FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2018045306> ?p ?o ?g. }

• W2018045306 endingPage "4162" @default.
• W2018045306 startingPage "4155" @default.
• W2018045306 abstract "We have isolated a novel cDNA clone from rat cerebral cortex encoding a protein of 670 amino acids (NCKX2) that has significant similarity to the 1199-amino acid-long Na/Ca-K exchanger of bovine rod outer segment (NCKX1). NCKX2 transcripts are 10.5 kilobase pairs in length and are expressed abundantly in neurons throughout the brain and with much lower abundance in selected other tissues. The predicted topology of the rat NCKX2 protein is very similar to that of bovine NCKX1, beginning with a solitary transmembrane segment (M0), which is removed as a “signal peptide” in bovine NCKX1, an extracellular loop, a cluster of five transmembrane spanning segments (M1 to M5), a long cytoplasmic loop, and a final hydrophobic cluster (M6 to M11). Within the hydrophobic clusters, rat NCKX2 shares 80% identity and 91% similarity with bovine NCKX1. The two larger hydrophilic loops are much shorter in NCKX2 than in NCKX1, accounting largely for the difference in length between the two proteins, and are dissimilar in sequence except for a 32-amino acid stretch with 69% identity in the cytosolic loop. NCKX2 was epitope-tagged in the extracellular domain and was shown to be expressed at the surface of transfected HEK cells. Analysis of NCKX2 function by fluorescent imaging of fura-2-loaded transfected cells demonstrated that NCKX2 is a potassium-dependent sodium/calcium exchanger. We have isolated a novel cDNA clone from rat cerebral cortex encoding a protein of 670 amino acids (NCKX2) that has significant similarity to the 1199-amino acid-long Na/Ca-K exchanger of bovine rod outer segment (NCKX1). NCKX2 transcripts are 10.5 kilobase pairs in length and are expressed abundantly in neurons throughout the brain and with much lower abundance in selected other tissues. The predicted topology of the rat NCKX2 protein is very similar to that of bovine NCKX1, beginning with a solitary transmembrane segment (M0), which is removed as a “signal peptide” in bovine NCKX1, an extracellular loop, a cluster of five transmembrane spanning segments (M1 to M5), a long cytoplasmic loop, and a final hydrophobic cluster (M6 to M11). Within the hydrophobic clusters, rat NCKX2 shares 80% identity and 91% similarity with bovine NCKX1. The two larger hydrophilic loops are much shorter in NCKX2 than in NCKX1, accounting largely for the difference in length between the two proteins, and are dissimilar in sequence except for a 32-amino acid stretch with 69% identity in the cytosolic loop. NCKX2 was epitope-tagged in the extracellular domain and was shown to be expressed at the surface of transfected HEK cells. Analysis of NCKX2 function by fluorescent imaging of fura-2-loaded transfected cells demonstrated that NCKX2 is a potassium-dependent sodium/calcium exchanger. A plasma membrane sodium-calcium exchange process plays an important role in controlling cytosolic calcium concentrations in a broad number of tissues (1Lederer W.J. He S. Luo S. duBell W. Kofuji P. Kieval R. Neubauer C.F. Ruknudin A. Cheng H. Cannell M.B. Rogers T.B. Schulze D.H. Ann. N. Y. Acad. Sci. 1996; 779: 7-17Crossref PubMed Scopus (25) Google Scholar). Detailed functional and structural studies have revealed the existence of two classes of protein that underlie the sodium-calcium exchange process. One class, exemplified by the sodium-calcium exchanger from dog heart, NCX1, 1The abbreviations used are: PCR, polymerase chain reaction; SSCP, standard saline citrate phosphate; BES, N,N-bis[2-hydroxyethyl]-2-aminoethanesulfonic acid. catalyzes the exchange of three sodium ions for one calcium ion (2Nicoll D.A. Longoni S. Philipson K.D. Science. 1990; 250: 562-565Crossref PubMed Scopus (628) Google Scholar). The other class, exemplified by the sodium-calcium + potassium exchanger of bovine retinal rod outer segments, NCKX1, transports four sodium ions in exchange for one calcium and one potassium ion (3Schnetkamp P.P.M. Cell Calcium. 1995; 18: 322-330Crossref PubMed Scopus (48) Google Scholar). NCX1 is the most abundantly and widely expressed sodium-calcium exchanger gene, with products present in almost every tissue and present at a particularly high level in heart, brain, and kidney. Recent molecular studies have shown that expression of theNCX1 gene is driven by three separate promoters in a tissue specific fashion, giving rise to transcripts with unique 5′-untranslated region exons (4Lytton J. Lee S.