FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1488753522> ?p ?o ?g. }

• W1488753522 endingPage "29254" @default.
• W1488753522 startingPage "29245" @default.
• W1488753522 abstract "Like true DNA replicases, herpes simplex virus type 1 DNA polymerase is equipped with a proofreading 3′-5′-exonuclease. In order to assess the functional significance of conserved residues in the putative exonuclease domain, we introduced point mutations as well as deletions within and near the conserved motifs' exonuclease (Exo) I, II, and III of the DNA polymerase gene from a phosphonoacetic acid-resistant derivative of herpes simplex virus-1 strain ANG. We examined the catalytic activities of the partially purified enzymes after overexpression by recombinant baculovirus. Mutations of the motifs' Exo I (D368A, E370A) and Exo III (Y577F, D581A) yielded enzymes without detectable and severely impaired 3′-5′-exonuclease activities, respectively. Except for the Exo I mutations, all other Exo mutations examined affected both exonuclease and polymerization activities. Mutant enzymes D368A, E370A, Y557S, and D581A showed a significant ability to extend mispaired primer termini. Mutation Y557S resulted in a strong reduction of the 3′-5′-exonuclease activity and in a polymerase activity that was hyperresistant to phosphonoacetic acid. The results of the mutational analysis provide evidence for a tight linkage of polymerase and 3′-5′-exonuclease activity in the herpesviral enzyme. Like true DNA replicases, herpes simplex virus type 1 DNA polymerase is equipped with a proofreading 3′-5′-exonuclease. In order to assess the functional significance of conserved residues in the putative exonuclease domain, we introduced point mutations as well as deletions within and near the conserved motifs' exonuclease (Exo) I, II, and III of the DNA polymerase gene from a phosphonoacetic acid-resistant derivative of herpes simplex virus-1 strain ANG. We examined the catalytic activities of the partially purified enzymes after overexpression by recombinant baculovirus. Mutations of the motifs' Exo I (D368A, E370A) and Exo III (Y577F, D581A) yielded enzymes without detectable and severely impaired 3′-5′-exonuclease activities, respectively. Except for the Exo I mutations, all other Exo mutations examined affected both exonuclease and polymerization activities. Mutant enzymes D368A, E370A, Y557S, and D581A showed a significant ability to extend mispaired primer termini. Mutation Y557S resulted in a strong reduction of the 3′-5′-exonuclease activity and in a polymerase activity that was hyperresistant to phosphonoacetic acid. The results of the mutational analysis provide evidence for a tight linkage of polymerase and 3′-5′-exonuclease activity in the herpesviral enzyme. In view of the evolutionary preservation of fundamental mechanisms of DNA replication among prokaryotic and eukaryotic DNA polymerases (for a review, see Refs. 1So A.G. Downey K.M. Crit. Rev. Biochem. Mol. Biol. 1992; 27: 129-155Google Scholar, 2Joyce J.M. Steitz T.A. Annu. Rev. Biochem. 1994; 63: 777-822Google Scholar), the herpes simplex virus DNA polymerase of type 1 (HSV Pol) 1The abbreviations used are: HSV PolHSV DNA polymeraseAcMNPVA. californica multiply enveloped nuclear polyhedrosis virusBEVSbaculovirus expression vector systemExo3′-5′-exonucleaseHSVherpes simplex virus type 1LORFlarge open reading framem.o.i.multiplicity of infectionPAAphosphonoacetic acidPOLrecombinant HSV PolPol IEscherichia coli DNA polymerase I. is an attractive model enzyme for studies of structural and functional organization of eukaryotic DNA polymerases (3Challberg M.D. Kelly T.J. Annu. Rev. Biochem. 