FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W14052271> ?p ?o ?g. }

• W14052271 endingPage "490" @default.
• W14052271 startingPage "481" @default.
• W14052271 abstract "Sexually transmitted diseases, genital ulcer disease, and progesterone therapy increase susceptibility to lentivirus transmission. Infection of cells by human immunodeficiency virus (HIV) is dependent on expression of specific chemokine receptors known to function as HIV co-receptors. Quantitative kinetic reverse transcription-polymerase chain reaction was developed to determine thein vivo expression levels of CCR5, CXCR4, CCR3, CCR2b, and the cytomegalovirus-encoded US28 in peripheral blood mononuclear cells and cervical biopsies from 12 women with and without sexually transmitted diseases, genital ulcer disease, and progesterone-predominant conditions. Our data indicate that CCR5 is the major HIV co-receptor expressed in the female genital tract, and CXCR4 is the predominantly expressed HIV co-receptor in peripheral blood. CCR5 mRNA expression in the ectocervix was 10-fold greater than CXCR4, 20-fold greater than CCR2b, and 100-fold greater than CCR3. In peripheral blood, CXCR4 expression was 1.5-fold greater than CCR5, 10-fold greater than CCR2b, and 15-fold greater than CCR3. US28 was not expressed in cervical tissue despite expression in peripheral blood mononuclear cells from five individuals. CCR5 was significantly increased (p < 0.02) in biopsies from women with sexually transmitted diseases and others who were progesterone predominant. In vitrostudies demonstrate that progesterone increases CCR5, CXCR4, and CCR3 expression and decreases CCR2b expression in lymphocytes and monocytes/macrophages. Characterization of chemokine receptors at the tissue level provides important information in identifying host determinants of HIV-1 transmission. Sexually transmitted diseases, genital ulcer disease, and progesterone therapy increase susceptibility to lentivirus transmission. Infection of cells by human immunodeficiency virus (HIV) is dependent on expression of specific chemokine receptors known to function as HIV co-receptors. Quantitative kinetic reverse transcription-polymerase chain reaction was developed to determine thein vivo expression levels of CCR5, CXCR4, CCR3, CCR2b, and the cytomegalovirus-encoded US28 in peripheral blood mononuclear cells and cervical biopsies from 12 women with and without sexually transmitted diseases, genital ulcer disease, and progesterone-predominant conditions. Our data indicate that CCR5 is the major HIV co-receptor expressed in the female genital tract, and CXCR4 is the predominantly expressed HIV co-receptor in peripheral blood. CCR5 mRNA expression in the ectocervix was 10-fold greater than CXCR4, 20-fold greater than CCR2b, and 100-fold greater than CCR3. In peripheral blood, CXCR4 expression was 1.5-fold greater than CCR5, 10-fold greater than CCR2b, and 15-fold greater than CCR3. US28 was not expressed in cervical tissue despite expression in peripheral blood mononuclear cells from five individuals. CCR5 was significantly increased (p < 0.02) in biopsies from women with sexually transmitted diseases and others who were progesterone predominant. In vitrostudies demonstrate that progesterone increases CCR5, CXCR4, and CCR3 expression and decreases CCR2b expression in lymphocytes and monocytes/macrophages. Characterization of chemokine receptors at the tissue level provides important information in identifying host determinants of HIV-1 transmission. The susceptibility to sexual transmission of human immunodeficiency virus (HIV)-1 is extremely variable as infection by HIV-1 may occur after a single or a few exposures,1Stakewski S Schieck E Rehmet S Helm EB Stille W HIV transmission from a male after only two sexual contacts.Lancet. 