-L. Lee W.-S. van Baal J. Bindels R.J.M. Kilav R. Naveh-Many T. Silver J. Ann. N. Y. Acad. Sci. 1996; 779: 58-72Crossref PubMed Scopus (31) Google Scholar). In addition, there is a region of complex alternative splicing that results in several protein variants with sequence differences in a fairly short region near the carboxyl end of the central cytoplasmic domain of the molecule (5Schulze D.H. Kojufi P. Valdivia C. He S. Luo S. Ruknudin A. Wisel S. Kirby M.S. duBell W. Lederer W.J. Ann. N. Y. Acad. Sci. 1996; 779: 46-57Crossref PubMed Scopus (13) Google Scholar). Two other structurally and functionally homologous gene products have also been identified, NCX2 and NCX3, which are expressed selectively in brain and skeletal muscle, apparently at lower levels than NCX1 (6Nicoll D.A. Quednau B.D. Qui Z. Xia Y.-R. Lusis A.J. Philipson K.D. J. Biol. Chem. 1996; 271: 24914-24921Abstract Full Text Full Text PDF PubMed Scopus (311) Google Scholar, 7Li Z. Matsuoka S. Hryshko L.V. Nicoll D.A. Bersohn M.M. Burke E.P. Lifton R.P. Philipson K.D. J. Biol. Chem. 1994; 269: 17434-17439Abstract Full Text PDF PubMed Google Scholar). Mechanistically, the NCKX1 enzyme is quite similar to NCX1, although coupling of the potassium gradient and the increase in coupling of the sodium gradient to the thermodynamic driving force allow NCKX1 to control calcium levels in rods even when the membrane potential and sodium gradient are diminished in darkness (3Schnetkamp P.P.M. Cell Calcium. 1995; 18: 322-330Crossref PubMed Scopus (48) Google Scholar, 8Reeves J.P. Sutko J.L. J. Biol. Chem. 1983; 258: 3178-3182Abstract Full Text PDF PubMed Google Scholar, 9Schnetkamp P.P.M. Prog. Biophys. Mol. Biol. 1989; 54: 1-29Crossref PubMed Scopus (51) Google Scholar). Surprisingly, although the proposed overall topology of the molecule is similar—two clusters of five and six hydrophobic helices separated by a central large cytoplasmic loop—there is very little sequence similarity between NCX and NCKX molecules (10Reiländer H. Achilles A. Friedel U. Maul G. Lottspeich F. Cook N.J. EMBO J. 1992; 11: 1689-1695Crossref PubMed Scopus (160) Google Scholar). Nevertheless, two short stretches, one in each hydrophobic helix cluster, do show significant similarity. Interestingly, these regions are the sites of highest conservation among sodium-calcium exchangers cloned from various organisms. It was recently noted that the two regions are also similar to one another and thus may have arisen from an ancient gene duplication event, a finding that has led to the speculation that these sites may constitute the ion binding pocket required for transport across the membrane (11Schwarz E.M. Benzer S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10249-10254Crossref PubMed Scopus (181) Google Scholar, 12Nicoll D.A. Hryshko L.V. Matsuoka S. Frank J.S. Philipson K.D. J. Biol. Chem. 1996; 271: 13385-13391Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). Although NCKX1 expression appears to be restricted to retinal photoreceptors, there is some evidence for a sodium-calcium + potassium exchange process in other tissues. Synaptic plasma membrane preparations from rat brain have been shown to possess sodium-calcium exchange, which is partially dependent upon potassium and is not mimicked by other monovalent alkali cations like lithium. In addition, uptake of rubidium (acting as a congener for potassium) was stimulated in the presence of sodium-calcium exchange (13Dahan D. Spanier R. Rahamimoff H. J. Biol. Chem. 1991; 266: 2067-2075Abstract Full Text PDF PubMed Google Scholar). This potassium dependence is distinct from the well characterized monovalent cation effect on the cardiac-type NCX1 (14Condrescu M. Rojas H. Gerardi A. DiPolo R. Beaugé L. Biochim. Biophys. Acta. 1990; 1024: 198-202Crossref PubMed Scopus (16) Google Scholar, 15Slaughter R.S. Sutko J.L. Reeves J.P. J. Biol. Chem. 1983; 258: 3183-3190Abstract Full Text PDF PubMed Google Scholar) and suggests that brain may express both potassium-dependent and potassium-independent sodium-calcium exchangers. Human platelets have also been shown to possess a sodium-calcium exchange activity