1989; 58: 671-718Google Scholar). Like true DNA replicases, HSV Pol has an associated 3′-5′-exonuclease that functions as proofreading activity (4Weissbach A. Hong S.-C.L. Aucker J. Muller R. J. Biol. Chem. 1973; 248: 6270-6277Google Scholar, 5Knopf K.W. Eur. J. Biochem. 1979; 98: 231-244Google Scholar, 6O'Donnell M.E. Elias P. Lehman I.R. J. Biol. Chem. 1987; 262: 4252-4259Google Scholar). HSV Pol belongs to the family of α-like DNA polymerases (7Blanco L. Bernad A. Salas M. Gene (Amst.). 1992; 112: 139-144Google Scholar). It has been shown to be more closely related to DNA polymerase δ (8Boulet A. Simon M. Faye G. Bauer G.A. Burgers P.M.J. EMBO J. 1989; 8: 1849-1854Google Scholar, 9Knopf K.W. Strick R. Becker Y. Darai G. Frontiers of Virology. Vol. 3. Springer-Verlag, Berlin1994: 87-135Google Scholar), which is the most conserved eukaryotic replicative DNA polymerase (10Cullmann G. Hindges R. Berchtold M.W. Hübscher U. Gene (Amst.). 1993; 134: 191-200Google Scholar), suggesting that the viral enzyme derives from an ancestor of the latter polymerase. Like this major DNA replicase (1So A.G. Downey K.M. Crit. Rev. Biochem. Mol. Biol. 1992; 27: 129-155Google Scholar), HSV Pol forms a heterodimeric complex with an auxiliary protein, the phosphorylated 65-kDa double-stranded DNA binding protein encoded by the ul42 gene (ul42 protein) (11Crute J.J. Lehman I.R. J. Biol. Chem. 1989; 264: 19266-19270Google Scholar). The ul42 protein increases the DNA polymerase processivity by its interaction with the C terminus of HSV Pol and is essential for virus replication (12Gallo M.L. Dorsky D.I. Crumpacker C.S. Parris D.S. J. Virol. 1989; 63: 5023-5029Google Scholar, 13Gottlieb J. Marcy A.I. Coen D.M. Challberg M.D. J. Virol. 1990; 64: 5976-5987Google Scholar, 14Hernandez T.R. Lehman I.R. J. Biol. Chem. 1990; 265: 11227-11232Google Scholar, 15Digard P. Chow C.S. Pirrit L. Coen D.M. J. Virol. 1993; 67: 1159-1168Google Scholar). The 136-kDa core subunit provides the polymerase and proofreading function (6O'Donnell M.E. Elias P. Lehman I.R. J. Biol. Chem. 1987; 262: 4252-4259Google Scholar, 11Crute J.J. Lehman I.R. J. Biol. Chem. 1989; 264: 19266-19270Google Scholar, 16Weisshart K. Knopf C.W. Eur. J. Biochem. 1988; 174: 707-716Google Scholar). The close relationship between HSV Pol and DNA polymerase δ is further documented by the identical response to common replication inhibitors (9Knopf K.W. Strick R. Becker Y. Darai G. Frontiers of Virology. Vol. 3. Springer-Verlag, Berlin1994: 87-135Google Scholar, 17Downey K.M. Tan C.-K. So A.G. BioEssays. 1990; 12: 231-236Google Scholar). HSV DNA polymerase A. californica multiply enveloped nuclear polyhedrosis virus baculovirus expression vector system 3′-5′-exonuclease herpes simplex virus type 1 large open reading frame multiplicity of infection phosphonoacetic acid recombinant HSV Pol Escherichia coli DNA polymerase I. Three-dimensional structural studies, together with site-directed mutagenesis and biochemical analyses, have led to the identification of the catalytic residues responsible for polymerization and 3′-5′-exonucleolytic activity of the Klenow fragment of Escherichia coli Pol I (for a review, see Ref. 2Joyce J.M. Steitz T.A. Annu. Rev. Biochem. 