FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2100804908> ?p ?o ?g. }

• W2100804908 endingPage "9141" @default.
• W2100804908 startingPage "9134" @default.
• W2100804908 abstract "One of the most common forms of functional interaction among transcription factors is the more than additive effect at promoters harboring multiple copies of a response element. The mechanisms that enable or control synergy at such compound response elements are poorly understood. We recently defined a common motif within the negative regulatory regions of multiple factors that operates by regulating their transcriptional synergy. We have identified such a synergy control (SC) motif embedded within the “attenuator domain” of CCAAT/enhancer-binding protein α (C/EBPα), a key regulator of energy homeostasis and cellular differentiation. A Lys159 → Arg substitution within the SC motif does not alter C/EBPα activity from a single site but leads to enhanced transactivation from synthetic or natural compound response elements. The sequence of SC motifs overlaps with the recently defined consensus SUMO modification site, and we find that the SC motif is the major site of both SUMO-1 and SUMO-3 modification in C/EBPα. Furthermore, the disruption of SC motif function is accompanied by loss of SUMO but not ubiquitin modification. C/EBPα interacts directly with the E2 SUMO-conjugating enzyme Ubc9 and can be SUMOylated in vitro using purified recombinant components. Notably, we find that PIASy has E3-like activity and enhances both SUMO-1 and SUMO-3 modification of C/EBPα in vivo and in vitro. Our results indicate that SUMO modification of SC motifs provides a means to rapidly control higher order interactions among transcription factors and suggests that SUMOylation may be a general mechanism to limit transcriptional synergy. One of the most common forms of functional interaction among transcription factors is the more than additive effect at promoters harboring multiple copies of a response element. The mechanisms that enable or control synergy at such compound response elements are poorly understood. We recently defined a common motif within the negative regulatory regions of multiple factors that operates by regulating their transcriptional synergy. We have identified such a synergy control (SC) motif embedded within the “attenuator domain” of CCAAT/enhancer-binding protein α (C/EBPα), a key regulator of energy homeostasis and cellular differentiation. A Lys159 → Arg substitution within the SC motif does not alter C/EBPα activity from a single site but leads to enhanced transactivation from synthetic or natural compound response elements. The sequence of SC motifs overlaps with the recently defined consensus SUMO modification site, and we find that the SC motif is the major site of both SUMO-1 and SUMO-3 modification in C/EBPα. Furthermore, the disruption of SC motif function is accompanied by loss of SUMO but not ubiquitin modification. C/EBPα interacts directly with the E2 SUMO-conjugating enzyme Ubc9 and can be SUMOylated in vitro using purified recombinant components. Notably, we find that PIASy has E3-like activity and enhances both SUMO-1 and SUMO-3 modification of C/EBPα in vivo and in vitro. Our results indicate that SUMO modification of SC motifs provides a means to rapidly control higher order interactions among transcription factors and suggests that SUMOylation may be a general mechanism to limit transcriptional synergy. One of the most pervasive forms of interaction between transcription factors is the synergistic response resulting from the recruitment of an activator to multiple copies of a recognition site (1Yamamoto K.R. Darimont B.D. Wagner R.L. Iniguez-Lluhi J.A. Cold Spring Harbor Symp. Quant. Biol. 1998; 63: 587-598Google Scholar, 2Yanofsky C. Mcknight S.L. Yamamoto K.R. Transcriptional Regulation. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1992: 3-26Google Scholar). Transcriptional synergy from such compound response elements provides a means to control both the level and specificity of gene expression (3Emami K.H. Carey M. EMBO J. 1992; 11: 5005-5012Google Scholar), yet the mechanisms by which synergy is controlled are still relatively poorly understood. Through a genetic approach, our laboratory has elucidated the function of a novel protein motif, which limits the transcriptional synergy of DNA binding regulators, including multiple steroid hormone receptors and ETS1 (4Iñiguez-Lluhı́ J.A. Pearce D. Mol. Cell. Biol. 2000; 20: 6040-6050Google Scholar). Disruption of these conserved synergy control (SC) 1The abbreviations used are: SC, synergy control; SCF, synergy control factor(s); C/EBP, CAAT/enhancer-binding protein; E1, ubiquitin-activating enzyme; E2, ubiquitin carrier protein; E3, ubiquitin-protein isopeptide ligase; Ub, ubiquitin; WT, wild type; HA, hemagglutinin; NTA, nitrilotriacetic acid; GST, glutathioneS-transferase motifs dramatically enhances synergistic activation from compound response elements without altering the intrinsic activity from an individual binding site. SC motifs are devoid of activation or repression properties, yet they are both necessary and sufficient to restrict the synergy mediated by a heterologous activation domain (4Iñiguez-Lluhı́ J.A. Pearce D. Mol. Cell. Biol. 2000; 20: 6040-6050Google Scholar). We have proposed that SC motifs serve to recruit synergy control factor(s) that directly limit transcriptional synergy (4Iñiguez-Lluhı́ J.A. Pearce D. Mol. Cell. Biol. 2000; 20: 6040-6050Google Scholar). Our functional characterization of eight examples of SC motifs in different regulators revealed that the critical features for SC motif function include a branched aliphatic residue at the first position followed by invariant Lys and Glu residues at positions 2 and 4 (see Fig. 1 and Ref. 4Iñiguez-Lluhı́ J.A. Pearce D. Mol. Cell. Biol. 2000; 20: 6040-6050Google Scholar). The core of the motif is preceded and/or followed by Pro residues in a region that often varies in size in different species, suggesting that the motif may lie between secondary structure elements or within a loop that can tolerate insertions (4Iñiguez-Lluhı́ J.A. Pearce D. Mol. Cell. Biol. 2000; 20: 6040-6050Google Scholar). In addition to the cases we have examined, matches to our definition of SC motifs occur frequently within documented negative regulatory regions of numerous unrelated transcription factors (4Iñiguez-Lluhı́ J.A. Pearce D. Mol. Cell. Biol. 2000; 20: 6040-6050Google Scholar). These seemingly disparate regions may therefore operate via a common mechanism (i.e. synergy control). A striking example is in the CCAAT/enhancer-binding proteins (C/EBPs), where C/EBPα and -ε harbor highly conserved SC motifs in previously defined “attenuator” regions (5Pei D.Q. Shih C.H. Mol. Cell. Biol. 1991; 11: 1480-1487Google Scholar, 6Angerer N.D. Du Y. Nalbant D. Williams S.C. J. Biol. Chem. 1999; 274: 4147-4154Google Scholar). At least six members of the C/EBP family have been isolated and characterized, C/EBPα to C/EBPζ. They all contain a highly conserved, basic leucine zipper dimerization and DNA binding domain at the C terminus (7Cao Z. Umek R.M. McKnight S.L. Genes Dev. 1991; 5: 1538-1552Google Scholar). Their divergent N-terminal regions contain the transcriptional regulatory domains and specify their diverse activities. Three conserved regions have been identified in C/EBPα, -β, and -ε that are involved in transcriptional activation (8Ramji D.P. Foka P. Biochem. J. 2002; 365: 561-575Google Scholar). The α-isoform of C/EBP is a central regulator of energy homeostasis (9McKnight S.L. Lane M.D. Gluecksohn-Waelsch S. Genes Dev. 1989; 3: 2021-2024Google Scholar) as it directly activates the transcription of many metabolically important genes (10Park E.A. Gurney A.L. Nizielski S.E. Hakimi P. Cao Z. Moorman A. Hanson R.W. J. Biol. Chem. 1993; 268: 613-619Google Scholar, 11Park E.A. Roesler W.J. Liu J. Klemm D.J. Gurney A.L. Thatcher J.D. Shuman J. Friedman A. Hanson R.W. Mol. Cell. Biol. 1990; 10: 6264-6272Google Scholar) and also plays pivotal roles in growth and differentiation (12Darlington G.J. Ross S.E. MacDougald O.A. J. Biol. Chem. 1998; 273: 30057-30060Google Scholar, 13Lane M.D. Tang Q.Q. Jiang M.S. Biochem. Biophys. Res. Commun. 1999; 266: 677-683Google Scholar, 14Cardinaux J.R. Allaman I. Magistretti P.J. Glia. 2000; 29: 91-97Google Scholar, 15Tengku-Muhammad T.S. Hughes T.R. Ranki H. Cryer A. Ramji D.P. Cytokine. 2000; 12: 1430-1436Google Scholar, 16Lekstrom-Himes J. Xanthopoulos K.G. J. Biol. Chem. 1998; 273: 28545-28548Google Scholar, 17Hendricks-Taylor L.R. Darlington G.J. Nucleic Acids Res. 1995; 23: 4726-4733Google Scholar, 18Wang N.D. Finegold M.J. Bradley A. Ou C.N. Abdelsayed S.V. Wilde M.D. Taylor L.R. Wilson D.R. Darlington G.J. Science. 