FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2069694792> ?p ?o ?g. }

• W2069694792 endingPage "16166" @default.
• W2069694792 startingPage "16155" @default.
• W2069694792 abstract "One goal of diabetic regenerative medicine is to instructively convert mature pancreatic exocrine cells into insulin-producing cells. We recently reported that ligand-bound thyroid hormone receptor α (TRα) plays a critical role in expansion of the β-cell mass during postnatal development. Here, we used an adenovirus vector that expresses TRα driven by the amylase 2 promoter (AdAmy2TRα) to induce the reprogramming of pancreatic acinar cells into insulin-producing cells. Treatment with l-3,5,3-triiodothyronine increases the association of TRα with the p85α subunit of phosphatidylinositol 3-kinase (PI3K), leading to the phosphorylation and activation of Akt and the expression of Pdx1, Ngn3, and MafA in purified acinar cells. Analyses performed with the lectin-associated cell lineage tracing system and the Cre/loxP-based direct cell lineage tracing system indicate that newly synthesized insulin-producing cells originate from elastase-expressing pancreatic acinar cells. Insulin-containing secretory granules were identified in these cells by electron microscopy. The inhibition of p85α expression by siRNA or the inhibition of PI3K by LY294002 prevents the expression of Pdx1, Ngn3, and MafA and the reprogramming to insulin-producing cells. In immunodeficient mice with streptozotocin-induced hyperglycemia, treatment with AdAmy2TRα leads to the reprogramming of pancreatic acinar cells to insulin-producing cells in vivo. Our findings suggest that ligand-bound TRα plays a critical role in β-cell regeneration during postnatal development via activation of PI3K signaling.Background: One goal of diabetic regenerative medicine is to convert mature pancreatic acinar cells into insulin-producing cells.Results: Ligand-bound thyroid hormone receptor α (TRα), which interacts with p85α, induces phosphatidylinositol 3-kinase (PI3K) signaling and insulin expression.Conclusion: PI3K signaling must be activated for TRα-induced reprogramming of pancreatic acinar cells.Significance: TRα is critical for postnatal expansion of the β-cell mass. One goal of diabetic regenerative medicine is to instructively convert mature pancreatic exocrine cells into insulin-producing cells. We recently reported that ligand-bound thyroid hormone receptor α (TRα) plays a critical role in expansion of the β-cell mass during postnatal development. Here, we used an adenovirus vector that expresses TRα driven by the amylase 2 promoter (AdAmy2TRα) to induce the reprogramming of pancreatic acinar cells into insulin-producing cells. Treatment with l-3,5,3-triiodothyronine increases the association of TRα with the p85α subunit of phosphatidylinositol 3-kinase (PI3K), leading to the phosphorylation and activation of Akt and the expression of Pdx1, Ngn3, and MafA in purified acinar cells. Analyses performed with the lectin-associated cell lineage tracing system and the Cre/loxP-based direct cell lineage tracing system indicate that newly synthesized insulin-producing cells originate from elastase-expressing pancreatic acinar cells. Insulin-containing secretory granules were identified in these cells by electron microscopy. The inhibition of p85α expression by siRNA or the inhibition of PI3K by LY294002 prevents the expression of Pdx1, Ngn3, and MafA and the reprogramming to insulin-producing cells. In immunodeficient mice with streptozotocin-induced hyperglycemia, treatment with AdAmy2TRα leads to the reprogramming of pancreatic acinar cells to insulin-producing cells in vivo. Our findings suggest that ligand-bound TRα plays a critical role in β-cell regeneration during postnatal development via activation of PI3K signaling. Background: One goal of diabetic regenerative medicine is to convert mature pancreatic acinar cells into insulin-producing cells. Results: Ligand-bound thyroid hormone receptor α (TRα), which interacts with p85α, induces phosphatidylinositol 3-kinase (PI3K) signaling and insulin expression. Conclusion: PI3K signaling must be activated for TRα-induced reprogramming of pancreatic acinar cells. Significance: TRα is critical for postnatal expansion of the β-cell mass. The formation of the pancreas and its subsequent differentiation into various types of exocrine and endocrine cells during development are controlled by the activation or repression of a large number of genes (1Edlund H. Transcribing pancreas.Diabetes. 