1987; 2: 628-630Abstract Google Scholar or not at all, even after multiple high-risk exposures.2Liu R Paxton WA Choe S Ceridini D Martin SR Horuk R MacDonald ME Stuhlmann H Koup RA Landau NR Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply exposed individuals to HIV-1 infection.Cell. 1996; 86: 367-377Abstract Full Text Full Text PDF PubMed Scopus (2548) Google Scholar In addition, many studies have noted a gender imbalance for heterosexual HIV transmission that places women at greater risk for acquisition from infected male partners.3Padian NS Shiboski SC Jewell NP Female to male transmission of human immunodeficiency virus.JAMA. 1991; 266: 1664-1667Crossref PubMed Scopus (246) Google Scholar, 4Plummer FA Simonsen JN Cameron DW Ndinya-Achola JO Kreiss JK Gakinya MN Waiyaki P Cheang M Piot P Ronald AR Ngugi EN Cofactors in male-female sexual transmission of human immunodeficiency virus type 1.J Infect Dis. 1991; 163: 233-238Crossref PubMed Scopus (613) Google Scholar Aside from gender, other factors may increase susceptibility to HIV-1 infection. The most convincing factors associated with enhancing HIV-1 transmission are co-infection with sexually transmitted diseases (STDs) or genital ulcer disease (GUD). The synergy between STDs, GUD, and HIV-1 has been described from an epidemiological and behavioral perspective.5Laga M Diallo OM Buve Inter-relationship of sexually transmitted disease and HIV: where are we now?.AIDS. 1994; 8: S119-S124Google Scholar, 6Kreiss JK Coombs R Plummer FA Isolation of human immunodeficiency virus from genital ulcers in Nairobi prostitutes.J Infect Dis. 1986; 160: 380-384Crossref Scopus (185) Google Scholar The cellular mechanism by which STDs and GUD facilitate HIV-1 transmission, however, has not been well characterized. Similarly, the role of endogenous or exogenous hormonal influences in increasing or decreasing susceptibility to HIV infection has not been determined. STDs, GUD, and hormonal influences may increase the number of target cells present, increase immune activation, or increase expression of cell type-specific chemokine receptors, co-receptors that are necessary for HIV-1 infection.Specific variants of HIV-1, non-syncytium-inducing, macrophage-tropic isolates, have been postulated to be the major sexually transmitted variants.7Schuitemaker H Kootstra NA de Goede RE de Wolf F Miedema F Termette M Monocytotropic human immunodeficiency virus type 1 (HIV-1) variants detectable at all stages of HIV-1 infection lack T-cell line tropism and syncytium-inducing ability in primary T-cell culture.J Virol. 1986; 65: 356-363Google Scholar The second requirement for infection involves the expression of specific co-receptors on host cell types that express CD4.8Deng H Liu R Ellmeier W Choe S Unutmaz D Burhart M Dimarzio P Marmon S Sutton RE Hill CM Peiper SC Schall TJ Littman DR Landau NR Identification of a major coreceptor for primary isolates of HIV-1.Nature. 1996; 381: 661-667Crossref PubMed Scopus (3189) Google Scholar, 9Alkhatib G Combadiere C Broder CC Feng Y Kennedy PE Murphy PM Berger EA CC-CKR5: a RANTES, MIP-1α, MIP-1β receptor as a fusion cofactor for macrophage-tropic HIV-1.Science. 1996; 272: 1955-1958Crossref PubMed Scopus (2437) Google Scholar, 10Feng Y Broder CC Kennedy PE Berger EA HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G-protein-coupled receptor.Science. 1996; 272: 872-877Crossref PubMed Scopus (3621) Google Scholar, 11Heath H Qin S Rao P Wu L LaRosa G Kassem N Ponath PD Mackay CR Chemokine receptor usage by human eosinophils.J Clin Invest. 1997; 99: 178-184Crossref PubMed Scopus (435) Google Scholar, 12Doranz BJ Rucker J Yanjie Y Smyth RJ Samson M Peiper SC Parmentier M Collman RG Doms RW A dual-tropic primary HIV-1 isolate that uses fusin, and the β-chemokine receptors CKR-5: CKR-3, and CKR-2b as fusion cofactors.Cell. 1996; 85: 1149-1158Abstract Full Text Full Text PDF PubMed Scopus (1684) Google Scholar, 13Plekoff O Treboute C Brelot A Heveker N Seman M Alizon M Identification of a chemokine receptor encoded by human cytomegalovirus as a cofactor for HIV-1 entry.Science. 