FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2020504648> ?p ?o ?g. }

• W2020504648 endingPage "21415" @default.
• W2020504648 startingPage "21409" @default.
• W2020504648 abstract "Cadherins are transmembrane glycoproteins involved in Ca2+-dependent cell-cell adhesion. Previously, we showed that the conserved membrane-proximal region of the E-cadherin cytoplasmic domain negatively regulates adhesion activity. In this report, we provide several lines of evidence that p120ctn is involved in this negative regulation. p120ctn binds to the membrane-proximal region of the nonfunctional carboxyl-terminally deleted E-cadherin protein. An additional internal deletion in this region prevented the association with p120ctn and activated the protein, as seen in an aggregation assay. Furthermore, the nonfunctional E-cadherin can be activated through coexpression of p120ctn proteins with amino-terminal deletions, which eliminate several potential serine/threonine phosphorylation sites but do not affect the ability to bind to cadherins. Finally, we show that staurosporine, a kinase inhibitor, induces an increased electrophoretic mobility of p120ctn bound to E-cadherin polypeptides, activates the nonfunctional E-cadherin protein, and converts the wild-type E-cadherin and an E-cadherin-α-catenin chimeric protein from a cytochalasin D-sensitive to a cytochalasin D-insensitive state. Together, these results indicate that p120ctn is a modulator of E-cadherin-mediated cell adhesion. Cadherins are transmembrane glycoproteins involved in Ca2+-dependent cell-cell adhesion. Previously, we showed that the conserved membrane-proximal region of the E-cadherin cytoplasmic domain negatively regulates adhesion activity. In this report, we provide several lines of evidence that p120ctn is involved in this negative regulation. p120ctn binds to the membrane-proximal region of the nonfunctional carboxyl-terminally deleted E-cadherin protein. An additional internal deletion in this region prevented the association with p120ctn and activated the protein, as seen in an aggregation assay. Furthermore, the nonfunctional E-cadherin can be activated through coexpression of p120ctn proteins with amino-terminal deletions, which eliminate several potential serine/threonine phosphorylation sites but do not affect the ability to bind to cadherins. Finally, we show that staurosporine, a kinase inhibitor, induces an increased electrophoretic mobility of p120ctn bound to E-cadherin polypeptides, activates the nonfunctional E-cadherin protein, and converts the wild-type E-cadherin and an E-cadherin-α-catenin chimeric protein from a cytochalasin D-sensitive to a cytochalasin D-insensitive state. Together, these results indicate that p120ctn is a modulator of E-cadherin-mediated cell adhesion. The cadherins are a family of transmembrane glycoproteins that play essential roles in the initiation and stabilization of cell-cell contacts (1Takeichi M. Science. 1991; 251: 1451-1455Crossref PubMed Scopus (2984) Google Scholar, 2Geiger B. Ayalon O. Annu. Rev. Cell Biol. 1992; 8: 307-332Crossref PubMed Scopus (521) Google Scholar, 3Kemler R. Trends Genet. 1993; 9: 317-321Abstract Full Text PDF PubMed Scopus (877) Google Scholar, 4Gumbiner B.M. Cell. 1996; 84: 345-357Abstract Full Text Full Text PDF PubMed Scopus (2928) Google Scholar). The extracellular domain of cadherins is responsible for specific homophilic binding (5Nose A. Tsuji K. Takeichi M. Cell. 1990; 61: 147-155Abstract Full Text PDF PubMed Scopus (414) Google Scholar), whereas the carboxyl-terminal region of the cytoplasmic domain interacts with intracellular proteins termed catenins (6Ozawa M. Baribault H. Kemler R. EMBO J. 1989; 8: 1711-1717Crossref PubMed Scopus (1148) Google Scholar, 7Ozawa M. Ringwald M. Kemler R. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 4246-4250Crossref PubMed Scopus (649) Google Scholar). Each cadherin molecule can bind to either β-catenin or γ-catenin (plakoglobin), which in turn binds to α-catenin (8Butz S. Kemler R. FEBS Lett. 1994; 355: 195-200Crossref PubMed Scopus (114) Google Scholar, 9Hinck L. Näthke I.S. Papkoff J. Nelson W.J. J. Cell Biol. 1994; 125: 1327-1340Crossref PubMed Scopus (556) Google Scholar, 10Hülsken J. Birchmeier W. Behrens J. J. Cell Biol. 1994; 127: 2061-2069Crossref PubMed Scopus (585) Google Scholar, 11Obama H. Ozawa M. J. Biol. Chem. 1997; 272: 11017-11020Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). α-Catenin is an actin-binding protein (12Rimm D.L. Koslov E.R. Kebriaei P. Cianci C.D. Morrow J.S. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8813-8817Crossref PubMed Scopus (633) Google Scholar) that interacts with other actin-binding proteins, i.e.α-actinin (13Nieset J.E. Redfield A.R. Jin F. Knudsen K.A. Johnson K.R. Wheelock M.J. J. Cell Sci. 1997; 110: 1013-1022Crossref PubMed Google Scholar), ZO-1 (14Itoh M. Nagafuchi A. Moroi S. Tsukita S. J. Cell Biol. 1997; 138: 181-192Crossref PubMed Scopus (570) Google Scholar), and vinculin (15Watabe-Uchida M. Uchida N. Imamura Y. Nagafuchi A. Fujimoto K. Uemura T. Vermeulen S. Van Roy F. Adamson E.D. Takeichi M. J. Cell Biol. 1998; 142: 847-857Crossref PubMed Scopus (272) Google Scholar, 16Weiss E.E. Kroemker M. Rüdiger A.-H. Jockusch B.M. Rüdiger M. J. Cell Biol. 1998; 141: 755-764Crossref PubMed Scopus (214) Google Scholar). Such interactions link cadherins to the actin cytoskeleton. Binding of the cadherin-catenin complexes to the actin cytoskeleton has been proposed to be essential for the binding activity. Deletion or truncation of the cytoplasmic domain of cadherin results in a loss of function, despite its continued expression on the cell surface (7Ozawa M. Ringwald M. Kemler R. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 4246-4250Crossref PubMed Scopus (649) Google Scholar, 17Nagafuchi A. Takeichi M. EMBO J. 1988; 7: 3679-3684Crossref PubMed Scopus (662) Google Scholar). Additionally, cells expressing normal E-cadherin but lacking α-catenin do not aggregate (18Shimoyama Y. Nagafuchi A. Fujita S. Gotoh M. Takeichi M. Tsukita S. Hirohashi S. Cancer Res. 1992; 52: 5770-5774PubMed Google Scholar), and cell-cell adhesion can be restored by transfection of these cells with the α-catenin cDNA (19Hirano S. Kimoto N. Shimoyama Y. Hirohashi S. Takeichi M. Cell. 1992; 70: 293-301Abstract Full Text PDF PubMed Scopus (479) Google Scholar, 20Watabe M. Nagafuchi A. Tsukita S. Takeichi M. J. Cell Biol. 1994; 127: 247-256Crossref PubMed Scopus (364) Google Scholar). Although these studies have defined protein-protein interactions that are important for cell adhesion, the mechanisms involved in regulation of cell adhesion remain poorly understood. p120ctn is a recently described component of the cadherin adhesion complex (21Reynolds A.B.J. Daniel J. McCrea P.D. Wheelock M.J. Wu J. Zhang Z. Mol. Cell. Biol. 1994; 14: 8333-8342Crossref PubMed Google Scholar, 22Shibamoto S. Hayakawa M. Takeuchi K. Hori T. Miyazawa K. Kitamura N. Johnson K.R. Wheelock M.J. Matsuyoshi N. Takeichi M. Ito F. J. Cell Biol. 1995; 128: 949-957Crossref PubMed Scopus (243) Google Scholar, 23Staddon J.M. Smales C. Schulze C. Esch F.S. Rubin L.L. J. Cell Biol. 1995; 130: 369-381Crossref PubMed Scopus (138) Google Scholar) that seems to be able to associate directly with cadherins (24Daniel J.M. Reynolds A.B. Mol. Cell. Biol. 1995; 15: 4819-4824Crossref PubMed Google Scholar), but its function in the complex remains unknown. p120ctn, like β-catenin, is a member of the armadillo family of proteins, having 10 copies of the 42-amino acid armadillo repeat (25Reynolds A.B. Herbert L. Cleveland J.L. Berg S.T. Gaut J.R. Oncogene. 1992; 7: 2439-2445PubMed Google Scholar), and a number of different but closely related isoforms have been identified (26Mo Y.-Y. Reynolds A.B. Cancer Res. 1996; 56: 2633-2640PubMed Google Scholar). p120ctn was first discovered as a protein the phosphorylation of which on tyrosine residues was correlated with transformation in cells transfected with pp60v-Src (27Reynolds A.B. Roesel D.J. Kanner S.B. Parsons J.T. Mol. Cell. Biol. 1989; 9: 629-638Crossref PubMed Scopus (288) Google Scholar). p120ctn is also tyrosine-phosphorylated following the stimulation of cells by growth factors, epidermal growth factor, colony-stimulating factor, and platelet-derived growth factors (28Downing J.R. Reynolds A.B. Oncogene. 