1995; 269: 1108-1112Google Scholar). Genes regulated by C/EBPα usually harbor multiple binding sites like in the case of the peroxisome proliferator-activated receptor γ promoter (19Shi X.M. Blair H.C. Yang X. McDonald J.M. Cao X. J. Cell. Biochem. 2000; 76: 518-527Google Scholar) or the myeloperoxidase enhancer (20Ford A.M. Bennett C.A. Healy L.E. Towatari M. Greaves M.F. Enver T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10838-10843Google Scholar). C/EBPα often functions synergistically with other transcription factors like peroxisome proliferator-activated receptor γ or PU.1 (21Rosen E.D. Hsu C.H. Wang X. Sakai S. Freeman M.W. Gonzalez F.J. Spiegelman B.M. Genes Dev. 2002; 16: 22-26Google Scholar, 22Zhang D.E. Hohaus S. Voso M.T. Chen H.M. Smith L.T. Hetherington C.J. Tenen D.G. Curr. Top. Microbiol. Immunol. 1996; 211: 137-147Google Scholar). For example, cross-regulation between peroxisome proliferator-activated receptor γ and C/EBPα is a key component of the transcriptional control during adipogenesis (23Wu Z. Rosen E.D. Brun R. Hauser S. Adelmant G. Troy A.E. McKeon C. Darlington G.J. Spiegelman B.M. Mol. Cell. 1999; 3: 151-158Google Scholar, 24Clarke S.L. Robinson C.E. Gimble J.M. Biochem. Biophys. Res. Commun. 1997; 240: 99-103Google Scholar). Regulatory mechanisms that affect C/EBPα synergy are therefore likely to have a profound impact on its function. We have hypothesized that the function of SC motifs may be regulated through post-translational modification of the critical Lys residue (4Iñiguez-Lluhı́ J.A. Pearce D. Mol. Cell. Biol. 2000; 20: 6040-6050Google Scholar), especially since Arg is not functional at this position. Interestingly, soon after our description of SC motifs, the consensus site for modification by the ubiquitin-like protein SUMO (Fig. 1) came into sharper focus, and it became apparent that our current definition of SC motifs could be viewed as a special case of the more general SUMOylation consensus. SUMOylation is a reversible process that regulates the function of target proteins in a manner akin to phosphorylation. The functional consequences of SUMOylation are poorly understood but do not directly involve targeting for proteasomal degradation (25Muller S. Hoege C. Pyrowolakis G. Jentsch S. Nat. Rev. Mol. Cell. Biol. 2001; 2: 202-210Google Scholar). Three different isoforms of SUMO are present in mammals, but whether they subserve different roles is unknown. As in the case of ubiquitination, preparation of SUMO for modification of proteins involves two steps carried by specific E1 activating (SAE1/SAE2) and E2 transfer (UBC9) enzymes. During ubiquitination, a third Ub-ligase or E3 component conveys substrate recognition, often in a signal-regulated manner (26Weissman A.M. Nat. Rev. Mol. Cell. Biol. 2001; 2: 169-178Google Scholar,27Jackson P.K. Eldridge A.G. Freed E. Furstenthal L. Hsu J.Y. Kaiser B.K. Reimann J.D. Trends Cell Biol. 2000; 10: 429-439Google Scholar). Although SUMOylation can be achieved without an E3 activityin vitro (28Desterro J.M. Rodriguez M.S. Kemp G.D. Hay R.T. J. Biol. Chem. 1999; 274: 10618-10624Google Scholar), recent studies indicate that proteins like RanBP2 (29Pichler A. Gast A. Seeler J.S. Dejean A. Melchior F. Cell. 2002; 108: 109-120Google Scholar) and members of the PIAS family (30Schmidt D. Muller S. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 2872-2877Google Scholar, 31Sachdev S. Bruhn L. Sieber H. Pichler A. Melchior F. Grosschedl R. Genes Dev. 2001; 15: 3088-3103Google Scholar, 32Kotaja N. Karvonen U. Janne O.A. Palvimo J.J. Mol. Cell. Biol. 2002; 22: 5222-5234Google Scholar) can have E3-like activity for SUMO conjugation. In an effort to examine the generality of SC motif function and to explore its mode of action, we have probed the functional significance of the SC motif in C/EBPα and the role of SUMO modification in its function. The pCDNA3-based expression plasmid for the p42 form of mouse C/EBPα was provided by Dr. Ormond MacDougald and is described in Ref. 33Ross S.E. Erickson R.L. Hemati N. MacDougald O.A. Mol. Cell. Biol. 1999; 19: 8433-8441Google Scholar. This plasmid (pCDNA3 p42) contains engineered silent restriction sites for ease of manipulation. The K159R substitution was generated by PCR and then transferred to