1997; 276: 1874-1878Crossref PubMed Scopus (286) Google Scholar The chemokine receptor CCR5 is the predominant receptor for macrophage-tropic isolates. It has previously been shown that the regulation of CCR5 expression is influenced by type 1 cytokine (eg, interleukin (IL)-2) activity and inflammatory responses in general. In addition, cells infiltrating inflammatory sites maintain the capacity to express other types of chemokine receptors (eg, CXCR4, CCR3, or CCR2b) that may serve as HIV co-receptors.Thus, susceptibility to sexual transmission of HIV-1 undoubtedly involves features associated with both the virus and the local state of immune activation. Because of the invasive procedures involved, studying the female genital tract mucosa has been difficult in humans. Animal studies involving macaques have yielded abundant information on the early events of simian immunodeficiency virus (SIV) transmission, including the elucidation of Langerhans' cells as the major infectable cell type immediately after inoculation.14Spira AI Marx PA Patterson BK Mahoney J Koup RA Wolinsky SM Ho DD Cellular targets of infection and route of viral dissemination after an intravaginal inoculation of simian immunodeficiency virus into rhesus macaques.J Exp Med. 1996; 183: 215-225Crossref PubMed Scopus (620) Google Scholar Studies in macaques have also shown that progesterone increases susceptibility to intravaginal SIV challenge by undetermined mechanisms.15Marx PA Spira AI Gettie A Dailey PJ Veazey RS Lackner AA Mahoney CJ Miller CJ Claypool LE Ho DD Alexander NJ Progesterone implants enhance SIV vaginal transmission and early virus load.Nat Med. 1996; 2: 1084-1089Crossref PubMed Scopus (403) Google Scholar Because infection with SIV may be mediated by receptors other than CCR5 and CXCR4,16Deng HK Unutmaz D KewalRamani VN Littman DR Expression cloning of new receptors used by simian and human immunodeficiency viruses.Nature. 1997; 388: 296-300Crossref PubMed Scopus (598) Google Scholar the purpose of this study was to examine factors influencing the expression and regulation of HIV-1 co-receptors in human tissue.Here, using immunological and extremely sensitive molecular methods, we report on the expression and localization of macrophage-tropic8Deng H Liu R Ellmeier W Choe S Unutmaz D Burhart M Dimarzio P Marmon S Sutton RE Hill CM Peiper SC Schall TJ Littman DR Landau NR Identification of a major coreceptor for primary isolates of HIV-1.Nature. 1996; 381: 661-667Crossref PubMed Scopus (3189) Google Scholar, 9Alkhatib G Combadiere C Broder CC Feng Y Kennedy PE Murphy PM Berger EA CC-CKR5: a RANTES, MIP-1α, MIP-1β receptor as a fusion cofactor for macrophage-tropic HIV-1.Science. 1996; 272: 1955-1958Crossref PubMed Scopus (2437) Google Scholar, 10Feng Y Broder CC Kennedy PE Berger EA HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G-protein-coupled receptor.Science. 1996; 272: 872-877Crossref PubMed Scopus (3621) Google Scholar (CCR5 and CCR3), dual-tropic11Heath H Qin S Rao P Wu L LaRosa G Kassem N Ponath PD Mackay CR Chemokine receptor usage by human eosinophils.J Clin Invest. 1997; 99: 178-184Crossref PubMed Scopus (435) Google Scholar, 12Doranz BJ Rucker J Yanjie Y Smyth RJ Samson M Peiper SC Parmentier M Collman RG Doms RW A dual-tropic primary HIV-1 isolate that uses fusin, and the β-chemokine receptors CKR-5: CKR-3, and CKR-2b as fusion cofactors.Cell. 1996; 85: 1149-1158Abstract Full Text Full Text PDF PubMed Scopus (1684) Google Scholar (CCR2b and US28), and T-cell-tropic13Plekoff O Treboute C Brelot A Heveker N Seman M Alizon M Identification of a chemokine receptor encoded by human cytomegalovirus as a cofactor for HIV-1 entry.Science. 1997; 276: 1874-1878Crossref PubMed Scopus (286) Google Scholar (CXCR4) HIV co-receptors in the female genital tract. Our findings show distinct patterns of chemokine receptor expression in the cervix compared with peripheral blood. The pattern of chemokine receptor expression in the cervix is influenced by infiltrates of cells expressing various chemokine receptors and microbial as well as hormonal factors that affect the local state of immune activation.Materials and MethodsPatientsPatients were enrolled in this study from the Northwestern Memorial Hospital Outpatient Clinic and the Prentice Women's Hospital Ambulatory Care Clinic. All women were in the preovulatory phase of their menstrual cycles at the time of biopsy, except one woman, who was postmenopausal. Informed consent was obtained from all patients. Cervical biopsies were obtained from the superior portion of the ectocervix using biopsy forceps. Peripheral blood (16 ml) was drawn in acid citrate dextrose tubes. Patients 1 to 4 and 6 were undergoing routine examinations, patients 5 and 8 to 12 were undergoing diagnostic procedures, and patient 7 was undergoing a