1991; 6: 607-613PubMed Google Scholar, 29Kanner S.B. Reynolds A.B. Parsons J.T. Mol. Cell. Biol. 1991; 11: 713-720Crossref PubMed Scopus (104) Google Scholar). In addition to phosphorylation on tyrosine residues in transformed cells and in response to growth factors, constitutive phosphorylation of p120ctn on serine and to a lesser extent on threonine residues in both normal and src-transformed cells was noticed (29Kanner S.B. Reynolds A.B. Parsons J.T. Mol. Cell. Biol. 1991; 11: 713-720Crossref PubMed Scopus (104) Google Scholar). It was also shown that in Madin-Darby canine kidney cells, p120ctn is phosphorylated primarily on serine residues, with some phosphothreonine but no detectable phosphotyrosine (30Ratcliffe M.J. Rubin L.L. Staddon J.M. J. Biol. Chem. 1997; 272: 31894-31901Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Dephosphorylation of these residues, caused by either activation of protein kinase C or the addition of kinase inhibitors such as staurosporine, has been correlated with faster migration of p120ctn during SDS-PAGE 1The abbreviations used are: PAGE, polyacrylamide gel electrophoresis; CD, cytochalasin D; EC0L, L cell expressing mutant E-cadherin lacking the cytoplasmic tail; EΔC71L, L cell expressing mutant E-cadherin with the carboxyl-terminal deletion of 71 amino acids; EL, L cells expressing E-cadherin; GST, glutathioneS-transferase; HA, hemagglutinin; mAb, monoclonal antibody; PBS, phosphate-buffered saline and precedes the permeability increase across epithelial cell monolayers (30Ratcliffe M.J. Rubin L.L. Staddon J.M. J. Biol. Chem. 1997; 272: 31894-31901Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar), raising the possibility that the phosphorylation/dephosphorylation of p120ctn on serine/threonine residues modulates intercellular junctions. Recent experiments revealed that the membrane-proximal region of the cadherin cytoplasmic domain plays a role(s) in the regulation of its activity. In the case of C-cadherin, it supports lateral clustering and adhesive strengthening (31Yap A.S. Niessen C.M. Gumbiner B.M. J. Cell Biol. 1998; 141: 779-789Crossref PubMed Scopus (463) Google Scholar), whereas in the case of E-cadherin, it prevents dimerization of the extracellular domain of the protein and thereby negatively regulates adhesion activity (32Ozawa M. Kemler R. J. Cell Biol. 1998; 142: 1605-1613Crossref PubMed Scopus (150) Google Scholar). Thus, carboxyl-terminally truncated mutant E-cadherin proteins retaining the membrane-proximal region are inactive in cell adhesion, but deletion of the region results in activation of the nonfunctional E-cadherin polypeptides. Although its precise role in the regulation remains to be determined, the membrane-proximal region seems to interact with p120ctn (31Yap A.S. Niessen C.M. Gumbiner B.M. J. Cell Biol. 1998; 141: 779-789Crossref PubMed Scopus (463) Google Scholar, 32Ozawa M. Kemler R. J. Cell Biol. 1998; 142: 1605-1613Crossref PubMed Scopus (150) Google Scholar, 33Lampugnani M.G. Corada M. Andriopoulou P. Esser S. Risau W. Dejana E. J. Cell Sci. 1997; 110: 2065-2077Crossref PubMed Google Scholar, 34Chitaev N.A. Troyanovsky S.M. J. Cell Biol. 1998; 142: 837-846Crossref PubMed Scopus (131) Google Scholar). Therefore, we investigated the potential role of p120ctn in this negative regulation and obtained several lines of evidence that p120ctn is involved in modulation of E-cadherin-mediated cell adhesion. Mammalian expression vectors containing mouse E-cadherin cDNAs encoding the wild-type, mutant proteins EΔC71 or EC0 (Fig. 1 a) and an E-cadherin-α-catenin chimeric protein (EαC) were described previously (32Ozawa M. Kemler R. J. Cell Biol. 1998; 142: 1605-1613Crossref PubMed Scopus (150) Google Scholar, 35Ozawa M. J. Biol. Chem. 1998; 273: 29524-29529Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). The cDNA encoding another E-cadherin mutant protein, EΔC71Δ604–615 (Fig. 1 a), was constructed as described below and cloned into the same expression vector, pCAGGSneo (36Niwa H. Yamamura K. Miyazaki J. Gene. 1991; 108: 193-200Crossref PubMed Scopus (4597) Google Scholar) (a gift from Dr. K. Yamamura, Kumamoto University, Kumamoto, Japan). To construct EΔC71Δ604–615, two additionalEcoRI sites were generated in the EΔC71 cDNA at the positions encoding amino acid residues 604–605 and 614–615, by means of the polymerase chain reaction described previously (32Ozawa M. Kemler R. J. Cell Biol. 1998; 142: 1605-1613Crossref PubMed Scopus (150) Google Scholar). For this, the following two combinations of sense and antisense primers were used: X1 (TATACCGCTCGAGAGCCG) and EN (CGGAATTCATCATAGTAATACACATTGTCCC), and EC (CGGAATTCAGCCAGCTGCACAGGGGC) and ΔC71 (ATCTTAATTACCGATGAAGTTTCCAATTTC). Sense primer X1 contains aXhoI restriction