• W1976471833 cites W2029243559 @default.
• W1976471833 cites W2030593751 @default.
• W1976471833 cites W2031005040 @default.
• W1976471833 cites W2035146517 @default.
• W1976471833 cites W2036103078 @default.
• W1976471833 cites W2036192663 @default.
• W1976471833 cites W2038392802 @default.
• W1976471833 cites W2042907868 @default.
• W1976471833 cites W2046811357 @default.
• W1976471833 cites W2049047540 @default.
• W1976471833 cites W2054218213 @default.
• W1976471833 cites W2059988559 @default.
• W1976471833 cites W2061306581 @default.
• W1976471833 cites W2068407072 @default.
• W1976471833 cites W2076596713 @default.
• W1976471833 cites W2077486912 @default.
• W1976471833 cites W2081145376 @default.
• W1976471833 cites W2081201480 @default.
• W1976471833 cites W2082431983 @default.
• W1976471833 cites W2084505555 @default.
• W1976471833 cites W2086468554 @default.
• W1976471833 cites W2087342144 @default.
• W1976471833 cites W2090219305 @default.
• W1976471833 cites W2099418917 @default.
• W1976471833 cites W2105139062 @default.
• W1976471833 cites W2106562918 @default.
• W1976471833 cites W2126169809 @default.
• W1976471833 cites W2126651276 @default.
• W1976471833 cites W2126917185 @default.
• W1976471833 cites W2127753323 @default.
• W1976471833 cites W2130403231 @default.
• W1976471833 cites W2134259738 @default.
• W1976471833 cites W2139251404 @default.
• W1976471833 cites W2145124885 @default.
• W1976471833 cites W2150840580 @default.
• W1976471833 cites W2153577740 @default.
• W1976471833 cites W2154828075 @default.
• W1976471833 cites W2163076785 @default.
• W1976471833 cites W2163392206 @default.
• W1976471833 cites W2168859393 @default.
• W1976471833 cites W2323274627 @default.
• W1976471833 doi "https://doi.org/10.1074/jbc.m400393200" @default.
• W1976471833 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14734554" @default.
• W1976471833 hasPublicationYear "2004" @default.
• W1976471833 type Work @default.
• W1976471833 sameAs 1976471833 @default.
• W1976471833 citedByCount "117" @default.
• W1976471833 countsByYear W19764718332012 @default.
• W1976471833 countsByYear W19764718332013 @default.
• W1976471833 countsByYear W19764718332014 @default.
• W1976471833 countsByYear W19764718332015 @default.
• W1976471833 countsByYear W19764718332016 @default.
• W1976471833 countsByYear W19764718332017 @default.
• W1976471833 countsByYear W19764718332018 @default.
• W1976471833 countsByYear W19764718332019 @default.
• W1976471833 countsByYear W19764718332020 @default.
• W1976471833 countsByYear W19764718332021 @default.
• W1976471833 countsByYear W19764718332022 @default.
• W1976471833 countsByYear W19764718332023 @default.
• W1976471833 crossrefType "journal-article" @default.
• W1976471833 hasAuthorship W1976471833A5017284430 @default.
• W1976471833 hasAuthorship W1976471833A5031960613 @default.
• W1976471833 hasAuthorship W1976471833A5037158933 @default.
• W1976471833 hasAuthorship W1976471833A5053086822 @default.
• W1976471833 hasAuthorship W1976471833A5067677903 @default.
• W1976471833 hasAuthorship W1976471833A5069829919 @default.
• W1976471833 hasAuthorship W1976471833A5075490359 @default.
• W1976471833 hasBestOaLocation W19764718331 @default.
• W1976471833 hasConcept C104317684 @default.
• W1976471833 hasConcept C134306372 @default.
• W1976471833 hasConcept C153911025 @default.
• W1976471833 hasConcept C181199279 @default.

• next