hysterectomy. The clinical history of all patients in this study is shown in Table 1.Table 1Clinical History of Patients in the StudyPatientAgeHIV statusCD4 countReproductive statusHormonal exposureInflammatory conditions139NegativeNANonpregnantNoneNone223NegativeNANonpregnantNoneNone326NegativeNANonpregnantNoneNone448NegativeNANonpregnantNoneNone527NegativeNANonpregnantOCPGUD (Behcet's)652NegativeNAPostmenopausalNoneNone745NegativeNANonpregnantProg.None829Positive238NonpregnantNoneLGSIL, HPV928Positive533NonpregnantNoneLGSIL, HPV1026Positive15NonpregnantNoneHPV, HSV1126Positive230NonpregnantNoneHPV1235Positive181NonpregnantNoneHGSIL, HPVAbbreviations: NA, not applicable; OCP, oral contraceptives; Prog, progesterone; HGSIL, high-grade squamous intraepithelial lesion; LGSIL, low-grade squamous intraepithelial lesion; HSV, herpes simplex virus. Open table in a new tab Blood Processing and Cell CulturePeripheral blood mononuclear cells (PBMCs) from homozygous wild-type (wt) CCR5 volunteers were isolated on a Ficoll-Hypaque gradient. PBMCs (2 × 106 cells) were immediately placed in TriReagent (Molecular Research Center, Cincinnati, OH) for RNA extraction as per the manufacturer's protocol or cultured in RPMI 1640 supplemented with 2 mmol/L l-glutamine 10% fetal bovine serum, 10 mmol/L HEPES, and penicillin/streptomycin. PBMCs were incubated with 50 ng/ml progesterone (Sigma Chemical Co., St. Louis, MO) for up to 6 days.Tissue and Cell PreparationTissue samples from uterine ectocervix were trisected and either homogenized for RNA extraction, snap frozen in ornithine carbamoyltransferase embedding compound or fixed in Streck Tissue Fixative17Frumkin L Patterson BK Leverenz J Agy M Wolinsky S Morton W Corey L Infection of Macaca nemistrina brain with human immunodeficiency virus type 1.J Gen Virol. 1995; 76: 2467-2476Crossref PubMed Scopus (10) Google Scholar, 18Korber B Kunstman K Patterson BK Furtado M McEvilly M Levy R Wolinsky S HIV-1 sequence differences between blood and simultaneously obtained brain biopsy samples: conserved elements in the V3 region of the envelope protein of brain-derived sequences.J Virol. 1994; 68: 7467-7481PubMed Google Scholar, 19Koffron AJ Hummel M Patterson BK Yan S Kaufman DB Frye JP Stuart FP Abecassis MI Cellular localization of latent murine cytomegalovirus.J Virol. 1998; 72: 95-103PubMed Google Scholar (Streck Laboratories, Omaha, NE). RNA was extracted from biopsy specimens by homogenizing fresh biopsies of 5 mm3 in 500 μl TriReagent using diethyl pyrocarbonate-treated, autoclaved, disposable homogenizers. After homogenization, RNA was purified as per the manufacturer's protocol. RNA pellets were resuspended in 1× transcription buffer (Promega, Madison, WI) with 2 units RQ1 RNase-free DNase (Promega, Madison, WI) and incubated for 30 minutes at 37°C to remove contaminating DNA. The mixture was extracted once with phenol:chloroform:isoamyl alcohol and once with chloroform:isoamyl alcohol. The aqueous layer was removed, and the RNA was precipitated in 3 volumes ethanol and 1/40 volume 3 mol/L sodium acetate overnight at −20°C.Immunohistochemistry/Image AnalysisTissue sections were cut to 5 μm, adhered to silanized slides, and deparaffinized through xylenes and graded alcohols. After peroxidase quenching and blocking with mouse serum in phosphate-buffered saline, pH 7.4, with 5% nonfat dry skim milk, immunohistochemistry was performed using the Vectastain ABC-HP kit (Vector Laboratories, Burlingame, CA) as per the manufacturer's recommendations. Diaminobenzidine was used as substrate with hematoxylin counterstain. Frozen tissue sections for quantitative image analysis were allowed to air dry for 5 minutes, followed by postfixation in cold acetone for 20 minutes or 2% formaldehyde for 15 minutes. Sections were washed in phosphate-buffered saline, and an optimized dilution of primary antibody was applied. Cytokine and chemokine expression was quantified using assisted computerized image analysis as previously described.20Litton MJ Dohlsten M Hansson J Rosendahl A Ohlsson L Kalland T Andersson J Andersson U Tumor therapy with an antibody-targeted superantigen generates a dichotomy between local and systemic immune responses.Am J Pathol. 