sequence, whereas sense primer EC and antisense primer EN each contain a EcoRI restriction sequence near the 5′-end. The cDNA fragments were assembled into the pBluescript II KS(+) vector using theXhoI-EcoRV site. After confirming the sequence, the cDNA was cloned into the expression vector for E-cadherin, from which the XhoI-EcoRV fragment of the E-cadherin cDNA that encodes the carboxyl-terminal 373 amino acids of E-cadherin had been removed. cDNA for mouse p120ctn (the 1A isoform) was kindly provided by Drs. J. Stappert and R. Kemler (Max-Planck Institut für Immunbiologie, Freiburg, Germany). Carboxyl-terminal epitope-tagged p120 (p120HA) was generated by the addition of the sequence that encodes the nine amino acid hemagglutinin (HA) epitope for the anti-peptide mAb 12CA5. cDNAs encoding two amino-terminal deletion mutant p120 proteins, p120ΔN1HA and p120ΔN2HA (see Fig.5 a), were constructed by deleting in-frame segments between two restriction sites, NcoI and EcoRI orSmaI and SmaI, respectively. These cDNAs were cloned into the pCAGGSneo vector For the blot overlay assay, the entire E-cadherin cytoplasmic domain or parts of it were expressed as fusion proteins with glutathioneS-transferase (GST) (see Fig. 4 a). For this, cDNA fragments were generated by either digestion at appropriate restriction enzyme sites in the cDNA or polymerase chain reaction with the following oligonucleotides as primers: N5 (CGGGATCCGGAGGAGAACGGTG) and N3 (AACTGCAGTCAAGTCACTTCCGGTCGGG), and C5 (TGACCCGGGAGGTGGAGAAGAAGAC) and C3 (GCGTCGACTTAAGGGGGTGCCGTGGG). The cDNA fragments were cloned into pGEX4T vectors (Amersham Pharmacia Biotech), and the fusion proteins were purified as described previously (11Obama H. Ozawa M. J. Biol. Chem. 1997; 272: 11017-11020Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Mouse fibroblasticl-tk− cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. L cells (5 × 105) were transfected with the expression vectors (10 μg) by the calcium phosphate method as described previously (6Ozawa M. Baribault H. Kemler R. EMBO J. 1989; 8: 1711-1717Crossref PubMed Scopus (1148) Google Scholar). G418-resistant clones were isolated and examined for E-cadherin expression by immunofluorescence staining as described previously (6Ozawa M. Baribault H. Kemler R. EMBO J. 1989; 8: 1711-1717Crossref PubMed Scopus (1148) Google Scholar). Positive cells were subcloned and used for further studies. To obtain transfectants expressing both the mutant E-cadherin (EΔC71) and mutant p120ctn proteins, either pC-p120HA, pC-p120ΔN1HA, or pC-p120ΔN2HA (15 μg) was introduced into an L cell clone expressing the mutant E-cadherin (EΔC71L cells) by the calcium phosphate method. Because EΔC71L cells already contained the neomycin gene, another plasmid (pStk) containing the herpes simplex virus thymidine kinase gene (37Ozawa M. Kemler R. J. Cell Biol. 1992; 116: 989-996Crossref PubMed Scopus (325) Google Scholar) (1.5 μg) was cotransfected. After selection in HAT (hypoxanthine, aminopterine, and thymidine; Life Technologies, Inc.) medium, single colonies were isolated and analyzed for the expression of the p120ctnprotein by immunoblotting with anti-HA mAb. The cell aggregation assay was performed as described previously (7Ozawa M. Ringwald M. Kemler R. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 4246-4250Crossref PubMed Scopus (649) Google Scholar). In brief, cells were incubated for 10 min at 37 °C in Hepes-buffered saline containing 0.01% trypsin (type XI, Sigma) and 2 mm CaCl2. After the addition of soybean trypsin inhibitor (Sigma), the cells were washed and resuspended. After incubation for 30 min at 37 °C with constant rotation at 70 rpm, the cells were fixed by adding an equal volume of 6% formaldehyde in PBS. A mouse mAb against p120ctn (pp120) was purchased from Transduction Laboratories (Lexington, KY). DECMA-1, a rat mAb to E-cadherin (38Vestweber D. Kemler R. EMBO J. 1985; 4: 3393-3398Crossref PubMed Scopus (197) Google Scholar), was used for immunoblotting and immunofluorescence staining, and rabbit anti-E-cadherin antibodies (6Ozawa M. Baribault H. Kemler R. EMBO J. 1989; 8: 1711-1717Crossref PubMed Scopus (1148) Google Scholar) were used for immunoprecipitation. A mAb against GST was purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). A mAb (12CA5) directed against HA and a mAb against phosphotyrosine (4G10) were