1994; 63: 777-822Google Scholar). Corresponding amino acids involved in metal binding and catalysis (Asp-355, Glu-357, Asp-424, Asp-501, Tyr-497) of the Pol I 3′-5′-exonuclease activity were first identified by sequence similarities and site-directed mutagenesis using the ϕ29 DNA polymerase (18Bernad A. Blanco L. Lázaro J.M. Martin G. Salas M. Cell. 1989; 59: 219-228Google Scholar), and subsequently three sequence motifs (Exo I, Exo II, and Exo III) containing the Pol I homologous residues were proposed to be important for the 3′-5′-exonuclease function in prokaryotic and eukaryotic DNA polymerases. Despite the low overall homology between Pol I- and α-like DNA polymerases, the Exo motifs with correspondingly arranged conserved residues were found in herpesviral and δ-polymerases (7Blanco L. Bernad A. Salas M. Gene (Amst.). 1992; 112: 139-144Google Scholar, 8Boulet A. Simon M. Faye G. Bauer G.A. Burgers P.M.J. EMBO J. 1989; 8: 1849-1854Google Scholar, 9Knopf K.W. Strick R. Becker Y. Darai G. Frontiers of Virology. Vol. 3. Springer-Verlag, Berlin1994: 87-135Google Scholar). Thus far, within the exonuclease domain of eukaryotic DNA polymerases, no homologs have been identified for the Pol I residues Leu-361 and Phe-473 which are predicted to be critical for the base positioning (19Derbyshire V. Freemont P.S. Sanderson M.R. Beese L.S. Friedman J.M. Joyce C.M. Steitz T.A. Science. 1988; 240: 199-201Google Scholar, 20Derbyshire V. Grindley N.D.F. Joyce C.M. EMBO J. 1991; 10: 17-24Google Scholar). From site-directed mutagenesis studies of the exonuclease domain with different prokaryotic (18Bernad A. Blanco L. Lázaro J.M. Martin G. Salas M. Cell. 1989; 59: 219-228Google Scholar, 20Derbyshire V. Grindley N.D.F. Joyce C.M. EMBO J. 1991; 10: 17-24Google Scholar, 21Soengas M.S. Esteban J.A. Lázaro J.M. Bernad A. Blasco M.A. Salas M. Blanco L. EMBO J. 1992; 11: 4227-4237Google Scholar, 22Mullen G.P. Serpersu E.H. Ferrin L.J. Loeb L.A. Mildvan A.S. J. Biol. Chem. 1990; 265: 14327-14334Google Scholar, 23Barnes M.H. Hammond R.A. Kennedy C.C. Mack S.L. Brown N.C. Gene (Amst.). 1992; 111: 43-49Google Scholar, 24Reha-Krantz L.J. Stocki S. Nonay R.L. Dimayuga E. Goodrich L.D. Konigsberg W.H. Spicer E.K. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 2417-2421Google Scholar, 25Patel S.S. Wong I. Johnson K.A. Biochemistry. 1991; 30: 511-525Google Scholar) and eukaryotic DNA polymerases (26Simon M. Giot L. Faye G. EMBO J. 1991; 10: 2165-2170Google Scholar, 27Morrison A. Bell J.B. Kunkel T.A. Sugino A. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9473-9477Google Scholar), it is evident that the putative exonuclease domain embodies the proofreading function (for a review, see Ref. 7Blanco L. Bernad A. Salas M. Gene (Amst.). 1992; 112: 139-144Google Scholar). This function seems to be organized in a quite separate domain in prokaryotic enzymes and in yeast, since exonuclease-minus mutants are readily obtained that display fully functioning polymerase activity. In addition, the structural and functional independence of these two domains in Klenow fragment was demonstrated by the ability of the polymerase domain to retain activity when cloned separately (28Freemont P.S. Ollis D.L. Steitz T.A. Joyce C.M. Proteins Struct. Funct. Genet. 