1998; 47: 1817-1823Crossref PubMed Scopus (275) Google Scholar). The expression of these genes is regulated by a well organized cascade of transcription factors. Pancreatic and duodenal homeobox 1 (Pdx1), basic helix-loop-helix factor neurogenin 3 (Ngn3), and MafA are transcription factors that are essential for the transdifferentiation of endocrine cells (1Edlund H. Transcribing pancreas.Diabetes. 1998; 47: 1817-1823Crossref PubMed Scopus (275) Google Scholar, 2Schwitzgebel V.M. Scheel D.W. Conners J.R. Kalamaras J. Lee J.E. Anderson D.J. Sussel L. Johnson J.D. German M.S. Expression of neurogenin3 reveals an islet cell precursor population in the pancreas.Development. 2000; 127: 3533-3542Crossref PubMed Google Scholar). Pdx1 controls the growth and development of the pancreatic bud; Ngn3 is required for formation of endocrine progenitors; and MafA and Pdx1 are required for the maturation of β-cells (3Murtaugh L.C. Melton D.A. Genes, signals, and lineages in pancreas development.Annu. Rev. Cell Dev. Biol. 2003; 19: 71-89Crossref PubMed Scopus (181) Google Scholar). Cell differentiation type can be reprogrammed by overexpression of selected transcription factors, usually a subset of the transcription factors required for formation of the relevant cell type during normal development. Zhou et al. reported a reprogramming of pancreatic exocrine cells to β-like cells in vivo by introduction of genes for the three transcription factors, Pdx1, Ngn3, and MafA (4Zhou Q. Brown J. Kanarek A. Rajagopal J. Melton D.A. In vivo reprogramming of adult pancreatic exocrine cells to beta-cells.Nature. 2008; 455: 627-632Crossref PubMed Scopus (1634) Google Scholar). Other studies have revealed that mature cells have high plasticity in their differentiation capacity. Pancreatic acinar cells can transdifferentiate into endocrine cells. Indeed, under appropriate culture conditions, dedifferentiated acinar cells can be induced to become insulin-expressing cells via Ngn3 expression (5Minami K. Okuno M. Miyawaki K. Okumachi A. Ishizaki K. Oyama K. Kawaguchi M. Ishizuka N. Iwanaga T. Seino S. Lineage tracing and characterization of insulin-secreting cells generated from adult pancreatic acinar cells.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 15116-15121Crossref PubMed Scopus (220) Google Scholar). Cell lineage studies have also indicated that pancreatic acinar cells possess sufficient plasticity to transdifferentiate into endocrine cells. Thyroid hormone influences various physiological processes, including cell cycle progression and cell differentiation/development in the vertebrate nervous system. The actions of triiodothyronine (T3) 2The abbreviations used are: T3, triiodothyronine; AdAmy2Cre, Cre-recombinase-expressing adenovirus under control of the amylase2 promoter; AdAmy2TRα, amylase2 promoter-driven adenovirus vector; m.o.i., multiplicity of infection; STZ, streptozotocin; TR, thyroid hormone nuclear receptor; WGA, wheat germ agglutinin. are mediated through specific thyroid hormone nuclear receptors (TR)s that function as ligand-dependent transcription factors that increase or decrease the expression of target genes (6Lazar M.A. Thyroid hormone receptors: multiple forms, multiple possibilities.Endocr. Rev. 1993; 14: 184-193Crossref PubMed Scopus (0) Google Scholar, 7Chin W.W. Molecular mechanisms of thyroid hormone action.Thyroid. 1994; 4: 389-393Crossref PubMed Scopus (18) Google Scholar). Two TR genes located on different chromosomes encode four TR isoforms, designated as α1, β1, β2, and β3, which all bind to T3. These TRs regulate target gene transcription by binding to specific DNA sequences (thyroid hormone response elements on promoters. TR-mediated transcription is regulated at multiple levels. In addition to these genomic or thyroid hormone response element-mediated effects of T3, nonnuclear or thyroid hormone response element-independent actions of ligand-bound TR have recently been described (8Sakaguchi Y. Cui G. Sen L. Acute effects of thyroid hormone on inward rectifier potassium channel currents in guinea pig ventricular myocytes.Endocrinology. 