kindly provided by Dr. A. Yoshimura (Kurume University, Fukuoka, Japan). Immunoblot analysis was carried out as described previously (32Ozawa M. Kemler R. J. Cell Biol. 1998; 142: 1605-1613Crossref PubMed Scopus (150) Google Scholar). Immunoprecipitation was carried out as described previously (32Ozawa M. Kemler R. J. Cell Biol. 1998; 142: 1605-1613Crossref PubMed Scopus (150) Google Scholar) with the following modifications. The cells (5 × 106) were lysed with either R lysis buffer (10 mm Tris-HCl buffer, pH 7.4, containing 0.5% Nonidet P-40, 150 mm NaCl, 1 mm EDTA, 0.1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml leupeptin, and 25 μg/ml aprotinin), or PI lysis buffer to preserve phosphorylated amino acid residues in p120ctn (25 mm Tris-HCl buffer, pH 7.4, containing 0.5% Nonidet P-40, 2 mm EDTA, 10 mm sodium pyrophosphate, 10 mm NaF, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml leupeptin, and 25 μg/ml aprotinin). The E-cadherin-catenin complex was collected with rabbit anti-E-cadherin antibodies, which had been preabsorbed to protein A-Sepharose CL4B (Amersham Pharmacia Biotech). The immune complex was washed with the same buffer four times and then boiled for 5 min in the SDS-PAGE sample buffer. For treatment with alkaline phosphatase, the immunoprecipitate was washed three times with AP buffer (50 mm Tris-HCl, pH 8.0, 50 mm NaCl, 1 mm MgCl2, and 1 mmphenylmethylsulfonyl fluoride), and then incubated with 20 units of calf intestine alkaline phosphatase (Takara Shuzo Co., Ltd., Ohtsu, Japan) in 200 μl of AP buffer. To check the specificity of the phosphatase, a phosphatase inhibitor (100 mmβ-glycerophosphate, 25 mm NaF, 4 mm EDTA, and 1 mm Na3VO4) was used (39Sakakibara A. Furuse M. Saitou M. Ando-Akatsuka Y. Tsukita S. J. Cell Biol. 1997; 137: 1393-1401Crossref PubMed Scopus (511) Google Scholar). After 1 h incubation at 30 °C with occasional mixing, the immunocomplex was washed with PI buffer and boiled with SDS-PAGE sample buffer. The blot overlay assay was carried out as described previously (11Obama H. Ozawa M. J. Biol. Chem. 1997; 272: 11017-11020Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) except that anti-p120 antibodies were used to detect the GST-p120 fusion proteins bound to the GST-E-cadherin cytoplasmic domain fusion proteins that had been separated by SDS-PAGE and transferred to nitrocellulose membranes and that the proteins were visualized with an ECL detection kit. Cells were fixed with 3% formaldehyde in PBS for 20 min at room temperature. After three washes with PBS containing 50 mm NH4Cl, the cells were soaked in a blocking solution (PBS containing 5% fetal calf serum) for 15 min and then permeabilized with 0.1% Triton X-100 in PBS for 5 min. The cells were incubated with antibodies as described previously (32Ozawa M. Kemler R. J. Cell Biol. 1998; 142: 1605-1613Crossref PubMed Scopus (150) Google Scholar). Cells were incubated overnight in phosphate-free Dulbecco's modified Eagle's medium containing 1% fetal calf serum (dialyzed against 0.9% NaCl and 10 mm Hepes buffer, pH 7.5) and 250 μCi/ml [32P]orthophosphate (NEN Life Science Products). The cells were then treated with or without 100 nmstaurosporine for 60 min, lysed, and subjected to immunoprecipitation as described above. Following transfer to polyvinylidene difluoride membranes (Immobilon, Millipore Corp., Bedford MA) and immunoblotting to assess the recoveries of proteins, the area of the filter containing p120ctn was excised. The proteins were hydrolyzed at 110 °C for 1 h in 5.7 m HCl to release phosphoamino acids. Following lyophilization, phosphoamino acids were separated and detected as described (40Boyle W.J. van der Geer P. Hunter T. Methods Enzymol. 1991; 201: 110-149Crossref PubMed Scopus (1276) Google Scholar). To examine the potential role of p120ctn in the modulation of E-cadherin-mediated cell adhesion, we expressed the wild-type E-cadherin as well as mutant E-cadherin polypeptides EΔC71 and EC0 on L cells. We chose L cells in the present study because L cells seem to exhibit less proteolytic activity toward p120ctn compared with K562 cells, in which degradation of p120ctn during immunoprecipitation experiments was observed (32Ozawa M. Kemler R. J. Cell Biol. 1998; 142: 1605-1613Crossref PubMed Scopus (150) Google Scholar). The wild-type E-cadherin has a cytoplasmic domain of 151 amino acids