1986; 1: 66-73Google Scholar) and by antibody neutralization studies (29Ruscitti T. Polayes D.A. Karu A.E. Linn S. J. Biol. Chem. 1992; 267: 16806-16811Google Scholar). In the case of HSV Pol, mutational studies (30Gibbs J.S. Weisshart K. Digard P. De Bruyn-Kops A. Knipe D.M. Coen D.M. Mol. Cell. Biol. 1991; 11: 4786-4795Google Scholar) as well as investigations carried out by limited proteolysis of HSV Pol (31Weisshart K. Kuo A.A. Hwang C.B.C. Kumura K. Coen D.M. J. Biol. Chem. 1994; 269: 22788-22796Google Scholar) provided no evidence for a similar structural independence of 3′-5′-exonuclease and polymerase domains. In order to demonstrate the possible structural and functional interrelationship of exonuclease and polymerase domains of HSV Pol more directly, in this report we have chosen to mutate directly the putative catalytic residues of the conserved motifs' Exo I, II, and III of the exonuclease domain and to examine functionally the consequences of the mutations on the enzymatic activities using recombinant baculovirus technology. The results show that in vitro it is possible to generate HSV Pol enzymes with active polymerase but with no or weak exonuclease activity by mutating the proposed catalytic residues, suggesting a functional independence for the polymerase activity. On the other hand, defined mutations in the exonuclease domain also had a strong impact on the polymerizing function of the enzyme, providing evidence for the involvement of exonuclease domain residues in essential functions of the polymerase forward reaction. Radiochemicals were obtained from Amersham Life Sciences (Braunschweig). Nucleotides were purchased from Pharmacia LKB (Freiburg). Activated calf thymus DNA was from Sigma and Aldrich (Deisenhofen). Oligonucleotides were synthesized using an Expedite Nucleic Acid synthesizer (Millipore, Eschborn), kindly provided by W. Weinig (Deutsches Krebsforschungszentrum, Heidelberg), and purified with the USB SurePure™ Oligonucleotide Purification Kit (Amersham Life Sciences, Braunschweig). Mutagenic oligonucleotides used are presented in Table I. Oligonucleotides spanning nucleotide position 1327-1346, 1845-1831, and 1905-1919, respectively, of the HSV Pol sequence of strain ANG (32Knopf C.W. Nucleic Acids Res. 1986; 14: 8225-8226Google Scholar) were used as sequencing primers. Restriction enzymes were purchased from Boehringer Mannheim, USB (Cleveland, OH), Life Technologies, Inc. (Eggenstein), and Stratagene (Heidelberg) and used as guidelined by the manufacturers. Random primed DNA labeling kit was obtained from Boehringer Mannheim. Phosphonoacetic acid (PAA) was purchased from Sigma (Deisenhofen).Table I.Sequences of mutagenic oligonucleotidesMutationOligonucleotides (5′-3′)aIntended mutations are represented by double underlining, and silent changes to delete restriction sites are indicated by single underlining.New restriction siteD368 to AATGTGCTTCGCTATCGAGTGCAAGGCGLoss of EcoRV and BsmIE370 to AATGTGCTTCGATATCGCATGCAAGGCGGGSphI, loss of BsmID471 to ACAACTTCGCCTGGCCCLoss of BsrIY538 to SGCTGTCGAGCTCCAAGCTCAACGCCGSstI, loss of XhoIY 557 to SAGAAGGACCTGAGCTCGCGCGACATCCSstI, loss of NruIY577 to FATCGGCGAGTTCTGCATACAGGLoss of ScaID581 to AACTGCATACAGGCTTCCCTGCTGGLoss of TfiIa Intended mutations are represented by double underlining, and silent changes to delete restriction sites are indicated by single underlining. Open table in a new tab Buffer A, used during HSV Pol purification, contained 25 mM sodium phosphate, pH 7.2, 200 mM NaCl, 0.5 mM EDTA, 2 mM 2-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, 10 μM leupeptin, and 1 μM pepstatin. Buffer B was the same as buffer A with 0.6 M NaCl. Enzyme storage buffer consisted of 20 mM Hepes/KOH, pH 7.5, 1 mM EDTA, 1 mM dithiothreitol, 40% (v/v) ethyleneglycol. TE buffer (Tris-EDTA) contained 10 mM Tris-Cl, pH 8, 1 mM EDTA. African green monkey kidney monolayer cells (Rita clone, RC-37, Italdiagnostic Products, Rome) were cultivated and infected with HSV strain ANG as described previously (16Weisshart K. Knopf C.W. Eur. J. Biochem. 