p42 as a 538-bp XhoI/KpnI fragment (pCDNA3 p42 K159R). The C-terminal region of p42 was amplified with primers 5′-CGCAACAGAAGGTGCTCGAGTTGACCAGTGACAAT-3′ and 5′-CTAGAAGCTTCTAA TGATGATGGTGGTGATGGTCGACCGCGCAGTTGCCCATGGCCTTG ACC-3′ to add a C-terminal hexahistidine tag and transferred into theXhoI and Hind III sites of the WT and K159R p42 plasmids (pCDNA3 p42 His and pCDNA3 p42 K159R His). The pCDNA3 HA SUMO-1, pCDNA3 HA SUMO-3, and pCDNA3 HA ubiquitin were kind gifts of Dr. Kim Orth (University of Texas Southwestern), and the pCMVFLAG PIASy plasmid was a kind gift of Dr. Tae-Hwa Chun (University of Michigan). The pΔODLO 02 parental vector contains a polylinker upstream of a minimal Drosophila alcohol dehydrogenase promoter (adh −33 to +53) and the luciferase gene. The oligonucleotides 5′-GATCCTGATTGCGCAATCGA-3′ and 5′-GATCTCGATTGCGCAATCAG-3′, containing a single consensus C/EBP site, were annealed and ligated into the BamHI andBglII sites of pΔODLO 02 to yield pΔ(CAAT)1-Luc. Ligation of BseRI/BglII andBamHI/BseRI fragments of the same vector yielded pΔ(CAAT)2-Luc. The same procedure using pΔ(CAAT)2-Luc yielded pΔ(CAAT)4-Luc. The pΔTAT glucocorticoid response units reporter consists of a fusion of 668- and 300-bp fragments corresponding to the −5.5 and −2.5 kb glucocorticoid response units of the rat tyrosine aminotransferase gene (34Grange T. Roux J. Rigaud G. Pictet R. Nucleic Acids Res. 1991; 19: 131-139Google Scholar) inserted at theBamHI and BglII sites of pΔODLO 02. The human Ubc9 coding sequence was amplified with primers 5′-GCTACGGATCCATGAGTGAGATCGCCCTCAGCAGACTCGCCCAG-3′ and 5′-GGAGTGCCTTGGCCCCAAG TCCGGTGGTGGTGGTGGAATTCAAAGATC-3′, digested withBamHI and EcoRI, and transferred to the same sites of the pGEX-KG vector (35Guan K.L. Dixon J.E. Anal. Biochem. 1991; 192: 262-267Google Scholar) to yield pGEX-hUbc9. The expression vectors for His SUMO-1GG, in which the last 4 residues of SUMO-1 have been deleted, and GST-Ulp1 were kind gifts of Dr. Kim Orth. The expression vector for bicistronic expression of GST SAE2 and SAE1 (28Desterro J.M. Rodriguez M.S. Kemp G.D. Hay R.T. J. Biol. Chem. 1999; 274: 10618-10624Google Scholar) was a kind gift of Dr. R. T. Hay. The sequences of all of the constructed plasmids were confirmed by sequencing. Human embryonic kidney 293T cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum. Cells were transfected by liposome-mediated transfection using LipofectAMINE and Plus reagent (Invitrogen). In all cases, cells received equimolar amounts of each type of expression plasmid to control for promoter effects. For functional assays, 5 × 103 cells were seeded into 96-well plates and transfected with the indicated amounts of expression plasmids, 30 ng of the indicated reporter plasmid, and 10 ng of the control pRSVβgal plasmid (36Pearce D. Yamamoto K.R. Science. 1993; 259: 1161-1165Google Scholar). The total amount of DNA was supplemented to 70 ng/well with pBSKS (−). Cells were lysed 36 h after transfection, and luciferase and β-galactosidase activities were determined as described previously (37Iñiguez-Lluhı́ J.A. Lou D.Y. Yamamoto K.R. J. Biol. Chem. 1997; 272: 4149-4156Google Scholar). For SUMOylation/ubiquitination experiments, 2 × 106 cells were seeded in 10-cm plates and transfected with the indicated amounts of expression plasmids. Cells were harvested 36 h post-transfection in 0.7 ml of urea lysis buffer (8m urea, 0.5 m NaCl, 45 mmNa2HPO4, 5 mmNaH2PO4, 10 mm imidazole, Complete miniprotease inhibitor mixture tablets (1 tablet/10 ml) (pH 8.0)) and sonicated. For ubiquitination experiments, the cells were treated with 10 μm lactacystin for 1 h before harvest with urea lysis buffer. Lysates were incubated with 0.1 ml of Ni2+-NTA-agarose (Qiagen) for 1 h at room temperature in a rotator. The resin was washed three times with 10 bed volumes of wash buffer 1 (8 m urea, 0.4 m NaCl, 17.6 mm Na2HPO4, 32.4 mmNaH2PO4, 10 mm imidazole (pH 6.75)) and three times with 10 bed volumes of wash buffer 2 (buffer 1 with 150 mm NaCl and no urea). Examination of the supernatants revealed that the binding is quantitative under these conditions. For Ulp1 treatment, beads were incubated with 3.5 μg of purified GST or GST-Ulp1 for 60 min at 30 °C. Proteins were eluted by incubating at 90 °C in elution buffer (100 mm Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 500 mm imidazole, 