at its carboxyl terminus. EΔC71 is a mutant E-cadherin polypeptide with a carboxyl-terminal deletion of 71 amino acid residues, whereas EC0 is a mutant polypeptide completely lacking the cytoplasmic domain (Fig.1 a). When expressed on L cells, these proteins migrated as polypeptides of the expected molecular weights upon immunoblot analysis (Fig. 1 b). Consistent with our previous experiments on these proteins expressed on K562 cells (32Ozawa M. Kemler R. J. Cell Biol. 1998; 142: 1605-1613Crossref PubMed Scopus (150) Google Scholar), EC0 expressed on L cells exhibits activity in a cell aggregation assay but EΔC71 was inactive (Fig.2). Therefore, as in the case of K562 cells, the presence of the membrane-proximal region of the E-cadherin cytoplasmic domain maintains the partially truncated E-cadherin polypeptide (EΔC71) expressed on L cells in an inactive state. Immunoblot analysis of the E-cadherin immunoprecipitate with anti-p120 revealed that p120ctn is associated with E-cadherin expressed on L cells (Fig. 1 c). In the case of the EΔC71 polypeptide, a reduced amount of p120ctn (∼10% of the wild-type E-cadherin polypeptide) was coprecipitated, but no p120ctn was detected in the EC0 precipitate. The largest isoform of p120ctn isolated from L cells migrated as a protein of 110 kDa, which was slightly smaller than the reported size of p120ctn in other cells (25Reynolds A.B. Herbert L. Cleveland J.L. Berg S.T. Gaut J.R. Oncogene. 1992; 7: 2439-2445PubMed Google Scholar). Different posttranslational modification may be responsible for the difference. To demonstrate the direct binding of p120ctn to the cytoplasmic domain of E-cadherin and to localize p120ctn-binding site(s) in the latter, we expressed different regions of the domain as fusion proteins with GST (Fig. 3 a). Their interaction with p120ctn, which was also expressed as a GST fusion protein, was analyzed using the blot overlay assay. As shown in Fig.3 b, p120ctn bound to the E-cadherin cytoplasmic domain fusion proteins containing residues 578–728 (the entire cytoplasmic domain) and residues 578–657 (the membrane-proximal region of the domain), but not to a fusion protein including residues 658–728 (the membrane-distal region of the domain). Furthermore, p120ctn bound to a cytoplasmic domain fusion protein containing residues 596–628, but not to a fusion protein containing residues 605–671, eliminating the possibility that the region that was split to produce the membrane-proximal and membrane-distal regions contains an additional binding site for p120ctn. The deletion of residues 604–615 from the membrane-proximal region abolished its ability to bind to p120ctn. These results suggest that the p120ctn-binding site in the E-cadherin cytoplasmic domain is localized in the membrane-proximal region,i.e. not in the membrane-distal region, and that residues 604–615 play a critical role in the binding. p120ctn has been shown to be colocalized with E-cadherin and catenins at cell-cell contacts (21Reynolds A.B.J. Daniel J. McCrea P.D. Wheelock M.J. Wu J. Zhang Z. Mol. Cell. Biol. 1994; 14: 8333-8342Crossref PubMed Google Scholar, 22Shibamoto S. Hayakawa M. Takeuchi K. Hori T. Miyazawa K. Kitamura N. Johnson K.R. Wheelock M.J. Matsuyoshi N. Takeichi M. Ito F. J. Cell Biol. 1995; 128: 949-957Crossref PubMed Scopus (243) Google Scholar, 23Staddon J.M. Smales C. Schulze C. Esch F.S. Rubin L.L. J. Cell Biol. 1995; 130: 369-381Crossref PubMed Scopus (138) Google Scholar). Immunofluorescence staining with anti-p120 mAb revealed that p120ctn is localized at cell-cell contacts in L cells expressing wild-type E-cadherin (EL) or a mutant E-cadherin polypeptide with the membrane-proximal region (EΔC71L) (Fig.4). In contrast, p120ctn was undetectable at cell-cell junctions in L cells expressing the tail-less E-cadherin polypeptide (EC0L); instead, it was found throughout the cytoplasm (Fig. 4). Thus, the tail-less E-cadherin cannot recruit p120ctn to the contacts. These results show that the membrane-proximal region of the E-cadherin cytoplasmic domain is enough to localize p120ctn at cell-cell contacts. If the binding of p120ctn to the membrane-proximal region of the E-cadherin cytoplasmic domain is involved in the failure of the mutant E-cadherin polypeptide (EΔC71) to be functional in the cell aggregation assay, the deletion of the p120ctn-binding site from the EΔC71 polypeptide