1988; 174: 707-716Google Scholar). Baculovirus expression vector system (BEVS) comprising Autographa californica multiply enveloped nuclear polyhedrosis virus (AcMNPV), baculovirus transfer vectors pVL1392 and pVL1393, as well as the Sf9 cell line (Spodoptera frugiperda IPLB-Sf21AE) was obtained from Max D. Summers and Gale E. Smith (Texas Agricultural Experiment Station, TX). Recombinant baculovirus POL and the corresponding pVL1393 transfer vector (pPOL) containing the large open reading frame (LORF) of a PAA-resistant (PAAr) variant of HSV-1 strain ANG (33Knopf C.W. J. Gen. Virol. 1987; 68: 1429-1433Google Scholar) from nucleotide position 326 to 4194 (32Knopf C.W. Nucleic Acids Res. 1986; 14: 8225-8226Google Scholar) were constructed following the BEVS protocol (34Summers M.D. Smith G.E. Tex. Agric. Exp. Stn. Bull. 1987; 1555Google Scholar, 35Bayer S. Expression der HSV-1 ANG DNA-Polymerase in Insektenzellen und im zellfreien System..diploma thesis, University of Heidelberg. 1990; Google Scholar, 36Strick R. Struktur- und Funktionsanalyse der Herpes Simplex-Virus DNA-Polymerase: Die Enzymefunktionen..doctoral thesis, University of Heidelberg. 1993; Google Scholar). For cloning of HSV Pol LORF subclones of the ClaI fragment h containing pH1381 (37Knopf K.W. Die Herpes Simplex-Virus DNA-Polymerase: Vom Gen zur Function. University of Heidelberg, 1988Google Scholar) were used. In separate cloning steps a BamI linker was inserted at nucleotide position 325 by Bal31 nuclease deletion cloning, and at position 4194 an XbaI linker was introduced by filling-in reaction of the Asp718 site (37Knopf K.W. Die Herpes Simplex-Virus DNA-Polymerase: Vom Gen zur Function. University of Heidelberg, 1988Google Scholar). The HSV Pol LORF could thus be transferred as a BamHI/XbaI DNA fragment to pVL1393. Recombinant pUC-8 clone pS5 was a subclone of pH1381 and contained the SalI fragment from nucleotide position 1229-3260 of the PAAr HSV Pol gene. SalI fragment from pS5 was cloned in phagemid vector pMa (38Stanssens P. Opsomer C. McKeown Y.M. Kramer W. Zabeau M. Fritz H.J. Nucleic Acids Res. 1989; 17: 4441-4454Google Scholar) yielding pMaS5, and its single-stranded DNA was subjected to standard site-directed mutagenesis procedure (39Kunkel T.A. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 488-492Google Scholar) using the U-DNA mutagenesis kit as instructed by the manufacturer (Boehringer Mannheim) together with the mutagenic oligonucleotides listed in Table I. Oligonucleotides were designed in order to generate restriction enzyme site polymorphisms allowing screening of mutant genes by DNA restriction endonuclease mapping. All of the mutations were confirmed by DNA sequence analysis, performing as described in the guidelines of the T7 sequencing kit (Pharmacia Biotech, Freiburg). Characterized NheI/SstI or NheI/MstII DNA subfragments of phagemid vector pMaS5 with the desired 3′-5′-exonuclease mutations were individually used to replace the corresponding fragments in recombinant baculovirus transfer vector pPOL. The presence of introduced mutations was confirmed by restriction endonuclease mapping. For generation of recombinant baculoviruses, transfer vector derivatives of pPOL containing the mutated genes as stated were individually cotransfected in Sf9 cells with modified linearized AcMNPV baculovirus DNA (BaculoGold™ DNA) following the protocol of BaculoGold™ Transfection Kit (Pharmingen, San Diego). Recombinant plaques were screened by negative β-galactosidase expression (40King L.A. Possee R.D. The Baculovirus Expression System: A Laboratory Guide. Chapman and Hall, New York1992Google Scholar), and high titer virus stock solutions were prepared after three cycles of plaque purification according to standard procedures (34Summers M.D. Smith G.E. Tex. Agric. Exp. Stn. Bull. 1987; 1555Google Scholar). For virus titration, alternative plaque assays were used (41Brown M. Faulkner P. J. Gen. Virol. 