1997; 150: 1607-1618PubMed Google Scholar IL-2-producing cells were identified by a juxtanuclear focal staining pattern surrounded by extracellular immune reactivity caused by adherence of cytokines to matrix proteins. Commercially available antibodies to CD4, CD45RO, CD68, S-100, IL-2, IL-4, and IL-10 (PharMingen, San Diego, CA) were used at concentrations optimized on control tissues.Immunofluorescence/Flow CytometryAfter the appropriate incubation with progesterone, cells were pretreated with 0.5 mmol/L EDTA three times for 10 minutes each to remove adherent cells. Cells were washed three times with phosphate-buffered saline, pH 7.4/0.5% bovine serum albumin. Cells were then treated with 1 μg human immunoglobulin IgG/1 × 105 cells for 15 minutes at room temperature. Cells were stained with anti-CD4-fluorescein isothiocyanate or anti-CD14-fluorescein isothiocyanate (Becton Dickinson Immunochemistry Systems, San Jose, CA) and anti-CCR5-phycoerythrin or anti-CXCR4-phycoerythrin (PharMingen, San Diego, CA) for 30 minutes at room temperature, washed in phosphate-buffered saline, pH 7.4/0.5% bovine serum albumin, and fixed in 2% formaldehyde. Analysis was performed on a FACSCalibur flow cytometer using Cell Quest software.CCR5 GenotypingTotal DNA was prepared by adding 400 μl of cell lysis buffer/200 μg/ml proteinase K to 1 × 106 cells from peripheral blood. The mixture was incubated at 58°C for 2 hours followed by extraction in 25:24:1 phenol:chloroform:isoamyl alcohol. The aqueous layer was recovered, and DNA was precipitated by the addition of 3 volumes of ethanol and 1/40 volume sodium acetate. DNA polymerase chain reaction (PCR) was performed by adding 45 μl reaction mix (1× PCR buffer (PEG> Applied Biosystems, Foster City, CA), 4.0 mmol/L MgCl2, 200 μmol/L dATP, 200 μmol/L dCTP, 200 μmol/L dGTP, 200 μmol/L dTTP, 200 nmol/L upstream CCR5 primer (TGTTTGCGTCTCTCCCAGGA), and 200 nmol/L CCR5 downstream primer (TGAAGATAAGCCTCACAGCCCT)) to approximately 500 ng DNA. The amplified product was resolved on a 2% metephor gel (FMC Bioproducts, Rockland, ME).Chemokine Receptor mRNA QuantificationQuantitative kinetic reverse transcription-PCR was performed by adding 45 μl of reaction mix (1× RT Taqman EZ buffer (PE Applied Biosystems, Foster City, CA), 4.0 mmol/L Mn(O)Ac2, 300 μmol/L dATP, 300 μmol/L dCTP, 300 μmol/L dGTP, 300 μmol/L dTTP, 200 nmol/L upstream primer, 200 nmol/L downstream primer, 200 nmol/L internally conserved fluorogenic probes, and 10 units rTth polymerase) directly to 100 ng of total RNA in 5 μl RNase, DNase free water (Ambion, Austin, TX). Input RNA was normalized using glyceraldehyde-3-phosphate dehydrogenase mRNA quantification (PE Applied Biosystems). Reverse transcription and thermal amplification were performed using the following linked profile: reverse transcription, 30 minutes at 60°C; cDNA denaturation, 5 minutes at 95°C; 40 cycles of denaturation (95°C for 15 seconds); and annealing/extension (60°C for 1 minute) in a 7700 sequence detection system (PE Applied Biosystems). Duplicate standard curves with copy number controls ranging from 10 to 105 copies were run with each optical 96-well plate (PE Applied Biosystems). In addition, no template controls were included with each plate. We assessed the efficiency of amplification and the linearity of the assay by plotting the threshold cycle number, the cycle number at which the fluorescence signal exceeds background,versus the log target copy number (Figure 1). To exclude potential signal due to plasmid DNA in the copy number standards, or to genomic DNA in the patient samples, we performed duplicate experiments with Taqpolymerase rather than rTth polymerase. These experiments revealed a lack of amplification signal due to contaminating chemokine receptor DNA (data not shown). Amplification of heterologous transcripts or squamous cell RNA known to be negative for chemokine receptors revealed a lack of amplification signal. Amplification of RNA from a homozygous Δ32 CCR5 individual also revealed a lack of wt CCR5 amplification signal.Primers and ProbesThe primers and their respective probes used were as follows: wt CCR5, 5′-TGTTTGCGTCTCTCCCAGGA-3′ and 5′-TGAAGATAAGCCTCACAGCCCT-3′ (probe, 5′-FAM-CAGTCAGTATCAATTCTGGAAGAATTTCCAGACAT-TAMRA-3′); CXCR4, 