Matches in Ubergraph for { <http://purl.obolibrary.org/obo/NCIT_C1788> ?p ?o ?g. }
Showing items 1 to 46 of
46
with 100 items per page.
- NCIT_C1788 IAO_0000115 "A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. (NCI04)" @default.
- NCIT_C1788 NCIT_A32 NCIT_C1909 @default.
- NCIT_C1788 NCIT_NHC0 "C1788" @default.
- NCIT_C1788 NCIT_P106 "Nucleic Acid, Nucleoside, or Nucleotide" @default.
- NCIT_C1788 NCIT_P106 "Pharmacologic Substance" @default.
- NCIT_C1788 NCIT_P108 "Aprinocarsen" @default.
- NCIT_C1788 NCIT_P175 "719337" @default.
- NCIT_C1788 NCIT_P207 "C0666551" @default.
- NCIT_C1788 NCIT_P210 "151879-73-1" @default.
- NCIT_C1788 NCIT_P319 "FMT95051CQ" @default.
- NCIT_C1788 NCIT_P322 "FDA" @default.
- NCIT_C1788 NCIT_P322 "GDC" @default.
- NCIT_C1788 NCIT_P325 "A substance that is being studied in the treatment of cancer." @default.
- NCIT_C1788 NCIT_P329 "42953" @default.
- NCIT_C1788 NCIT_P330 "42953" @default.
- NCIT_C1788 NCIT_P366 "ISIS_3521" @default.
- NCIT_C1788 NCIT_P375 "Aprinocarsen" @default.
- NCIT_C1788 NCIT_P375 "PKC-alpha Antisense Oligodeoxynucleotide ISIS 3521" @default.
- NCIT_C1788 NCIT_P399 "42953" @default.
- NCIT_C1788 normalizedInformationContent "92.730304365937428" @default.
- NCIT_C1788 referenceCount "3" @default.
- NCIT_C1788 hasExactSynonym "APRINOCARSEN" @default.
- NCIT_C1788 hasExactSynonym "Affinitac" @default.
- NCIT_C1788 hasExactSynonym "Affinitak" @default.
- NCIT_C1788 hasExactSynonym "Aprinocarsen" @default.
- NCIT_C1788 hasExactSynonym "CGP 64128A" @default.
- NCIT_C1788 hasExactSynonym "DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A)" @default.
- NCIT_C1788 hasExactSynonym "DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA)" @default.
- NCIT_C1788 hasExactSynonym "ISIS 3521" @default.
- NCIT_C1788 hasExactSynonym "LY900003" @default.
- NCIT_C1788 hasExactSynonym "Protein Kinase C-Alpha Antisense" @default.
- NCIT_C1788 inSubset NCIT_C128784 @default.
- NCIT_C1788 inSubset NCIT_C157711 @default.
- NCIT_C1788 inSubset NCIT_C157712 @default.
- NCIT_C1788 inSubset NCIT_C176424 @default.
- NCIT_C1788 inSubset NCIT_C177537 @default.
- NCIT_C1788 inSubset NCIT_C63923 @default.
- NCIT_C1788 type Class @default.
- NCIT_C1788 isDefinedBy ncit.owl @default.
- NCIT_C1788 label "Aprinocarsen" @default.
- NCIT_C1788 subClassOf NCIT_C1291 @default.
- NCIT_C1788 subClassOf NCIT_C1788 @default.
- NCIT_C1788 subClassOf NCIT_C1908 @default.
- NCIT_C1788 subClassOf NCIT_C1909 @default.
- NCIT_C1788 subClassOf NCIT_C1962 @default.
- NCIT_C1788 subClassOf NCIT_C307 @default.