0.015% bromphenol blue, 10 mm dithiothreitol), resolved by SDS-PAGE, and processed for immunoblotting. Membranes (Immobilon) were incubated with goat polyclonal anti-C/EBPα IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or monoclonal HA 11 anti IgG (Covance) or monoclonal anti-FLAG IgG (Sigma). Anti-goat IgG peroxidase conjugate (Santa Cruz Biotechnology) or anti-mouse IgG peroxidase conjugate (Bio-Rad) were used as secondary antibodies, and visualization was with Super Signal West Femto substrates (Pierce). Images were captured with an Eastman Kodak Co. Image Station 440 CF. All of the experiments were performed at least twice with similar results. BL21 DE3-CodonPlus cells harboring the pGEX-hUbc9 or pGEX-SAE2/SAE1 expression vector and BLR (DE3) pLysS cells (Novagen) containing pGEX-Ulp1 or pT7His SUMO-1GG were grown at 37 °C in LB medium containing carbenicillin, chloramphenicol, and tetracycline (50 μg/ml, 25 μg/ml, and 12 μg/ml). Cultures (1 liter;A 600 = 0.8) were induced with 1 mmisopropyl-1-thio-β-d-galactopyranoside for 2 h at 37 °C. Cells were centrifuged at 8,000 × g for 15 min at 4 °C. For GST fusion proteins, the pellet was resuspended in buffer A (10 mm Tris-HCl (pH 8.0), 150 mm NaCl, 1 mm EDTA, 5 mm dithiothreitol, 10% glycerol, and Complete miniprotease inhibitor mixture tablets (1 tablet/10 ml)). After lysozyme treatment (40 μg/ml for 30 min) and sonication at 4 °C, the suspension was centrifuged at 35,000 rpm at 4 °C for 30 min. The supernatant was incubated with 2 ml of glutathione-agarose (Sigma) for 60 min at 24 °C. The matrix was washed (4 °C) with 10 bed volumes of buffer A without protease inhibitors and with 10 bed volumes of buffer B (buffer A with 400 mm NaCl). Proteins were eluted in buffer B (24 °C) supplemented with 20 mmreduced glutathione. For His SUMO-1GG, cells were resuspended and lysed in buffer C (50 mm sodium phosphate buffer, pH 8.0, 300 mm NaCl, 10% glycerol 10 mm imidazole, 5 mm β-mercaptoethanol Complete miniprotease inhibitor mixture tablets (1 tablet/10 ml)). Incubation of the extract was with 2 ml of Ni2+-NTA resin (Qiagen) for 1 h at 4 °C. The resin was washed with 10 bed volumes of buffer C, followed by 2 bed volumes of buffer C containing 20 mmimidazole. Protein was eluted in buffer C containing 250 mmimidazole. All proteins were exchanged into buffer D (10 mmTris-HCl (pH 8.0), 150 mm NaCl, 1 mm EDTA, 5 mm dithiothreitol, 10% glycerol) via gel filtration and stored at −80 °C. For immunopurification of PIASy, COS-7 cells were maintained and transiently transfected in 10-cm plates as described above for 293T cells with 10 μg of expression plasmid, pCMVFLAG-PIASy, or the empty pCMV FLAG. Cells were harvested after 36 h in Buffer E (20 mm Hepes, pH 7.5, 5 mm EDTA, 1 mm EGTA, 5% glycerol, 400 mm NaCl, Complete miniprotease inhibitor mixture tablets (1 tablet/10 ml)). The extracts were incubated with 50 μg of anti-FLAG antibody (Sigma) for 1 h at 4 °C. Complexes were recovered using 50 μl of protein A-Sepharose (Sigma) and washed three times in buffer E with 200 mm NaCl and twice in 50 mmTris (pH 7.5), 5 mm MgCl2. Proteins were translated in vitro using the T7-TNT Quick Coupled Transcription-Translation system (Promega) in the presence of [35S]methionine using the pCDNA3 p42, pCDNA3 p42 K159R, or control T7 Luc (Promega) plasmids as templates. Binding reactions (50 μl) were carried out at 4 °C for 1 h and contained 1.2 nmol of purified GST or GST-hUBC9 fusion proteins bound to 20 μl of glutathione-Sepharose 4B (Amersham Biosciences) and 10 μl of 35S-labeled proteins in a binding buffer containing 50 mm NaCl and 1 mg/ml bovine serum albumin. The resin was washed four times with 1 ml of 0.1% Nonidet P-40 in phosphate-buffered saline. The beads and 2 μl of the corresponding load were boiled in a final volume of 40 μl of SDS-PAGE sample buffer, and 25% of the samples were resolved by SDS-PAGE. The gels were fixed in 45% methanol, 10% acetic acid and dried, and radioactive proteins were visualized using a PhosphorImager (Amersham Biosciences). In vitro SUMOylation reactions (20 μl) were assembled on ice in 50 mm Tris, 5 mm MgCl2 (pH 7.5) and contained 1 μg of GST SAE2/SAE1, 5 or 0.5 μg of GST hUBC9, 5 μg of His-SUMO-1GG, 5 μl of in vitro translated [35S]methionine-labeled p42 C/EBPα WT or K159R, and 10 μl of control or PIASy-containing beads as