that is dependent upon potassium (16Kimura M. Aviv A. Reeves J.P. J. Biol. Chem. 1993; 268: 6874-6877Abstract Full Text PDF PubMed Google Scholar). As a consequence of these observations, we have searched for potassium-dependent sodium-calcium exchangers using a homology approach based on the sequence of the cloned bovineNCKX1. We identified and isolated a full-length cDNA, called NCKX2, from rat brain that encodes a novel protein with extensive similarity to bovine NCKX1 in the hydrophobic regions and displays potassium-dependent sodium-calcium exchange activity when expressed in HEK-293 cells. All molecular procedures were performed essentially according to standard protocols (17Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, New York1997Google Scholar, 18Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) or the directions of reagent manufacturers, unless indicated otherwise. Chemicals were of the highest quality analytical grade available and were obtained from either Fisher, BDH, or Sigma, unless indicated otherwise. Nucleic acid and protein amino acid sequence analyses were performed with the MacVector software package (Oxford Molecular Group), with TopPred II (19Claros M.G. von Heijne G. Comput. Appl. Biosci. 1994; 10: 586-685Google Scholar), or via Internet connection to the National Center for Biotechnology Information at the National Institutes of Health. 2http://www.ncbi.nlm.nih.gov. Two primers were designed based on sequences of relatively low degeneracy from the end of putative transmembrane span 7 (amino acids 1053–1059, YLMVWWA) and the loop between transmembrane spans 10 and 11 (amino acids 1164–1170, WRMNKIL) of the bovine NCKX1 sequence (10Reiländer H. Achilles A. Friedel U. Maul G. Lottspeich F. Cook N.J. EMBO J. 1992; 11: 1689-1695Crossref PubMed Scopus (160) Google Scholar): YYTIATGGTITGGTGGGC (ncke1) and ARIATYTTRTTCATICKCCA (ncke2; standard degenerate nucleic acid codes (I = inosine)). RNA, isolated from various rat or mouse tissues according to the CsCl centrifugation procedure, was reverse transcribed using oligo(dT) and Superscript II Moloney-murine leukemia virus reverse transcriptase (Life Technologies, Inc.) and amplified with the above primers at an annealing temperature of 42 °C. Products were analyzed on ethidium bromide-stained polyacrylamide gels, and bands of the expected size (351 nucleotides) were excised, subcloned, and sequenced. Poly(A)+ mRNA was isolated from rat brain cerebral cortex by oligo(dT)-cellulose chromatography. An oligo(dT)-primed size-fractionated (>4 kilobase pairs) cDNA library was constructed from this mRNA with Superscript II reverse transcriptase and ligated using BstXI-EcoRI adapters into the vector pcDNA II (Invitrogen). Approximately 250,000 transformants in E. coli DH10B were plated and screened with a digoxigenin-UTP (Boehringer Mannheim)-labeled riboprobe, prepared from the PCR products described above, essentially as described previously (20Wu K.-D. Lytton J. Am. J. Physiol. 1993; 264: C333-C341Crossref PubMed Google Scholar). Several positive colonies were purified, and the plasmid DNA containing the longest insert (clone BC-1) was analyzed by restriction endonuclease digestion, Southern blotting, and DNA sequencing. Sequence analysis of this and subsequent clones was obtained on double-stranded templates either with [35S]αdCTPαS and Sequenase 2.0 (United States Biochemicals) or with the AmpliTaq FS kit from Perkin-Elmer. Fluorescently labeled sequencing reactions were analyzed at the University of Calgary Core DNA Services facility. The coding and 5′-untranslated regions were sequenced on both strands, whereas the majority of the 3′-untranslated region was sequenced only on one strand. The 5′-end of NCKX2 transcripts corresponding to the BC-1 clone was analyzed using inverse PCR essentially according to published accounts (21Zeiner M. Gehring U. BioTechniques. 1994; 17: 1051-1053Google Scholar). In brief, 5 μg of poly(A)+ mRNA from rat cerebral cortex was reverse transcribed with Superscript II using the gene-specific primer gsp1 (TCTAAGAGAGTTCTTTGACG) based on theBC-1 sequence. The cDNA was converted to second strand essentially as described previously (20Wu K.-D. Lytton J. Am. J. Physiol. 