1977; 36: 361-364Google Scholar, 42Shanafelt A.B. BioTechniques. 1991; 11: 330Google Scholar). Recombinant baculoviral DNA was examined by restriction endonuclease mapping and Southern blot analysis (43Sambrook J. Fritsch E.F. Maniatis F. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Growth of Sf9 monolayer cells was performed in tissue flasks (Nunc, Raskilde) at 28°C with TC100 insect medium (Life Technologies, Inc., Eggenstein) supplemented with 10% (v/v) fetal bovine serum (Life Technologies, Inc., Eggenstein), 2 mML-glutamine (Biochrome, Berlin), and 0.1 mg/ml gentamycin (Biochrome, Berlin). For infection, medium was removed and monolayers inoculated under gentle rocking for 1 h with baculovirus stocks, appropriately diluted in culture medium to achieve a multiplicity of infection (m.o.i.) of 10. After removal of inoculum, fresh medium was added, and cells were cultivated for 48 h. Then medium was removed, cells were washed twice with ice-cold phosphate-buffered saline (Life Technologies, Inc., Eggenstein), transferred to centrifuge tubes by up and down pipeting, and sedimented at 1000 × g for 15 min at 4°C. Cell pellets were kept at −70°C until used. Expression of HSV-1 DNA polymerases in recombinant baculovirus-infected cell extracts was monitored by immunoblot analysis. Confluently grown Sf9 cells (7 × 106 cells/25 cm2-flasks) were infected for 48 h with recombinant baculovirus at a m.o.i. of 5 and harvested as described above. Pelleted cells were resuspended in 150 μl of double-distilled water, disrupted by sonication, and cellular debris removed by centrifugation. One part of 4-fold concentrated sample buffer was added to three parts of supernatant, and after boiling for 5 min aliquots of cell extracts were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (44Laemmli U.-K. Nature. 1970; 227: 680-685Google Scholar) and electroblotted on nitrocellulose membranes (BA-S 85; Schleicher & Schuell, Dassel). Immunostaining was performed with a 1000-fold diluted polyclonal rabbit anti-(HSV Pol) serum EX3, directed against the carboxyl terminus (amino acid residues 1072-1235) of HSV-1 ANG DNA Pol, as described previously (16Weisshart K. Knopf C.W. Eur. J. Biochem. 1988; 174: 707-716Google Scholar). Unless otherwise noted, all procedures were performed at 4°C. Frozen Sf9 cell pellets, collected from five 175-cm2 flasks (2 × 108 cells) 48 h after baculovirus infection at a m.o.i. of 10, were thawed in ice, resuspended in 5 ml of buffer A, disrupted by ultrasonication (Branson Sonifier 250, microtip, position 7; 10 times 3 s), and centrifuged at 13,000 × g for 15 min. After resuspending in 5 ml of buffer A cell pellets were reextracted by ultrasonication as before, and the combined supernatants were passed through a 5-ml column of DEAE-cellulose (Whatman, Maidstone) equilibrated with buffer A. The column was washed with 10 ml of buffer A, and flow-through fractions (20 ml) were pooled and applied on a 1-ml heparin-Sepharose column, equilibrated with buffer A at a flow rate of 0.5 ml/min using a fast protein liquid chromatography system (Pharmacia Biotech, Freiburg). After loading, the column was washed with buffer A at the same