should activate the protein. Therefore we constructed a cDNA that encodes a mutant E-cadherin, designated EΔC71Δ604–615 (Fig. 1 a). The EΔC71Δ604–615 polypeptide has an additional deletion of residues 604–615, the residues shown to be required for p120ctn-binding in the above experiments, within the EΔC71 protein. This construct was introduced into L cells, and G418-resistant clones were isolated. Although the EΔC71Δ604–615 protein has the molecular weight expected from its construct and migrated faster than the EΔC71 protein on SDS-PAGE (Fig. 3 c), immunofluorescence staining with DECMA-1, an anti-E-cadherin mAb, revealed that each clone positive for DECMA-1 staining contained a mixture of two types of cells, one (10∼%) stained normally, like EL cells, and the other (∼90%) stained weakly. This unstable nature of expression of the EΔC71Δ604–615 protein persisted even after recloning. Therefore, we analyzed aggregation activity using L cell clones consisting of the two types of cells. Despite the presence of the weakly stained cells, L cells expressing the EΔC71Δ604–615 protein showed a certain degree of cell aggregation (Fig. 2). Immunofluorescence staining revealed that cells in the aggregates were stained strongly with DECMA-1, whereas the majority of the cells remaining as single ones were stained only weakly (data not shown). Therefore, the EΔC71Δ604–615 protein expressed on L cells seemed to be active in the aggregation assay. The lack of association of p120ctn with the EΔC71Δ604–615 protein was confirmed by immunoblot analysis of the E-cadherin immunoprecipitate with anti-p120ctn antibodies (Fig.3 c). Whereas the above results demonstrating p120ctn binds to a site (including residues 604–615) of the membrane-proximal region of the E-cadherin cytoplasmic domain and the deletion of this site from the nonfunctional E-cadherin (EΔC71) activates the protein strongly suggested that p120ctn was a crucial modulator of the protein, the possibility existed that another protein that can bind to the protein at this site could be modulating the aggregation activity. To confirm the role of p120ctn in the modulation of the adhesion activity of the EΔC71 protein, we constructed two amino-terminally truncated p120ctn proteins (p120ΔN1 and p120ΔN2) (Fig.5 a) and expressed them in EΔC71L cells. p120ctn can be divided into three parts; an amino-terminal part, a central portion composed of the so-called armadillo repeats, and a small carboxyl-terminal tail. The armadillo repeats are responsible for its binding to cadherins (24Daniel J.M. Reynolds A.B. Mol. Cell. Biol. 1995; 15: 4819-4824Crossref PubMed Google Scholar, 41Reynolds A.B. Daniel J.M. Mo Y.-Y. Wu J. Zhang Z. Exp. Cell. Res. 1996; 225: 328-337Crossref PubMed Scopus (128) Google Scholar). EΔC71L cells were transfected with these constructs together with the pStk vector containing the herpes simplex virus thymidine kinase gene or the pStk vector alone. After selection in HAT medium, single colonies were isolated and analyzed for expression of the p120ctn protein by immunoblotting with anti-HA and anti-p120 antibodies (Fig. 5 b). Immunoblot analysis of the E-cadherin immunoprecipitates with anti-p120 antibodies revealed that these truncated p120ctn polypeptides are associated with the EΔC71 polypeptides to similar degrees to the endogenous p120ctn polypeptides (Fig. 5 c). Aggregation assay of EΔC71 cells expressing these truncated p120ctnpolypeptides (clone 3 of EΔC71/p120ΔN1L cells and clones 8 and 3 of EΔC71/p120ΔN2L cells) revealed that these cells form aggregates, whereas EΔC71L cells transfected with the pStk vector alone (EΔC71/tkL cells) and EΔC71L cells expressing the full-length p120ctn polypeptides (EΔC71/p120L cells" @default.
• W2020504648 created "2016-06-24" @default.
• W2020504648 creator A5001753332 @default.
• W2020504648 creator A5068682184 @default.
• W2020504648 date "1999-07-01" @default.
• W2020504648 modified "2023-10-16" @default.
• W2020504648 title "p120ctn Binds to the Membrane-proximal Region of the E-cadherin Cytoplasmic Domain and Is Involved in Modulation of Adhesion Activity" @default.
• W2020504648 cites W1528493806 @default.
• W2020504648 cites W153332747 @default.
• W2020504648 cites W1534652806 @default.
• W2020504648 cites W1556831481 @default.
• W2020504648 cites W1605235578 @default.
• W2020504648 cites W1837392873 @default.