indicated. Reactions were initiated by the addition of an ATP regeneration system (10 units/ml creatine kinase, 25 mm phosphocreatine, 5 mmATP final concentrations) and pyrophosphatase (0.6 units/ml final concentration) and incubated at 30 °C for 2 h. Disruption buffer (50 mm Tris-HCl, pH 6.8, 1.67% SDS, 10% glycerol, 0.24 m β-mercaptoethanol, 0.015% bromphenol blue) was added to terminate the reaction. The samples were heated at 95 °C for 5 min, resolved by SDS-PAGE, and dried, and the radioactive proteins were visualized in a PhosphorImager. All of the results were confirmed in at least two independent experiments. Mining of the Swiss-Prot protein data base for the occurrence of SC motifs allowed us to identify a number of transcription factors that harbor conserved SC motifs. For several of them, like the progesterone receptor, Sp3, C/EBPα, C/EBPε and c-Myb, the motifs reside in demonstrated negative regulatory regions (4Iñiguez-Lluhı́ J.A. Pearce D. Mol. Cell. Biol. 2000; 20: 6040-6050Google Scholar). In the case of C/EBPα, the SC motif lies within an “attenuator” domain (5Pei D.Q. Shih C.H. Mol. Cell. Biol. 1991; 11: 1480-1487Google Scholar). By comparing multiple sequences from distantly related vertebrates, we find that the SC motif in C/EBPα constitutes a highly conserved small stretch surrounded by regions of lower conservation (see Fig.1 A). This suggests an evolutionary pressure for the preservation of this sequence and the function it subserves. To assess whether the SC motif in C/EBPα functions by inhibiting transcriptional synergy, we replaced the predicted critical lysine at position 159 with arginine. This substitution inactivates SC motif function in all of the cases we have examined (4Iñiguez-Lluhı́ J.A. Pearce D. Mol. Cell. Biol. 2000; 20: 6040-6050Google Scholar). We then compared the activity of the WT and mutant proteins at promoters harboring zero, one, two, or four C/EBPα sites. We chose 293T cells, since they do not contain endogenous C/EBPα (38Erickson R.L. Hemati N. Ross S.E. MacDougald O.A. J. Biol. Chem. 2001; 276: 16348-16355Google Scholar). As can be seen in Fig.1 B, WT C/EBPα activates the reporter with a single binding site by 10-fold. Adding a second site enhances the activity only 2.8-fold, and adding two more sites does not significantly increase transcription. These results indicate that the ability of C/EBPα to engage in synergistic interactions is limited. The K159R mutant is indistinguishable from the WT at a single site. However, the activity of the mutant at the reporters with two and four sites is ∼6- and 14-fold higher than that at a single site. This translates to a 2.5- and 5-fold higher activity of the mutant versus the WT protein at these reporters. Thus, disruption of the SC motif leads to enhanced transcriptional synergy, indicating that its normal function is to restrict the potential of C/EBPα to synergize but without affecting its intrinsic transactivation potential. Similar results were obtained in CV-1 cells (not shown). Importantly, we also observed a 5-fold higher activity of the mutant C/EBPα from a reporter driven by the natural enhancer regions of the rat tyrosine aminotransferase gene, which harbor multiple C/EBPα sites (see Fig. 1 B,right) (34Grange T. Roux J. Rigaud G. Pictet R. Nucleic Acids Res. 1991; 19: 131-139Google Scholar). This indicates that the effect is not restricted to synthetic promoters. Consistent with their comparable activities at a single site, Western blot analysis indicated that the WT and mutant proteins are expressed at equivalent levels (not shown). Furthermore, similar results were observed at both higher and lower amounts of plasmid, ruling out preferential squelching effects (not shown). Taken together, these results confirm our assignment of this region of C/EBPα as a functional synergy control motif and argue that the SC motif is responsible for the described “attenuator” property of this region (5Pei D.Q. Shih C.H. Mol. Cell. Biol. 1991; 11: 1480-1487Google Scholar). Our sequence definition of SC motifs, which is based purely on functional effects, can be viewed as a subset of the more general SUMO modification consensus (Fig. 1 A). Therefore, we tested whether the SC motif in C/EBPα can be modified by SUMO isoforms in vivo. To this end, we co-transfected 293T cells with expression vectors for His-tagged WT and