1993; 264: C333-C341Crossref PubMed Google Scholar), purified, phosphorylated, and ligated in dilute solution to circularize the cDNA fragments. Circles were then amplified using primers gsp2 (CAGAGGAGAAGCCAGTGATGTGACG) and gsp3 (GGCCCATGACAAGGCCAATGACTCG), which are also based on BC-1 sequence upstream from gsp1 and face away from each other. Amplified products were gel purified, subcloned, and sequenced. The location of the BC-1 clone with respect to its full-length cognate NCKX2 transcript was determined by RNase H digestion of annealed complexes between rat cerebral cortex mRNA and antisense primers based on sequence from either end of clone BC-1. Primers used were gsp1 and gsp3 (above), which anneal ∼180 and ∼30 nucleotides from the 5′-end of cloneBC-1, respectively, and gsp4 (TGGGCGAATCTTGCTTAAC), which anneals about 150 nucleotides from the 3′-end of clone BC-1. Two μg of poly(A)+ mRNA from rat cerebral cortex was annealed with 200 pmol of each primer in 25 μl of 130 KCl and 13 mm MgCl2 by heating to 65 °C for 5 min and then allowing the mixture to cool slowly to room temperature. Twenty-five μl of 125 mm Tris-HCl, pH 7.8, 10 mm dithiothreitol containing 2 units of RNase H (Pharmacia) was added to each tube, and the digestion was incubated at 37 °C for 20 min. The reaction was then stopped with 2 μl of 0.5 mEDTA, pH 8, the RNA was recovered by ethanol precipitation, and the products were analyzed by Northern blot. Control reactions, one without primer and one without RNase H, were run in parallel. Samples of RNA were electrophoresed on 0.8% agarose-formaldehyde gels and transferred to a nylon membranes by capillary diffusion overnight. The UV-cross-linked membranes were hybridized with a digoxigenin-UTP-labeled riboprobe according to the directions of the manufacturer (Boehringer Mannheim) as described previously (20Wu K.-D. Lytton J. Am. J. Physiol. 1993; 264: C333-C341Crossref PubMed Google Scholar). The probe was a 726-nucleotide HindIII fragment from the 5′-end of clone BC-1. Adult male Wistar rats were perfused transcardially with 4% paraformaldehyde in PBS (130 mmNaCl, 3 mm KCl, 8 mmNa2HPO4, 2 mmKH2PO4, pH 7.2, 0.1 mmMgCl2, and 0.1 mm CaCl2), and their brains were removed and embedded in paraffin. Sections of 6–8 μm cut in the horizontal plane were collected onto Fisher Plus slides.In situ hybridization was performed essentially according to published accounts (22Schaeren-Wiemers N. Gerfin-Moser A. Histochemistry. 1993; 100: 431-440Crossref PubMed Scopus (1086) Google Scholar, 23Breitschopf H. Suchanek G. Nonradioactive in Situ Hybridization Application Manual. 2nd Ed. Boehringer Mannheim GmbH, Mannheim1996: 136-140Google Scholar), using digoxigenin-labeled riboprobes that were synthesized from a template corresponding to a 2.3-kilobase pairNsiI fragment derived from the 5′-end of the BC-1clone. The brain sections were dewaxed in xylene, hydrated through a graded ethanol:water series, treated with 20 μg/ml of proteinase K in PBS, postfixed with 4% paraformaldehyde in PBS, acylated with acetic anhydride, and then incubated overnight at 68 °C in a hybridization solution composed of 50% formamide, 10% dextran sulfate, 5× SSCP (1× SSCP is 120 mm NaCl, 15 mm sodium citrate, 13 mm KH2PO4, 1 mmEDTA, pH 7.2), 0.01% polyvinylpyrrolidone, 0.01% Ficoll, 0.01% bovine serum albumin, 0.25 mg/ml salmon sperm DNA, 0.25 mg/ml yeast tRNA, 0.1 mg/ml poly(A), and 0.5 μg/ml of base-hydrolyzed probe. The slides were then washed at 68 °C, first in 2× SSCP and subsequently in 0.2× SSCP, twice each for 20 min. The hybridized probe was detected using alkaline phosphatase-coupled anti-digoxigenin antibody (Boehringer Mannheim) diluted 1:1000, followed by incubation overnight with 4-nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl-phosphate substrate solution. Primers flanking the presumed cytoplasmic domain, based on the sequence of BC-1 and including restriction sites and clamps (ncke4, CGTGGATTCGTCCAAGTAGAGAGATGG, and ncke5, CCGCTCGAGCTGCTTGCGGGTGTTGG) were used to amplify oligo(dT)-primed reverse transcribed rat brain RNA. Products were gel-purified, subcloned, and sequenced. A full-length clone encoding the NCKX2 protein was obtained by combining a fragment based on the inverse PCR product with a fragment from the BC-1 clone as follows. Rat cerebellum RNA was reverse transcribed using the specific primer gsp5 (CCTTTGGGTAGTCTCCC) and amplified using the primers gsp6 (CTAGGGCCCGTCACATC), which overlaps the ApaI site at position 