5′-TATGACTCCATGAAGGAACCCTGT-3′ and 5′-AGCCTGTACTTGTCCGTCATGC-3′ (probe, 5′-FAM-TCC TGCCCACCATCTACTCCATCATC-TAMRA-3′); CCR3, 5′-AAAGCTGATACCAGAGCACTGATGG-3′ and 5′-GTTGGTCATAATTCGGAGCCTCC-3′ (probe, 5′-FAM-TTCACTGTGGGCCTCTTGGGCAAT-TAMRA-3′); CCR2b, 5′-CCTGTAAAGCAGGTGCCCAA-3′ and 5′-AGAGTCAAAGTCTCTACCCACAGTTTTT-3′ (probe, 5′-FAM-CCAATGCATATCCAACATGTGCTCAG-TAMRA-3′); US28, 5′-GACTCCCTGTGTCCTCACCG-3′ and 5′-CCAAGAAGTTGCCGATGGAA-3′ (probe, 5′-FAM-ACGTTGTTTCTGTACGGCGTTGTCTTTC-TAMRA-3′); IL-2, 5′-CCACAATATGCTATTCACATGTTCAGT-3′ and 5′-CAATTAACGCCTTCTGTATGAAACAG-3′ (probe, 5′-FAM-TTTCTGAGTTACTTTTGTATCCCCACCC-TAMRA-3′); IL-4, 5′-CTGTTCCCTGTGAGCTGCCT-3′ and 5′-GTATAGTTATCCGCACTGACCACG-3′ (probe, 5′-FAM-AGCTGGTTTTTCTGCTCTCCGAAGCC-TAMRA-3′); and IL-10, 5′-CCCAAGTATAGCTGAACCTTCCAA-3′ and 5′-TGTGGATGCCTGCTGTGTG-3′ (probe, 5′- FAM-CACGTAGGGTTGCAGGTTTCCTAGTGAG-TAMRA-3′).Statistical AnalysisComparisons between samples were performed using the Student'st-test. Comparisons yielding a P < 0.05 were considered significant.ResultsQuantification of the Chemokine Receptor Repertoire in Cervical Biopsies and Peripheral BloodTo quantify the expression of chemokine receptor mRNA in peripheral blood and biopsies from the female genital tract, we extracted and purified RNA and DNA from 12 women. Seven HIV-seronegative and five HIV-seropositive women with or without STDs, GUD, and progesterone predominance were evaluated using these techniques (Table 1). To control for variable levels of wt and Δ32 CCR5 allelic expression in heterozygotes relative to homozygous wt individuals (manuscript in preparation), we selected women with a homozygous wt CCR5 genotype. Using 10,000 copies of glyceraldehyde-3-phosphate dehydrogenase mRNA (∼100 cells) in each replicate, at least duplicate determinations of chemokine receptor mRNA levels were performed (Table 2). The level of CCR5 mRNA in the cervix was significantly greater than CXCR4, CCR3, CCR2b, and US28 (P < 0.001) regardless of the clinical state of the patient (Table 2, Figure 2). Levels of CCR5 mRNA in biopsies with increased inflammation (Table 2, patients 5 to 12) were significantly increased compared with levels in biopsies without increased inflammation (Table 2, patients 1 to 4) (P < 0.02). Levels of CCR5 were also increased in biopsies from progesterone-predominant women (Table 2, patients 6 and 7) relative to premenopausal, exogenous progesterone-naïve women (Table 2, patients 1 to 4). Immunohistochemistry using monoclonal antibodies was performed to localize and quantify CXCR4 and CCR5 protein-expressing cells and to confirm the relative expression levels of CXCR4 and CCR5 determined by quantitative reverse transcription-PCR (Figure 3). We found an 8-fold greater CCR5 protein expression level compared with CXCR4 (P< 0.02). The 8-fold difference in protein expression approximates the 10-fold difference in mRNA expression. Double-label immunofluorescence staining revealed that all cells expressing CCR5 or CXCR4 co-expressed CD4 in the biopsies studied (Figure 4).Table 2Quantification of Chemokine Receptor mRNA in Blood and Cervical BiopsiesCCR5 mRNA*Number of copies per 10,000 glyceraldehyde-3-phosphate dehydrogenase RNA copies.CXCR4 mRNA*Number of copies per 10,000 glyceraldehyde-3-phosphate dehydrogenase RNA copies.CCR3 mRNA*Number of copies per 10,000 glyceraldehyde-3-phosphate dehydrogenase RNA copies.CCR2b mRNA*Number of copies per 10,000 glyceraldehyde-3-phosphate dehydrogenase RNA copies.US28*Number of copies per 10,000 glyceraldehyde-3-phosphate dehydrogenase RNA copies.PatientCXPBLsCXPBLsCXPBLsCXPBLsCXPBLs191 ± 1189 ± 4<10744 ± 71Negative52 ± 12<10<10NegativeNegative294 ± 21104 ± 20442 ± 5368 ± 19Negative15 ± 6<10113 ± 13Negative<103292 ± 43133 ± 28278 ± 17674 ± 33<1067 ± 836 ± 1336 ± 82NegativeNegative4209 ± 1577 ± 1360 ± 9914 ± 55<10<1048 ± 1952 ± 7Negative1832 ± 1775123 ± 17112 ± 10<10964 ± 44Negative25 ± 2<1076 ± 33NegativeNegative6441 ± 43860 ± 3855 ± 81860 ± 124Negative23 ± 11<1095 ± 20Negative2997 ± 2917678 ± 211144 ± 3627 ± 81287 ± 41Negative116 ± 2818 ± 7184 ± 33NegativeNegative8704 ± 823717 ± 3086 ± 27865 ± 92Negative80 ± 22<1064 ± 16Negative822 ± 1199922 ± 711409 ± 54<10421 ± 12<10348 ± 41100 ± 37529 ± 111NegativeNegative10642 ± 27706 ± 48<10655 ± 14926± 1172 ± 1751 ± 21266 ± 14NegativeNegative111216 ± 16785 ± 614 ± 61232 ± 211Negative<10<1012 ± 3NegativeNegative121176 ± 114106 ± 21153 ± 315531 ± 249<10<1017 ± 3<10Negative<10CX, cervix; PBLs, peripheral blood lymphocytes.