1996; 137: 4744-4751Crossref PubMed Scopus (70) Google Scholar, 9Sun Z.Q. Ojamaa K. Coetzee W.A. Artman M. Klein I. Effects of thyroid hormone on action potential and repolarizing currents in rat ventricular myocytes.Am. J. Physiol. Endocrinol. Metab. 2000; 278: E302-E307Crossref PubMed Google Scholar, 10Sen L. Sakaguchi Y. Cui G. G protein modulates thyroid hormone-induced Na+ channel activation in ventricular myocytes.Am. J. Physiol. Heart Circ. Physiol. 2002; 283: H2119-H2129Crossref PubMed Scopus (19) Google Scholar, 11Hiroi Y. Kim H.H. Ying H. Furuya F. Huang Z. Simoncini T. Noma K. Ueki K. Nguyen N.H. Scanlan T.S. Moskowitz M.A. Cheng S.Y. Liao J.K. Rapid nongenomic actions of thyroid hormone.Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 14104-14109Crossref PubMed Scopus (295) Google Scholar). These results indicate that T3 rapidly modulates membrane potential, cellular depolarization, and contractile activity by regulating ion flux across plasma membrane ion channels. Regarding the mechanism of transdifferentiation of pancreatic acinar cells, PI3K, Notch, and/or leukocyte inhibitory factor/signal transducers and activators of transcription (LIF/STAT) signals are thought to be involved in the process, based mainly on studies with signaling inhibitor compounds (5Minami K. Okuno M. Miyawaki K. Okumachi A. Ishizaki K. Oyama K. Kawaguchi M. Ishizuka N. Iwanaga T. Seino S. Lineage tracing and characterization of insulin-secreting cells generated from adult pancreatic acinar cells.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 15116-15121Crossref PubMed Scopus (220) Google Scholar, 12Means A.L. Meszoely I.M. Suzuki K. Miyamoto Y. Rustgi A.K. Coffey Jr., R.J. Wright C.V. Stoffers D.A. Leach S.D. Pancreatic epithelial plasticity mediated by acinar cell transdifferentiation and generation of nestin-positive intermediates.Development. 2005; 132: 3767-3776Crossref PubMed Scopus (261) Google Scholar, 13Minami K. Okano H. Okumachi A. Seino S. Role of cadherin-mediated cell-cell adhesion in pancreatic exocrine-to-endocrine transdifferentiation.J. Biol. Chem. 2008; 283: 13753-13761Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). However, the precise roles of these signals in the transdifferentiation are not clear. Members of the steroid hormone receptor superfamily, such as estrogen, vitamin D, and TRs, cross-couple to the PI3K/Akt pathway, leading to the downstream activation of the PI3K signaling (14Hafezi-Moghadam A. Simoncini T. Yang Z. Limbourg F.P. Plumier J.C. Rebsamen M.C. Hsieh C.M. Chui D.S. Thomas K.L. Prorock A.J. Laubach V.E. Moskowitz M.A. French B.A. Ley K. Liao J.K. Acute cardiovascular protective effects of corticosteroids are mediated by nontranscriptional activation of endothelial nitric-oxide synthase.Nat. Med. 2002; 8: 473-479Crossref PubMed Scopus (474) Google Scholar). Indeed, thyroid hormone modulates the interaction of TR with the p85α subunit of PI3K, leading to the activation of Akt and endothelial NOS in vascular endothelial cells (11Hiroi Y. Kim H.H. Ying H. Furuya F. Huang Z. Simoncini T. Noma K. Ueki K. Nguyen N.H. Scanlan T.S. Moskowitz M.A. Cheng S.Y. Liao J.K. Rapid nongenomic actions of thyroid hormone.Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 14104-14109Crossref PubMed Scopus (295) Google Scholar). We have reported that intrapancreatic injection of adenovirus vector that expresses TRα leads to the restoration of islet function and an increase in the β-cell mass in immunodeficient mice with streptozotocin (STZ)-induced diabetes (15Furuya F. Shimura H. Yamashita S. Endo T. Kobayashi T. Liganded thyroid hormone receptor-α enhances proliferation of pancreatic beta-cells.J. Biol. Chem. 2010; 285: 24477-24486Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). These results suggest that ligand-bound TRα plays a critical role in β-cell replication and expansion of the β-cell mass during postnatal development. In the present study, we investigated the physiological importance of the activation of PI3K by TRα and the influence of TRα on the reprogramming of pancreatic exocrine cells to insulin-producing cells. Immunodeficient, 4-week-old nude mice (BALB/cAJc1-nu/nu) that were treated with 200 mg/kg STZ (Sigma) were sacrificed, and their pancreases were removed and digested with 1 mg/ml collagenase (Sigma). By Ficoll gradient centrifugation, the exocrine fraction was prepared as a pellet (5Minami K. Okuno M. Miyawaki K. Okumachi A. Ishizaki K. Oyama K. Kawaguchi M. Ishizuka N. Iwanaga T. Seino S. Lineage tracing and characterization of insulin-secreting cells generated from adult pancreatic acinar cells.