229, and ncke3 (CGAGGGCCCACCAGAAGATCCAAGATGG), which comprises the initiator methionine codon plus one base of the subsequent codon, 17 nucleotides of 5′-untranslated sequence, and 7 additional nucleotides completing an ApaI site and a clamp sequence. The 257-nucleotide product was digested with ApaI and ligated with ApaI-digested 2.3-kilobase pair NsiI subclone (above). The resultant construct, which encoded a full-length NCKX2 open reading frame, was confirmed by sequencing from the 5′-end. So that the protein product encoded by this clone could be detected, a FLAG (24Hopp T.P. Prickett K.S. Price V. Libby R.T. March C.J. Cerretti P. Urdal D.L. Conlon P.J. Biotechnology. 1988; 6: 1205-1210Crossref Scopus (754) Google Scholar) epitope-tag sequence (amino acids DYKDDDDK) was inserted in place of the predicted extracellular sequence found at amino acids 90–97 (DLNDKIRD) using two chimeric primers, each encoding an overlapping segment of the FLAG sequence, as well as upstream flanking NCKX2 sequence (flagncke1: GTCATCGTCGTCCTTGTAGTCTAAGAGAGTTCTTTG) or downstream flankingNCKX2 sequence (flagncke2: TACAAGGACGACGATGACAAGTACACCCCACAGCCAC). One ng of the full-lengthNCKX2 construct (above) was used as template for two PCR reactions: (i) from the M13U primer sequence of the vector (GTAAAACGACGGCCAGTGA) to the flagncke1 primer; (ii) from the flagncke2 primer to a specific primer just downstream of the XbaI site at position 682 (gsp7: CCAGGTCAGGTTTAAGATTTC). An aliquot of purified product from each of these reactions was combined together with primers M13U and gsp7 to amplify a fragment of about 780 base pairs, which was digested with KpnI and XbaI, subcloned, and sequenced. The KpnI-XbaI fragment was isolated from an appropriate clone and used to replace the corresponding fragment from the full-length NCKX2 construct above, to create a FLAG-tagged full-length NCKX2 clone. The ∼2.3-kilobase pair FLAG-NCKX2 fragment was then excised by digestion with KpnI and BamHI and ligated, blunt-ended, into the HindIII-digested mammalian expression vector pRc/CMV (Invitrogen). Transfection of Qiagen-purified FLAG-NCKX2 cDNA into HEK-293 cells was performed using a standard calcium-phosphate precipitation protocol with BES buffer essentially as described previously (25Toyofuku T. Kurzydlowski K. Tada M. MacLennan D.H. J. Biol. Chem. 1994; 269: 3088-3094Abstract Full Text PDF PubMed Google Scholar). The FLAG-NCKX2cDNA, cloned in the reverse orientation in the pMT2 vector (26Kaufman R.J. Davies M.V. Pathak V.K. Hershey J.W.B. Mol. Cell. Biol. 1989; 9: 946-958Crossref PubMed Scopus (333) Google Scholar), was used in control transfections. A clonal derivative of HEK-293 cells, which expresses the SV40 large T antigen, was originally obtained from Ron Kopito (Stanford University). Expression was analyzed 2 days following transfection. For protein expression studies, postnuclear extracts were prepared by solubilizing transfected cells in 1% Triton X-100, 0.5% deoxycholate, 0.14 m NaCl, 10 mm EDTA, 25 mm TrisCl, pH 7.4, 100 units/ml aprotinin, 0.1 mm phenylmethylsulfonyl fluoride. Crude microsome preparations were isolated as described previously (27Lytton J. Westlin M. Burk S.E. Shull G.E. MacLennan D.H. J. Biol. Chem. 1992; 267: 14483-14489Abstract Full Text PDF PubMed Google Scholar). For immunofluorescence and calcium imaging experiments, cells were plated onto glass coverslips, which had been coated with 1 mg/ml protamine solution. Immunoblotting and immunofluorescence were performed essentially as described previously (27Lytton J. Westlin M. Burk S.E. Shull G.E. MacLennan D.H. J. Biol. Chem. 1992; 267: 14483-14489Abstract Full Text PDF PubMed Google Scholar) using the M2 anti-FLAG monoclonal antibody (Kodak Scientific Imaging) at 5 μg/ml. For calcium imaging, transfected cells were loaded with 5 μmfura-2-AM, 0.01% pluronic F-127 (Molecular Probes) in serum-free DMEM medium for 20–30 min at room temperature. The coverslips were then mounted in a perfusion chamber (Warner Instruments) on a Zeiss Axiovert 135 microscope. Fura-2 fluorescence was captured through a Fluar × 20 objective and a Chroma filter set using the ImageMaster System and DeltaRAM rapid wavelength-switching illuminator from Photon Technology International. As part of our interest in molecular diversity of sodium-calcium exchangers, we used a reverse