* Number of copies per 10,000 glyceraldehyde-3-phosphate dehydrogenase RNA copies. Open table in a new tab Figure 2Comparison of chemokine receptor expression in PBMCs and uterine cervix. CCR5 mRNA expression in the cervix was 10-fold greater than CXCR4, 20-fold greater than CCR2b, and 100-fold greater than CCR3. In PBMCs, CXCR4 expression was 1.5-fold greater than CCR5, 10-fold greater than CCR2b, and 15-fold greater than CCR3. US28 was not expressed in any of the cervical biopsies despite expression in PBMCs from five individuals.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 3Digital microscopic images of chemokine receptor expression in an immunohistochemically stained cervical biopsy from HIV-1-seropositive patient 12 (Table 1, Table 2). Chemokine receptor-expressing cells appear brown (arrows) in sections counterstained with hematoxylin (blue). A:CCR5-expressing cells are clustered beneath the surface epithelium.B: CXCR4-expressing cells from the same biopsy have a similar localization as the CCR5-expressing cells. Increased numbers of CCR5-expressing cells were found compared with CXCR4-expressing cells. Magnification, ×350.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 4Localization of cells co-expressing CD4 and CCR5 (yellow) using double-label immunofluorescence and laser confocal image analysis (patient 6). Cells expressing only CD4 appeared red (arrowheads), and cells expressing only CCR5 were not identified. The epithelium-submucosa junction is denoted by arrows.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The levels of CXCR4, CCR3, CCR2b, and US28 were significantly elevated in blood (P < 0.001) relative to the cervix when the whole study population was assessed, whereas the level of CCR5 in peripheral blood was not significantly elevated relative to the cervix (Table 2, Figure 2). The difference between the level of CXCR4 and the level of CCR5 in peripheral blood was not statistically significant.Quantification of Immune Cells in the Cervical MucosaIncreases in chemokine receptor expression in a particular tissue can be attributed to an increase in the number of cells expressing a particular chemokine receptor, up-regulation of chemokine receptors in cells present in a particular tissue, or both. To determine whether increases in the number of cells known to express specific chemokine receptors contributed to the repertoire of chemokine receptor expression, we characterized the immune cells present in the ectocervix of women with normal, proinflammatory, and progesterone-predominant conditions.Using immunohistochemistry and assisted computerized image analysis,20Litton MJ Dohlsten M Hansson J Rosendahl A Ohlsson L Kalland T Andersson J Andersson U Tumor therapy with an antibody-targeted superantigen generates a dichotomy between local and systemic immune responses.Am J Pathol. 1997; 150: 1607-1618PubMed Google Scholar we quantified the number of cells known to express CCR5 (CD4+ and CD45RO+ T cells, CD68+ macrophages, and S-100+ Langerhans' cells), CXCR4 (CD4+ and CD45RA+ T cells and CD68+ macrophages), CCR3 (CD4+ T cells, CD68+ macrophages, eosinophils, and basophils), CCR2b (CD68+ macrophages, natural killer cells), or US28 (CD4+ T cells and monocytes/macrophages) (Table 3). Langerhans' cells, macrophages, and lymphocytes were evenly distributed in low quantities throughout the submucosa in four healthy controls such as patient 1 (Table 3, Figure 5) and were rarely found in the epithelium. Dramatic yet heterogeneous increases in cellular infiltrates were seen in biopsies from women with GUD, progesterone predominance, or genital tract infec" @default.
• W14052271 created "2016-06-24" @default.
• W14052271 creator A5016102389 @default.
• W14052271 creator A5018768648 @default.
• W14052271 creator A5021280151 @default.
• W14052271 creator A5041742651 @default.
• W14052271 creator A5051523894 @default.
• W14052271 creator A5056576224 @default.
• W14052271 creator A5071859420 @default.
• W14052271 creator A5073504893 @default.