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 15116-15121Crossref PubMed Scopus (220) Google Scholar). Subsequently, the cells were cultured for 6 h on 35-mm culture dishes (Thermo Fisher Scientific). Floating cells were collected and replated on 2-methacryloxyethyl phosphorylcholine-coated plates (Cosmo Bio). The purified cells were cultured in RPMI 1640 Gluta MAX-I medium supplemented with 10% resin-stripped FBS (16Samuels H.H. Stanley F. Casanova J. Depletion of l-3,5,3′-triiodothyronine and l-thyroxine in euthyroid calf serum for use in cell culture studies of the action of thyroid hormone.Endocrinology. 1979; 105: 80-85Crossref PubMed Scopus (555) Google Scholar) at 37 °C under 5% CO2 atmosphere. The murine amylase2 promoter was PCR-amplified from mouse liver genomic DNA. The PCR primers were: Amy2-KpnI-5′ (AAGGTACCGCAGGATGGCCTCAGAAGTAAGAT) and Amy2-3′-XhoI (AACTCGAGAGTTGTCAGTGTTCTCTGTAGCAC) (17Dematteo R.P. McClane S.J. Fisher K. Yeh H. Chu G. Burke C. Raper S.E. Engineering tissue-specific expression of a recombinant adenovirus: selective transgene transcription in the pancreas using the amylase promoter.J. Surg. Res. 1997; 72: 155-161Abstract Full Text PDF PubMed Scopus (28) Google Scholar). The enzyme-digested promoter fragment was ligated into the KpnI and XhoI sites of pGL3 basic vector (Promega). Pancreatic exocrine cell-specific activation of these promoters has been established (17Dematteo R.P. McClane S.J. Fisher K. Yeh H. Chu G. Burke C. Raper S.E. Engineering tissue-specific expression of a recombinant adenovirus: selective transgene transcription in the pancreas using the amylase promoter.J. Surg. Res. 1997; 72: 155-161Abstract Full Text PDF PubMed Scopus (28) Google Scholar, 18Gumucio D.L. Wiebauer K. Dranginis A. Samuelson L.C. Treisman L.O. Caldwell R.M. Antonucci T.K. Meisler M.H. Evolution of the amylase multigene family: YBR/Ki mice express a pancreatic amylase gene which is silent in other strains.J. Biol. Chem. 1985; 260: 13483-13489Abstract Full Text PDF PubMed Google Scholar) and confirmed by reporter assay in AR42J cells, a rat pancreatic exocrine cell line (data not shown). The FLAG-TRα1 plasmid (15Furuya F. Shimura H. Yamashita S. Endo T. Kobayashi T. Liganded thyroid hormone receptor-α enhances proliferation of pancreatic beta-cells.J. Biol. Chem. 2010; 285: 24477-24486Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar) was used as the template for cloning human TRα1 into pENTR-1A Dual Selection (Invitrogen) by using PCR. The PCR primers were: kozak-SalI 5′ (GGGGTCGACCACCATGGACTACAAAGACGATGACGACAAG) and SpeI 3′ (GGGCATCTCAGGATGTTAGACTTCCTGATCCTCAAAGAC). Then, amylase2 promoter-driven adenovirus vector (AdAmy2TRα) was constructed by using the pAd/PL-DEST Gateway vector kit (Invitrogen) according to the manufacturer's protocol. Cre-recombinase-expressing adenovirus under control of the amylase2 promoter (AdAmy2Cre) was assembled from synthetic oligonucleotides or PCR products. The fragments were cloned into attL1 and attL2 sites by using the pAd/PL-DEST Gateway vector kit. Wheat germ agglutinin (WGA) is a lectin that binds to N-acetylglucosamine (19Maylié-Pfenninger M.F. Jamieson J.D. Distribution of cell surface saccharides on pancreatic cells. II. Lectin-labeling patterns on mature guinea pig and rat pancreatic cells.J. Cell Biol. 1979; 80: 77-95Crossref PubMed Scopus (60) Google Scholar). Because of the higher expression of this sugar on exocrine cells, WGA labels only the acinar cells (20Baeyens L. Bonné S. Bos T. Rooman I. Peleman C. Lahoutte T. German M. Heimberg H. Bouwens L. Notch signaling as gatekeeper of rat acinar-to-beta-cell conversion in vitro.Gastroenterology. 