transcription-coupled PCR approach to search for novel molecules. Primers were designed from regions of low degeneracy within the carboxyl-terminal cluster of putative transmembrane helices of the bovine retinal rod outer segment Na/Ca-K exchanger, NCKX1. Products were amplified from both rat brain and eye RNA samples and very faintly from heart, but not from any other tissues tested. Cloning and sequencing of these bands revealed two species from eye, one of which was unique (I-14), and the other of which was identical with products in brain and heart (B-2). Comparison of these sequences with the bovine NCKX1 clone suggested that the unique eye clone I-14 was the rat equivalent of NCKX1 and the “brain” clone, B-2, was the product of a novel gene that we callNCKX2. The novel brain product B-2 was therefore used as a probe to screen at high stringency a cDNA library prepared from rat cerebral cortex mRNA in the vector pcDNAII. Several positive clones were isolated, the longest of which was 8.7 kilobase pairs. Partial sequence of this clone (called BC-1) revealed a sequence identical to that of the probe B-2 and a long open reading frame beginning at one end of the clone but without an initiator methionine. Thus, BC-1 did not contain the 5′-end of the transcript, nor was there a poly(A) tail or polyadenylation signal at the 3′-end of the clone. Northern analysis (see below, Fig.1) indicated that the major transcript corresponding to the BC-1 clone was 10.5 kilobase pairs in length. The position of the BC-1 clone within its cognate transcript was determined using RNase H digestion of complexes formed between rat cerebrum mRNA and antisense primers designed from sequence near either end of the BC-1 clone. Analysis by Northern blot of the digestion products revealed bands of about 9 and 10.2 kb from complexes formed with primers from the 3′- and 5′-ends of BC-1, respectively, compared with the 10.5 kb message found in control reactions (data not shown). This indicated that theBC-1 clone was missing approximately 1.5 kilobase pairs from the 3′ end but only about 300 nucleotides from the 5′ end. The technique of inverse PCR was used to obtain the missing 5′-end of the NCKX2 transcript. Multiple independently isolated clones all gave rise to the same fragment, extending 226 base pairs further 5′ than the BC-1 sequence. The combined sequences of the inverse PCR product and the BC-1 clone code for anNCKX2 cDNA with 148 base pairs of 5′-UTR, an open reading frame of 2009 base pairs, and a 3′-UTR of 6785 base pairs. The initiator methionine of the coding region falls within a sequence that fits the Kozak consensus (28Kozak M. J. Biol. Chem. 1991; 266: 19867-19870Abstract Full Text PDF PubMed Google Scholar) very well, tCCAagATGG (uppercase indicates matches), including the important −3 and +4 nucleotides. In addition, multiple stop codons are present in all three frames upstream from this methionine start codon. The tissue distribution of NCKX2 transcripts is shown in Fig. 1. The major transcript of 10.5 kilobase pairs was found to be abundantly expressed in all regions of the brain and also more weakly in eye, large intestine, and adrenal tissue. Another band, running at about 4.5 kilobase pairs, was also visible in heart, aorta, small and large intestine, and lung, although longer exposure times were required to see this species. Because we were able to amplify a PCR product corresponding to NCKX2 from heart RNA, the 4.5-kilobase pair band may correspond to a low abundance transcript polyadenylated at an upstream site. It is also possible, however, that transcripts visible in tissues outside of the brain may correspond to cross-reaction of theNCKX2 probe with larger amounts of related gene product(s). Note that a faint band (more evident in longer exposures, not shown) at about 6 kilobase pairs was present in RNA from eye, which corresponds to cross-reaction with the rat NCKX1 transcript. The location of NCKX2 transcripts in the brain was determined by in situ hybridization, as shown in Fig.2. Expression was restricted to neuronal cell bodies in almost all regions of the brain (29Carpenter M.B. Core Text of Neuroanatomy. 4th Ed. Williams and Wilkins, Baltimore1991Google Scholar, 30Paxinos G. Watson C. The Rat Brain in Stereotaxic Coordinates. 