mutant C/EBPα forms with vectors for HA-tagged SUMO-1 or SUMO-3. Cells were lysed under denaturing conditions to protect SUMOylated proteins from isopeptidases. His-tagged C/EBPα forms were purified via metal chelate chromatography, resolved by SDS-PAGE, and immunoblotted. As can be seen in Fig. 2, when WT C/EBPα is coexpressed with HA-SUMO-1 or HA-SUMO-3, we can detect ∼91-kDa HA immunoreactive bands corresponding to HA SUMO-1- and HA SUMO-3-modified C/EBPα. The SUMO-3-modified form migrates slightly faster than the SUMO-1 counterpart, presumably due to the smaller size of SUMO-3versus SUMO-1. As is the case for other SUMO-modified proteins, the migration of modified forms is slower than that expected for their molecular sizes. The slower migrating species can also be detected as a minor band in the anti C/EBP blot for both SUMO-1 and SUMO-3. As in the case of other targets (25Muller S. Hoege C. Pyrowolakis G. Jentsch S. Nat. Rev. Mol. Cell. Biol. 2001; 2: 202-210Google Scholar), relative quantitation revealed that less than 5% of the total C/EBPα is modified by either SUMO isoform. This may reflect the transient and reversible nature of this modification. Notably, these slower migrating forms were completely absent in the case of the K159R mutant, although its expression is indistinguishable from that of the WT protein. Comparable results were obtained in COS-7 cells. These results show that C/EBPα is modified in vivo by SUMO-1 or SUMO-3 and argue strongly that the SC motif is the main target for SUMO modification in C/EBPα. Moreover, the fact that the K159R mutation disrupts both SC motif function and SUMOylation implies that this modification is key for SC motif function. The yeast ubiquitin-like protein specific protease 1 (Ulp1) deconjugates SUMO from the lysine ε-amino group of modified proteins (39Li S.J. Hochstrasser M. Nature. 1999; 398: 246-251Google Scholar). This deconjugase activity is specific for SUMO versus ubiquitin. To confirm that the higher order species of C/EBPα that we observe is a SUMO-modified form, we treated the purified C/EBPα preparations with GST alone or with GST-Ulp1 (Fig. 3). In contrast to the GST treatment, we did not observe HA immunoreactive bands at ∼91 kDa in SUMO-1 or SUMO-3 samples treated with GST-Ulp1. Instead, we saw a species of ∼24 kDa corresponding to free SUMO. Ulp1 did not display nonspecific protease activity, since the unmodified C/EBPα protein was not affected by the treatment. These results suggest that C/EBPα can be modified by SUMO-1 and SUMO-3 and that Ulp1 can remove either SUMO isoform from C/EBPα. Although the cleavage of SUMO-1 from substrates by Ulp1 is well established, to our knowledge, this is the first demonstration that SUMO-3-modified proteins can also be deconjugated by this yeast enzyme. Both ubiquitin and SUMO are linked to proteins through Lys residues, and in the case of IκB, both modifications appear to occur at the same site (40Desterro J.M. Rodriguez M.S. Hay R.T. Mol. Cell. 1998; 2: 233-239Google Scholar). Desterro et al. (40Desterro J.M. Rodriguez M.S. Hay R.T. Mol. Cell. 1998; 2: 233-239Google Scholar) proposed that SUMO modification of IκB prevents its ubiquitination and therefore contributes to the stabilization of this protein. We therefore explored whether C/EBPα is ubiquitinated and, if so, whether disruption of the SC motif alters this modification. We used the same experimental paradigm as for SUMO modification and treated the cells with the proteasome inhibitor lactacystin to allow the accumulation of ubiquitinated proteins. As can be seen in the HA immunoblot in Fig. 4, we can detect mono- and polyubiquitinated forms of C/EBPα. To our knowledge, this is the first demonstration that C/EBPα is ubiquitinated. Notably, we observed an identical pattern using the K159R mutant. These results clearly indicate that although ubiquitina" @default.
• W2100804908 created "2016-06-24" @default.
• W2100804908 creator A5032715400 @default.
• W2100804908 creator A5062181502 @default.
• W2100804908 creator A5064256673 @default.
• W2100804908 date "2003-03-01" @default.
• W2100804908 modified "2023-10-17" @default.
• W2100804908 title "A Synergy Control Motif within the Attenuator Domain of CCAAT/Enhancer-binding Protein α Inhibits Transcriptional Synergy through Its PIASy-enhanced Modification by SUMO-1 or SUMO-3" @default.