• W2020504648 cites W1920794749 @default.
• W2020504648 cites W1931818816 @default.
• W2020504648 cites W1967385749 @default.
• W2020504648 cites W1978609854 @default.
• W2020504648 cites W1981752846 @default.
• W2020504648 cites W1985656017 @default.
• W2020504648 cites W1990215042 @default.
• W2020504648 cites W1996902174 @default.
• W2020504648 cites W2002041258 @default.
• W2020504648 cites W2011812152 @default.
• W2020504648 cites W2018884883 @default.
• W2020504648 cites W2020514343 @default.
• W2020504648 cites W2025189885 @default.
• W2020504648 cites W2025949809 @default.
• W2020504648 cites W2026376382 @default.
• W2020504648 cites W2048162805 @default.
• W2020504648 cites W2055971769 @default.
• W2020504648 cites W2068779280 @default.
• W2020504648 cites W2068822275 @default.
• W2020504648 cites W2069990200 @default.
• W2020504648 cites W2081427703 @default.
• W2020504648 cites W2102090879 @default.
• W2020504648 cites W2103842570 @default.
• W2020504648 cites W2106104738 @default.
• W2020504648 cites W2129775855 @default.
• W2020504648 cites W2129840495 @default.
• W2020504648 cites W2143646667 @default.
• W2020504648 cites W2152731523 @default.
• W2020504648 cites W2172160601 @default.
• W2020504648 cites W2221942573 @default.
• W2020504648 cites W4242838352 @default.
• W2020504648 doi "https://doi.org/10.1074/jbc.274.30.21409" @default.
• W2020504648 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10409703" @default.
• W2020504648 hasPublicationYear "1999" @default.
• W2020504648 type Work @default.
• W2020504648 sameAs 2020504648 @default.
• W2020504648 citedByCount "159" @default.
• W2020504648 countsByYear W20205046482012 @default.
• W2020504648 countsByYear W20205046482013 @default.
• W2020504648 countsByYear W20205046482014 @default.
• W2020504648 countsByYear W20205046482015 @default.
• W2020504648 countsByYear W20205046482016 @default.
• W2020504648 countsByYear W20205046482017 @default.
• W2020504648 countsByYear W20205046482018 @default.
• W2020504648 countsByYear W20205046482022 @default.
• W2020504648 countsByYear W20205046482023 @default.
• W2020504648 crossrefType "journal-article" @default.
• W2020504648 hasAuthorship W2020504648A5001753332 @default.
• W2020504648 hasAuthorship W2020504648A5068682184 @default.
• W2020504648 hasBestOaLocation W20205046481 @default.
• W2020504648 hasConcept C121332964 @default.
• W2020504648 hasConcept C123079801 @default.
• W2020504648 hasConcept C12554922 @default.
• W2020504648 hasConcept C134306372 @default.
• W2020504648 hasConcept C1491633281 @default.
• W2020504648 hasConcept C149402561 @default.
• W2020504648 hasConcept C178790620 @default.
• W2020504648 hasConcept C185592680 @default.
• W2020504648 hasConcept C190062978 @default.
• W2020504648 hasConcept C24890656 @default.
• W2020504648 hasConcept C33923547 @default.
• W2020504648 hasConcept C36503486 @default.
• W2020504648 hasConcept C41625074 @default.
• W2020504648 hasConcept C55493867 @default.
• W2020504648 hasConcept C84416704 @default.
• W2020504648 hasConcept C86803240 @default.
• W2020504648 hasConcept C95444343 @default.
• W2020504648 hasConceptScore W2020504648C121332964 @default.
• W2020504648 hasConceptScore W2020504648C123079801 @default.
• W2020504648 hasConceptScore W2020504648C12554922 @default.
• W2020504648 hasConceptScore W2020504648C134306372 @default.
• W2020504648 hasConceptScore W2020504648C1491633281 @default.
• W2020504648 hasConceptScore W2020504648C149402561 @default.
• W2020504648 hasConceptScore W2020504648C178790620 @default.
• W2020504648 hasConceptScore W2020504648C185592680 @default.
• W2020504648 hasConceptScore W2020504648C190062978 @default.
• W2020504648 hasConceptScore W2020504648C24890656 @default.
• W2020504648 hasConceptScore W2020504648C33923547 @default.
• W2020504648 hasConceptScore W2020504648C36503486 @default.
• W2020504648 hasConceptScore W2020504648C41625074 @default.
• W2020504648 hasConceptScore W2020504648C55493867 @default.
• W2020504648 hasConceptScore W2020504648C84416704 @default.
• W2020504648 hasConceptScore W2020504648C86803240 @default.
• W2020504648 hasConceptScore W2020504648C95444343 @default.
• W2020504648 hasIssue "30" @default.

• next