2nd Ed. Academic Press, New York1996Google Scholar). In the neocortex, cells throughout layers II–VI were labeled, with particularly strong expression in layers VI and V. Hippocampal expression was strongest in the CA3 neurons, followed by CA1, then CA4, and then dentate gyrus neurons. Expression was robust throughout the striatum, with clearly observed regional patches of reduced intensity that may correspond to striosomes of the caudate nucleus. Expression was evident in all regions of the thalamus but was particularly strong in the medial geniculate body. In the cerebellum, strong expression was observed in stellate cells of the molecular layer, as well as in neurons of the deep cerebellar nuclei (not shown). Lower expression was also evident in the Purkinje neurons. In addition, expression was observed at high levels in entorhinal cortex, in many pontine nuclei, in the indusium griseum, and at lower levels in mitral and glomerular neurons of the olfactory bulb, and in subependymal neurons of the medial habenula (not shown). Of note, the septal nuclei were negative. The NCKX2 transcript encodes a protein with a predicted size of 74,651 Da and the sequence shown in Fig.3. Hydropathy analysis suggests 12 transmembrane segments resulting in a protein with a topology analogous to both NCX1 and NCKX1, as shown in Fig.4. Both a single consensus glycosylation site and a potential cleavage site for signal peptidase are present on the extracellular loop between M0 and M1, in positions analogous to the known sites of NCX1 (31Durkin J.T. Ahrens D.C. Pan Y.C.E. Reeves J.P. Arch. Biochem. Biophys. 1991; 290: 369-375Crossref PubMed Scopus (64) Google Scholar, 32Hryshko L.V. Nicoll D.A. Weiss J.N. Philipson K.D. Biochim. Biophys. Acta. 1993; 1151: 35-42Crossref PubMed Scopus (62) Google Scholar). In addition, a sequence weakly resembling a calmodulin binding motif (33O'Neil K.T. DeGrado W.F. Trends Biochem. Sci. 1990; 15: 59-64Abstract Full Text PDF PubMed Scopus (716) Google Scholar) is present at the beginning of the cytoplasmic loop following M5, analogous to the location of the XIP region of NCX1 (34Li Z. Nicoll D.A. Collins A. Hilgemann D.W. Filoteo A.G. Penniston J.T. Weiss J.N. Tomich J.M. Philipson K.D. J. Biol. Chem. 1991; 266: 1014-1020Abstract Full Text PDF PubMed Google Scholar). Analysis of NCKX2 transcripts from rat brain RNA by PCR has also revealed the presence of a slightly shorter species, apparently as a consequence of alternative splicing, which encodes a protein lacking a 17-amino acid stretch within the large cytoplasmic loop, as shown in Figs. 3 and 4. The location of several potential sites for modification by a variety of protein kinases is also illustrated in Fig. 3.Figure 4Hydropathy profile and model for the transmembrane topology of rat NCKX2. A hydropathy profile was generated with the TopPred II program using the Engelman, Steitz, and Goldman algorithm (19Claros M.G. von Heijne G. Comput. Appl. Biosci. 1994; 10: 586-685Google Scholar). The shaded regions with positive values correspond to the predicted transmembrane segments, shown ascylinders in the model below the graph. The hatched horizontal bars on the hydropathy plot indicate the regions with highest similarity to bovine NCKX1 (see Fig. 5). The schematic model also indicates the relative positions of the FLAG epitope insertion site, the alternate splice, putative glycosylation (CHO), signal peptidase (SigPase?) cleavage sites, and the two α-repeats.View Large Image Figure ViewerDownload (PPT) The similarity between rat NCKX2 and bovine NCKX1 is shown in Fig.5. The two proteins share an overall amino acid identity of 55% (and a" @default.
• W2018045306 created "2016-06-24" @default.
• W2018045306 creator A5027960395 @default.
• W2018045306 creator A5039817142 @default.
• W2018045306 creator A5044614967 @default.
• W2018045306 creator A5062560228 @default.
• W2018045306 creator A5071109183 @default.
• W2018045306 creator A5073140119 @default.
• W2018045306 creator A5082148663 @default.
• W2018045306 date "1998-02-01" @default.
• W2018045306 modified "2023-09-27" @default.
• W2018045306 title "Molecular Cloning of a Novel Potassium-dependent Sodium-Calcium Exchanger from Rat Brain" @default.
• W2018045306 cites W1503346460 @default.
• W2018045306 cites W1507203601 @default.
• W2018045306 cites W1518120013 @default.
• W2018045306 cites W1539099740 @default.
• W2018045306 cites W1546570611 @default.