2009; 136: 1750-1760Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar). For the specific labeling of acinar cells, freshly isolated exocrine cells were incubated with 4 nm Qdot-conjugated WGA (Invitrogen) in RPMI 1640 Gluta MAX-I medium (Invitrogen) without serum for 10 min and washed three times. To analyze the reprogramming of exocrine cells, culture medium was supplemented with adenovirus at a multiplicity of infection (m.o.i.) of 30 and 100 nm T3 with or without 10 μm LY294002 (Cell Signaling Technology), a PI3K signal-specific inhibitor. The culture medium was not changed throughout the experiment. For lineage tracing with the Cre/loxP-based system, ROSA26-lacZ mice (B6.129S4-Gt (ROSA) 26Sortm1Sor) were purchased from the Jackson Laboratory. Purified pancreatic acinar cells from ROSA26-lacZ mice were coinfected with 30 m.o.i. of AdAmy2TRα and AdAmy2Cre with T3 treatment. After 24, 48, or 72 h of incubation, cells were fixed in 10% buffered formalin and subsequently embedded in paraffin. Then, 3-μm sections were permeabilized with 0.2% Triton X-100 in phosphate-buffered saline for 10 min at room temperature and blocked with 10% BSA and 0.2% Tween 20. RNA was extracted from tissues or cells by using an RNeasy mini kit (Qiagen) according to the manufacturer's instructions. cDNA synthesis and real-time RT-PCR were performed as described (15Furuya F. Shimura H. Yamashita S. Endo T. Kobayashi T. Liganded thyroid hormone receptor-α enhances proliferation of pancreatic beta-cells.J. Biol. Chem. 2010; 285: 24477-24486Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). TaqMan probes for glucokinase, amylase2, insulin1, insulin2, Hnf6, Foxa2, Neurod1, Nkx2.2, Ngn3, Mafa, Pdx1, and 18S were purchased from Applied Biosystems. Protein lysate was prepared by using cell lysis buffer (Cell Signaling Technology) according to the manufacturer's instructions. Determination of the protein abundance by Western blot analysis was performed as described (15Furuya F. Shimura H. Yamashita S. Endo T. Kobayashi T. Liganded thyroid hormone receptor-α enhances proliferation of pancreatic beta-cells.J. Biol. Chem. 2010; 285: 24477-24486Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar) with the following primary antibodies: anti-Ngn3 antibody (BD Biosciences); anti-MafA, anti-Akt, anti-elastase, anti-GLUT2, anti-GCK, anti-receptor-type tyrosine-protein phosphatase-like N, and anti-carboxypeptidase E antibody (Santa Cruz Biotechnology); and anti-prohormone convertase 1/3, anti-p85α, anti-Pdx1, anti-phosphorylated Akt (Ser-473), and anti-phosphorylated Akt (Thr-308) antibody (Cell Signaling Technology). Negative control siRNA (Stealth RNAi) and siRNA against p85α (Stealth RNAi) were purchased from Invitrogen. Pancreatic acinar cells (1.0–1.3 × 105) infected with adenovirus (m.o.i., 30) were incubated with or without T3 for 12 h. Fifty nanomoles of control siRNA or a mixture of two anti-p85α siRNAs were then transfected into the cells by using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. After 48 h, the cells were washed with phosphate-buffered saline (Ca2+/Mg2+-free), and Western blot analysis was performed. Purified acinar cells that were infected with 30 m.o.i. of AdAmy2TRα were incubated with 100 nm T3 for 12 h. Fifty nanomoles of control siRNA or anti-p85α siRNAs was transfected. After 24, 48, or 72 h of incubation, the cells were fixed in 10% buffered formalin and subsequently embedded in paraffin. To analyze the protein expression of endogenous TRα in the cells, 500 μg of protein lysate from purified β-cells or acinar cells was immunoprecipitated with 5 μg of the C3 mouse monoclonal antibody against the C terminus of TRα (Santa Cruz Biotechnology) or with 5 μg of mouse IgG by using the Dynabeads protein G immunoprecipitation kit (Invitrogen) according to the manufacturer's protocol. Western blot analysis was performed with anti-TRα antibody (Santa Cruz Biotechnology) against an N-terminal TRα peptide. The association of p85α and TRα in purified acinar cells was determined by coimmunoprecipitation. To determine the interaction of endogenous p85α and transfected TRα, acinar cells infected with AdAmy2TRα at an m.o.i. of 30 were cultured with or without 100 nm T3. Cells were harvested after 24 h, and cell lysates were immunoprecipitated with 5 μg of anti-FLAG antibody by using the Dynabeads protein G immunoprecipitation kit, followed by Western blot analysis with anti-p85α antibody. Purified acinar cells that were infected with AdAmy2TRα were incubated with 100 nm T3 for 12 h. Fifty nanomoles of control siRNA or anti-p85α siRNAs was transfected. After 48 h, the cells were pre-fixed with 2% glutaraldehyde in phosphate buffer (pH 7.4) at 4 °C. After fixation the specimen was post-fixed with 2% osmium tetroxide in phosphate buffer (pH 7.4) for 45 min. Then, the specimens were dehydrated in a graded series of ethanol replaced with propylene oxide and embedded in epoxy resin (Quetol 812). Ultrathin sections (90–100 nm) were cut by using an Ultracut-UCT (Leica) with a diamond knife and stained with 2% uranyl acetate in distilled water for 15 min followed by a lead staining solution (21Hanaichi T. Sato T. Iwamoto T. Malavasi-Yamashiro J. Hoshino M. Mizuno N. A stable lead by modification of Sato's method.J. Electron Microsc. 