• W2100804908 cites W1653711913 @default.
• W2100804908 cites W1666755687 @default.
• W2100804908 cites W1780544763 @default.
• W2100804908 cites W1972166544 @default.
• W2100804908 cites W1975658312 @default.
• W2100804908 cites W1978589050 @default.
• W2100804908 cites W1980292048 @default.
• W2100804908 cites W1990863079 @default.
• W2100804908 cites W1996223704 @default.
• W2100804908 cites W2003019920 @default.
• W2100804908 cites W2004722555 @default.
• W2100804908 cites W2005902803 @default.
• W2100804908 cites W2009379631 @default.
• W2100804908 cites W2009856824 @default.
• W2100804908 cites W2020649739 @default.
• W2100804908 cites W2022139382 @default.
• W2100804908 cites W2031668046 @default.
• W2100804908 cites W2032660293 @default.
• W2100804908 cites W2036883820 @default.
• W2100804908 cites W2040825545 @default.
• W2100804908 cites W2049629344 @default.
• W2100804908 cites W2050895547 @default.
• W2100804908 cites W2071689903 @default.
• W2100804908 cites W2072961847 @default.
• W2100804908 cites W2073148985 @default.
• W2100804908 cites W2074463981 @default.
• W2100804908 cites W2075470465 @default.
• W2100804908 cites W2078049307 @default.
• W2100804908 cites W2078853769 @default.
• W2100804908 cites W2081880451 @default.
• W2100804908 cites W2082181748 @default.
• W2100804908 cites W2083489746 @default.
• W2100804908 cites W2094209629 @default.
• W2100804908 cites W2094966235 @default.
• W2100804908 cites W2116988305 @default.
• W2100804908 cites W2117272440 @default.
• W2100804908 cites W2118810511 @default.
• W2100804908 cites W2121779606 @default.
• W2100804908 cites W2123180955 @default.
• W2100804908 cites W2129011493 @default.
• W2100804908 cites W2133162368 @default.
• W2100804908 cites W2134513269 @default.
• W2100804908 cites W2135412012 @default.
• W2100804908 cites W2135855901 @default.
• W2100804908 cites W2140513365 @default.
• W2100804908 cites W2142022809 @default.
• W2100804908 cites W2162481722 @default.
• W2100804908 cites W2170005346 @default.
• W2100804908 cites W2173681478 @default.
• W2100804908 cites W2791163698 @default.
• W2100804908 doi "https://doi.org/10.1074/jbc.m210440200" @default.
• W2100804908 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12511558" @default.
• W2100804908 hasPublicationYear "2003" @default.
• W2100804908 type Work @default.
• W2100804908 sameAs 2100804908 @default.
• W2100804908 citedByCount "147" @default.
• W2100804908 countsByYear W21008049082012 @default.
• W2100804908 countsByYear W21008049082013 @default.
• W2100804908 countsByYear W21008049082014 @default.
• W2100804908 countsByYear W21008049082015 @default.
• W2100804908 countsByYear W21008049082016 @default.
• W2100804908 countsByYear W21008049082017 @default.
• W2100804908 countsByYear W21008049082018 @default.
• W2100804908 countsByYear W21008049082019 @default.
• W2100804908 countsByYear W21008049082020 @default.
• W2100804908 countsByYear W21008049082021 @default.
• W2100804908 crossrefType "journal-article" @default.
• W2100804908 hasAuthorship W2100804908A5032715400 @default.
• W2100804908 hasAuthorship W2100804908A5062181502 @default.
• W2100804908 hasAuthorship W2100804908A5064256673 @default.
• W2100804908 hasBestOaLocation W21008049081 @default.
• W2100804908 hasConcept C104317684 @default.
• W2100804908 hasConcept C111936080 @default.
• W2100804908 hasConcept C120665830 @default.
• W2100804908 hasConcept C121332964 @default.
• W2100804908 hasConcept C138885662 @default.
• W2100804908 hasConcept C149240914 @default.
• W2100804908 hasConcept C153911025 @default.
• W2100804908 hasConcept C174847166 @default.
• W2100804908 hasConcept C179926584 @default.
• W2100804908 hasConcept C184652730 @default.
• W2100804908 hasConcept C185592680 @default.
• W2100804908 hasConcept C24890656 @default.
• W2100804908 hasConcept C32276052 @default.
• W2100804908 hasConcept C41895202 @default.
• W2100804908 hasConcept C55493867 @default.
• W2100804908 hasConcept C86339819 @default.
• W2100804908 hasConcept C86803240 @default.
• W2100804908 hasConcept C94966510 @default.
• W2100804908 hasConcept C95444343 @default.

• next