• W2018045306 cites W1574288427 @default.
• W2018045306 cites W1599959410 @default.
• W2018045306 cites W1968901680 @default.
• W2018045306 cites W1986210448 @default.
• W2018045306 cites W1988297454 @default.
• W2018045306 cites W1991220984 @default.
• W2018045306 cites W1997619666 @default.
• W2018045306 cites W2005650912 @default.
• W2018045306 cites W2007473116 @default.
• W2018045306 cites W2009126004 @default.
• W2018045306 cites W2011954551 @default.
• W2018045306 cites W2020922831 @default.
• W2018045306 cites W2024906448 @default.
• W2018045306 cites W2031626109 @default.
• W2018045306 cites W2043832680 @default.
• W2018045306 cites W2050553080 @default.
• W2018045306 cites W2055043387 @default.
• W2018045306 cites W2059201211 @default.
• W2018045306 cites W2067616314 @default.
• W2018045306 cites W2068615953 @default.
• W2018045306 cites W2076218906 @default.
• W2018045306 cites W2083092470 @default.
• W2018045306 cites W2092473345 @default.
• W2018045306 cites W2100220730 @default.
• W2018045306 cites W2132194645 @default.
• W2018045306 cites W2140100868 @default.
• W2018045306 cites W2170680714 @default.
• W2018045306 cites W2264443444 @default.
• W2018045306 cites W2409249472 @default.
• W2018045306 cites W2417252497 @default.
• W2018045306 cites W304878669 @default.
• W2018045306 doi "https://doi.org/10.1074/jbc.273.7.4155" @default.
• W2018045306 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9461611" @default.
• W2018045306 hasPublicationYear "1998" @default.
• W2018045306 type Work @default.
• W2018045306 sameAs 2018045306 @default.
• W2018045306 citedByCount "121" @default.
• W2018045306 countsByYear W20180453062012 @default.
• W2018045306 countsByYear W20180453062013 @default.
• W2018045306 countsByYear W20180453062014 @default.
• W2018045306 countsByYear W20180453062015 @default.
• W2018045306 countsByYear W20180453062017 @default.
• W2018045306 countsByYear W20180453062018 @default.
• W2018045306 countsByYear W20180453062020 @default.
• W2018045306 countsByYear W20180453062021 @default.
• W2018045306 countsByYear W20180453062022 @default.
• W2018045306 crossrefType "journal-article" @default.
• W2018045306 hasAuthorship W2018045306A5027960395 @default.
• W2018045306 hasAuthorship W2018045306A5039817142 @default.
• W2018045306 hasAuthorship W2018045306A5044614967 @default.
• W2018045306 hasAuthorship W2018045306A5062560228 @default.
• W2018045306 hasAuthorship W2018045306A5071109183 @default.
• W2018045306 hasAuthorship W2018045306A5073140119 @default.
• W2018045306 hasAuthorship W2018045306A5082148663 @default.
• W2018045306 hasBestOaLocation W20180453061 @default.
• W2018045306 hasConcept C104317684 @default.
• W2018045306 hasConcept C121050878 @default.
• W2018045306 hasConcept C12554922 @default.
• W2018045306 hasConcept C167625842 @default.
• W2018045306 hasConcept C178790620 @default.
• W2018045306 hasConcept C185592680 @default.
• W2018045306 hasConcept C19924922 @default.
• W2018045306 hasConcept C199360897 @default.
• W2018045306 hasConcept C2777735026 @default.
• W2018045306 hasConcept C41008148 @default.
• W2018045306 hasConcept C517785266 @default.
• W2018045306 hasConcept C519063684 @default.
• W2018045306 hasConcept C537181965 @default.
• W2018045306 hasConcept C55493867 @default.
• W2018045306 hasConcept C86803240 @default.
• W2018045306 hasConcept C95444343 @default.
• W2018045306 hasConceptScore W2018045306C104317684 @default.
• W2018045306 hasConceptScore W2018045306C121050878 @default.
• W2018045306 hasConceptScore W2018045306C12554922 @default.
• W2018045306 hasConceptScore W2018045306C167625842 @default.
• W2018045306 hasConceptScore W2018045306C178790620 @default.
• W2018045306 hasConceptScore W2018045306C185592680 @default.
• W2018045306 hasConceptScore W2018045306C19924922 @default.
• W2018045306 hasConceptScore W2018045306C199360897 @default.
• W2018045306 hasConceptScore W2018045306C2777735026 @default.
• W2018045306 hasConceptScore W2018045306C41008148 @default.

• next