1986; 35: 304-306PubMed Google Scholar) for 5 min. Sections were examined with a JEM-1200EX (JEOL) electron microscope at 80 kV. For immunoelectron microscopy, samples were fixed with 0.5% glutaraldehyde and 4% paraformaldehyde in 0.1 m phosphate buffer (pH 7.4) at 4 °C. Afterward, these were dehydrated in a graded series of ethanol and embedded in acrylate resin (LR-White). The polymerization was performed using an ultraviolet lamp equipped machine at −20 °C. Ultrathin sections (100–120 nm) were cut using a Ultracut-UCT (Leica) and pre-treated with 2% BSA. They were subsequently incubated with anti-insulin antibody (diluted 1:100 with 2% BSA in PBS) at 4 °C overnight and then with colloidal gold-conjugated (15 nm) anti-guinea pig IgG (BB International) at a dilution of 1:100 with 2% BSA. The sections were washed with distilled water prior to staining with 2% uranyl acetate for 5 min following by a lead staining solution (21Hanaichi T. Sato T. Iwamoto T. Malavasi-Yamashiro J. Hoshino M. Mizuno N. A stable lead by modification of Sato's method.J. Electron Microsc. 1986; 35: 304-306PubMed Google Scholar) for 1 min. Immunodeficient, 4-week-old nude mice (BALB/cAJc1-nu/nu) were purchased from Clea Japan. A single dose of 200 mg/kg STZ was injected intraperitoneally (15Furuya F. Shimura H. Yamashita S. Endo T. Kobayashi T. Liganded thyroid hormone receptor-α enhances proliferation of pancreatic beta-cells.J. Biol. Chem. 2010; 285: 24477-24486Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 22Shifrin A.L. Auricchio A. Yu Q.C. Wilson J. Raper S.E. Adenoviral vector-mediated insulin gene transfer in the mouse pancreas corrects streptozotocin-induced hyperglycemia.Gene Ther. 2001; 8: 1480-1489Crossref PubMed Scopus (47) Google Scholar). Depletion of β-cells was confirmed by immunohistochemical staining of the pancreas as well as by detection of severe hyperglycemia. After 7 days, mice that showed hyperglycemia (almost 70% of STZ-injected mice) were randomly divided into experimental groups (n = 6) that received 6 × 1010 plaque-forming units/mouse of AdAmy2TRα or AdAmy2LacZ, which are both controlled by the amylase2 promoter. Mice were anesthetized, and adenovirus was injected through the ampulla of Vater, also known as the hepatopancreatic ampulla, into the pancreatic duct. The abdomen was closed by using 2 layers of 4-0 vicryl sutures. T3 (0.25 μg/g body weight) was intraperitoneally injected once a day for 3 days. At day 4 following pancreatic duct injection, blood glucose levels or plasma insulin concentrations were analyzed as described (15Furuya F. Shimura H. Yamashita S. Endo T. Kobayashi T. Liganded thyroid hormone receptor-α enhances proliferation of pancreatic beta-cells.J. Biol. Chem. 2010; 285: 24477-24486Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar), and organs were removed from mice, fixed in 10% buffered formalin, and subsequently embedded in paraffin. Intraperitoneal glucose tolerance tests in STZ-treated mice were analyzed as described previously (15Furuya F. Shimura H. Yamashita S. Endo T. Kobayashi T. Liganded thyroid hormone receptor-α enhances proliferation of pancreatic beta-cells.J. Biol. Chem. 2010; 285: 24477-24486Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). At day 4 following adenovirus injection, mice were intravenously injected with a 5-bromo-2′-deoxyuridine (BrdU) labeling reagent, and BrdU incorporation was analyzed according to the manufacturer's protocol (Roche Applied Science). Data are expressed as means ± S.D. Statistical analysis was performed by using one-way ANOVA or the unpaired two-tailed Student's t test. Probability (23Furuya F. Hanover J.A. Cheng S.Y. Activation of phosphatidylinositol 3-kinase signaling by a mutant thyroid hormone β receptor.Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 1780-1785Crossref PubMed Scopus (120) Google Scholar) values <0.05 were considered to be significant. We first analyzed the expression of endogenous TRα in the pancreatic acinar or β-cells by coimmunoprecipitation of the whole cell lysate with a monoclonal antibody that recognizes the TR C-terminal region or with control mouse IgG. The immunoprecipitation was followed by Western blot analysis with antibody against an N-terminal TRα peptide. As shown in Fig. 1a, TRα protein expression was clearly observed in islets, but the TRα protein level was diminished in acinar cells. There was no signal for TRα in mouse IgG-precipitated samples of liver cells. These findings indicate that the expression levels of TRα are different between pancreatic acinar cells and β-cells and that large amounts of TRα are present in insulin-producing cells. In contrast, little TRα was expressed in pancreatic acinar cells. To explore the effects of TRα on the reprogramming of pancreatic acinar cells, we constructed adenovirus vector that expresses AdAmy2TRα. Ficoll-purified acinar cells or β-cells were infected with AdAmy2TRα at an m.o.i. of 30. After 48 h of incubation, the specific expression of FLAG-tagged TRα in purified acinar cells but not in AdAmy2TRα-infected β-cells was shown by Western blot analysis (Fig. 1b). Several reports suggested that activation of EGF signaling induces transdifferentiation of pancreatic exocrine cells into endocrine cells (5Minami K. Okuno M. Miyawaki K. Okumachi A. Ishizaki K. Oyama K. Kawaguchi M. Ishizuka N. Iwanaga T. Seino S. Lineage tracing and characterization of insulin-secreting cells generated from adult pancreatic acinar cells.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 15116-15121Crossref PubMed Scopus (220) Google Scholar, 20Baeyens L. Bonné S. Bos T. Rooman I. Peleman C. Lahoutte T. German M. Heimberg H. Bouwens L. Notch signaling as gatekeeper of rat acinar-to-beta-cell conversion in vitro.Gastroenterology. 2009; 136: 1750-1760Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar). To understand the functional consequences of ligand-bound TRα with downstream signaling molecules of the EGF receptor, we focused on PI3K. Previous reports indicated that TRα binds to the regulatory subunit of PI3K, p85α, and activates the PI3K/Akt pathway in vascular endothelial cells (11Hiroi Y. Kim H.H. Ying H. Furuya F. Huang Z. Simoncini T. Noma K. Ueki K. Nguyen N.H. Scanlan T.S. Moskowitz M.A. Cheng S.Y. Liao J.K. Rapid nongenomic actions of thyroid hormone.Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 14104-14109Crossref PubMed Scopus (295) Google Scholar). To determine whether ligand-bound TRα can interact with p85α in pancreatic exocrine cells, we performed coimmunoprecipitation studies with anti-FLAG and anti-p85α antibodies (Fig. 1c). The expression levels of endogenous p85α are no different in the lysates of purified acinar cells infected with AdAmy2TRα with or without 100 nm T3 treatment. By using the coimmunoprecipitation assay, we found that TRα and endogenous p85α are associated in a T3-dependent manner in pancreatic acinar cells. To identify the role of TRα in the reprogramming of pancreatic β-cells, purified pancreatic acinar cells were infected with Ad Amy2TRα and treated with or without T3. The expression of transcription factors that are involved in the differentiation of pancreatic endocrine cells was then analyzed by quantitative RT-PCR (Fig. 2 and Table 1). Infection with Ad Amy2TRα and incubation with T3 for 72 h significantly enhanced the mRNA expression of insulin1, insulin2, and glucokinase and induced the expression of transcription factors expressed at high levels in the early developing pancreas, such as Hnf6, Foxa2, Nkx2.2, NeuroD1, Pdx1, Ngn3, and MafA. In contrast, the expression level of amylase2 was decreased in the AdAmy2TRα-infected exocrine cells treated with T3. These results indicate that ligand-bound TRα specifically induced the genes characteristic of pancreatic" @default.
• W2069694792 created "2016-06-24" @default.
• W2069694792 creator A5006707748 @default.
• W2069694792 creator A5010312709 @default.
• W2069694792 creator A5029279570 @default.
• W2069694792 creator A5041469856 @default.
• W2069694792 creator A5054179861 @default.
• W2069694792 creator A5059688117 @default.
• W2069694792 creator A5059800665 @default.
• W2069694792 creator A5061187992 @default.
• W2069694792 creator A5066068448 @default.
• W2069694792 creator A5066834130 @default.
• W2069694792 date "2013-05-01" @default.
• W2069694792 modified "2023-09-30" @default.