• W14052271 creator A5083030966 @default.
• W14052271 creator A5086888539 @default.
• W14052271 date "1998-08-01" @default.
• W14052271 modified "2023-10-11" @default.
• W14052271 title "Repertoire of Chemokine Receptor Expression in the Female Genital Tract" @default.
• W14052271 cites W146739493 @default.
• W14052271 cites W1539529772 @default.
• W14052271 cites W1642524132 @default.
• W14052271 cites W1915828783 @default.
• W14052271 cites W1938763205 @default.
• W14052271 cites W1967020365 @default.
• W14052271 cites W1981440980 @default.
• W14052271 cites W1981621474 @default.
• W14052271 cites W1983466424 @default.
• W14052271 cites W1989035987 @default.
• W14052271 cites W1996183144 @default.
• W14052271 cites W1997893449 @default.
• W14052271 cites W2032918869 @default.
• W14052271 cites W2047798559 @default.
• W14052271 cites W2052392655 @default.
• W14052271 cites W2055613276 @default.
• W14052271 cites W2060088029 @default.
• W14052271 cites W2060903877 @default.
• W14052271 cites W2085114777 @default.
• W14052271 cites W2090630729 @default.
• W14052271 cites W2093168828 @default.
• W14052271 cites W2116720206 @default.
• W14052271 cites W2125650988 @default.
• W14052271 cites W2130635171 @default.
• W14052271 cites W2131055683 @default.
• W14052271 cites W2131376910 @default.
• W14052271 cites W2147777424 @default.
• W14052271 cites W2156117117 @default.
• W14052271 cites W2186801777 @default.
• W14052271 cites W2466949530 @default.
• W14052271 cites W81572170 @default.
• W14052271 doi "https://doi.org/10.1016/s0002-9440(10)65591-5" @default.
• W14052271 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1852974" @default.
• W14052271 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9708808" @default.
• W14052271 hasPublicationYear "1998" @default.
• W14052271 type Work @default.
• W14052271 sameAs 14052271 @default.
• W14052271 citedByCount "196" @default.
• W14052271 countsByYear W140522712012 @default.
• W14052271 countsByYear W140522712013 @default.
• W14052271 countsByYear W140522712014 @default.
• W14052271 countsByYear W140522712015 @default.
• W14052271 countsByYear W140522712016 @default.
• W14052271 countsByYear W140522712017 @default.
• W14052271 countsByYear W140522712018 @default.
• W14052271 countsByYear W140522712019 @default.
• W14052271 countsByYear W140522712021 @default.
• W14052271 countsByYear W140522712022 @default.
• W14052271 countsByYear W140522712023 @default.
• W14052271 crossrefType "journal-article" @default.
• W14052271 hasAuthorship W14052271A5016102389 @default.
• W14052271 hasAuthorship W14052271A5018768648 @default.
• W14052271 hasAuthorship W14052271A5021280151 @default.
• W14052271 hasAuthorship W14052271A5041742651 @default.
• W14052271 hasAuthorship W14052271A5051523894 @default.
• W14052271 hasAuthorship W14052271A5056576224 @default.
• W14052271 hasAuthorship W14052271A5071859420 @default.
• W14052271 hasAuthorship W14052271A5073504893 @default.
• W14052271 hasAuthorship W14052271A5083030966 @default.
• W14052271 hasAuthorship W14052271A5086888539 @default.
• W14052271 hasBestOaLocation W140522712 @default.
• W14052271 hasConcept C121332964 @default.
• W14052271 hasConcept C12823836 @default.
• W14052271 hasConcept C13373296 @default.
• W14052271 hasConcept C142724271 @default.
• W14052271 hasConcept C186382791 @default.
• W14052271 hasConcept C203014093 @default.
• W14052271 hasConcept C24890656 @default.
• W14052271 hasConcept C2776914184 @default.
• W14052271 hasConcept C2778473898 @default.
• W14052271 hasConcept C29456083 @default.
• W14052271 hasConcept C3018711458 @default.
• W14052271 hasConcept C70721500 @default.
• W14052271 hasConcept C71924100 @default.
• W14052271 hasConcept C86803240 @default.
• W14052271 hasConceptScore W14052271C121332964 @default.
• W14052271 hasConceptScore W14052271C12823836 @default.
• W14052271 hasConceptScore W14052271C13373296 @default.
• W14052271 hasConceptScore W14052271C142724271 @default.
• W14052271 hasConceptScore W14052271C186382791 @default.
• W14052271 hasConceptScore W14052271C203014093 @default.
• W14052271 hasConceptScore W14052271C24890656 @default.
• W14052271 hasConceptScore W14052271C2776914184 @default.

• next