• W2069694792 title "Ligand-bound Thyroid Hormone Receptor Contributes to Reprogramming of Pancreatic Acinar Cells into Insulin-producing Cells" @default.
• W2069694792 cites W1554318771 @default.
• W2069694792 cites W1966585633 @default.
• W2069694792 cites W1967687840 @default.
• W2069694792 cites W1974828844 @default.
• W2069694792 cites W1979928692 @default.
• W2069694792 cites W1982781304 @default.
• W2069694792 cites W1992032967 @default.
• W2069694792 cites W2010364187 @default.
• W2069694792 cites W2022896133 @default.
• W2069694792 cites W2025397278 @default.
• W2069694792 cites W2041739600 @default.
• W2069694792 cites W2055213986 @default.
• W2069694792 cites W2056249538 @default.
• W2069694792 cites W2065616344 @default.
• W2069694792 cites W2076508959 @default.
• W2069694792 cites W2077371239 @default.
• W2069694792 cites W2085447049 @default.
• W2069694792 cites W2085806876 @default.
• W2069694792 cites W2091724321 @default.
• W2069694792 cites W2101744962 @default.
• W2069694792 cites W2110447217 @default.
• W2069694792 cites W2113939834 @default.
• W2069694792 cites W2123229085 @default.
• W2069694792 cites W2126780067 @default.
• W2069694792 cites W2130595231 @default.
• W2069694792 cites W2134661862 @default.
• W2069694792 cites W2137987484 @default.
• W2069694792 cites W2142272547 @default.
• W2069694792 cites W2142769261 @default.
• W2069694792 cites W2148078342 @default.
• W2069694792 cites W2153711338 @default.
• W2069694792 cites W2154650642 @default.
• W2069694792 cites W2155006762 @default.
• W2069694792 cites W2159282095 @default.
• W2069694792 cites W2159802181 @default.
• W2069694792 cites W2324697026 @default.
• W2069694792 cites W4235936284 @default.
• W2069694792 cites W2016712103 @default.
• W2069694792 doi "https://doi.org/10.1074/jbc.m112.438192" @default.
• W2069694792 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3668771" @default.
• W2069694792 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/23595988" @default.
• W2069694792 hasPublicationYear "2013" @default.
• W2069694792 type Work @default.
• W2069694792 sameAs 2069694792 @default.
• W2069694792 citedByCount "27" @default.
• W2069694792 countsByYear W20696947922014 @default.
• W2069694792 countsByYear W20696947922015 @default.
• W2069694792 countsByYear W20696947922016 @default.
• W2069694792 countsByYear W20696947922017 @default.
• W2069694792 countsByYear W20696947922018 @default.
• W2069694792 countsByYear W20696947922019 @default.
• W2069694792 countsByYear W20696947922020 @default.
• W2069694792 countsByYear W20696947922021 @default.
• W2069694792 countsByYear W20696947922022 @default.
• W2069694792 crossrefType "journal-article" @default.
• W2069694792 hasAuthorship W2069694792A5006707748 @default.
• W2069694792 hasAuthorship W2069694792A5010312709 @default.
• W2069694792 hasAuthorship W2069694792A5029279570 @default.
• W2069694792 hasAuthorship W2069694792A5041469856 @default.
• W2069694792 hasAuthorship W2069694792A5054179861 @default.
• W2069694792 hasAuthorship W2069694792A5059688117 @default.
• W2069694792 hasAuthorship W2069694792A5059800665 @default.
• W2069694792 hasAuthorship W2069694792A5061187992 @default.
• W2069694792 hasAuthorship W2069694792A5066068448 @default.
• W2069694792 hasAuthorship W2069694792A5066834130 @default.
• W2069694792 hasBestOaLocation W20696947921 @default.
• W2069694792 hasConcept C109115496 @default.
• W2069694792 hasConcept C116569031 @default.
• W2069694792 hasConcept C121608353 @default.
• W2069694792 hasConcept C126322002 @default.
• W2069694792 hasConcept C134018914 @default.
• W2069694792 hasConcept C1491633281 @default.
• W2069694792 hasConcept C149574134 @default.
• W2069694792 hasConcept C170493617 @default.
• W2069694792 hasConcept C185592680 @default.
• W2069694792 hasConcept C23589133 @default.
• W2069694792 hasConcept C2778764654 @default.
• W2069694792 hasConcept C2779306644 @default.
• W2069694792 hasConcept C526584372 @default.
• W2069694792 hasConcept C530470458 @default.
• W2069694792 hasConcept C55493867 @default.
• W2069694792 hasConcept C71315377 @default.
• W2069694792 hasConcept C71924100 @default.

• next