flow rate until the absorbance at 280 nm reached base line and eluted consecutively in 0.5-ml fractions with the following salt gradients formed with buffer A and buffer B: 5 ml of linear gradient from 0.2 M to 0.4 M NaCl, 5 ml of isocratic gradient at 0.4 M NaCl, 5 ml of linear gradient from 0.4 to 0.6 M NaCl, and 5 ml of isocratic gradient at 0.6 M NaCl. After elution, the column was routinely washed with 5 ml of 2 M NaCl. Fractions were assayed for DNA polymerase and exonuclease activities, and HSV Pol protein was detected by immunoblot analysis. DNA polymerase peak fractions were pooled, dialyzed against storage buffer, concentrated with a Microcon™ 100 concentrator (Amicon, Witten), and stored at −20°C until used. Reaction mixtures contained in a final volume of 100 μl 50 mM Tris-Cl, pH 8.0, 50 μg of bovine serum albumin, 0.5 mM dithiothreitol, 7.5 mM MgCl2, 0.1 mM each of dCTP, dGTP, and dTTP, 0.0125 mM dATP, 0.5 μCi of [α-32P]dATP (3000 Ci/mmol), 25 μg of activated calf thymus DNA (Sigma, Deisenhofen), and enzyme fractions as well as ammonium sulfate concentrations as stated. After incubation at 37°C for 20 min, 80-μl aliquots of reaction mixtures were spotted onto Whatman GF/C glass filters and treated to determine acid-insoluble radioactivity as described (5Knopf K.W. Eur. J. Biochem. 1979; 98: 231-244Google Scholar). Reaction mixtures (50 μl) containing 50 mM Tris-Cl, pH 7.8, 1 mM dithiothreitol, 5 mM MgCl2, 0.4 mM each of dCTP, dGTP, and dTTP, 20 μCi of [α-32P]dATP (3000 Ci/mmol), 500 μg/ml activated calf thymus DNA, and 10 units of Klenow enzyme were incubated at 37°C for 30 min, quenched by the addition of 2.5 μl of 0.5 M EDTA, and chilled in ice. DNA substrate was extracted twice with phenol/chloroform/isoamyl alcohol and purified by gel filtration using TE buffer. Exonucleolytic activities were determined in the absence of dNTP under the conditions of the DNA polymerase assay. Reaction mixtures (100 μl) were incubated for 20 min at 37°C with 25 μg of activated calf thymus DNA containing 0.15 μg (6.7 × 105 cpm/μg) of 32P-labeled exonuclease substrate. Reactions were terminated by chilling in ice and by adding 20 μl of a mixture of 0.25 M EDTA, pH 8, and 5 mg/ml bovine serum albumin, and 20 μl of 100% trichloroacetic acid. After centrifugation (13,000 × g, 20 min, 4°C) the radioactivity of supernatant fractions (100 μl) was determined with 3 ml of Unisolve 100 (Zinsser, Frankfurt) in a 1209 Rackbeta liquid scintillation counter (Pharmacia-LKB Wallac, Freiburg). Oligonucleotides used for the construction of primer-templates illustrated in Fig. 5, Fig. 6 were obtained and purified as described above. DNA primers were labeled at the 5′-end in reaction mixtures (20 μl) using 7 μg of oligonucleotide, 50 μCi of [γ-32P]ATP (5000 Ci/mmol), 10 units of T4 polynucleotide kinase (Boehringer Mannheim), and 1 × linker-kinase buffer for 30 min at 37°C followed by an incubation of 10 min at 68°C according to a standard procedure (43Sambrook J. Fritsch E.F. Maniatis F. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). 3′-End-labeled primers were synthesized in reaction mixtures (20 μl) containing 7 μg of oligonucleotide, 1 μCi of [α-32P]dTTP (3000 Ci/mmol), 30 units of terminal deoxynucleotidyltransferase, and 1 × One-Phor-All buffer, as specified by the supplier (Biotech Pharmacia, Freiburg), for 10 min at 37°C. Unincorporated radioactivity was removed by passing through Sephadex G-50 spun columns, and oligonucleotides were concentrated by precipitation with 1-butanol (45Sawadogo M. Van Dyke M.W. Nucleic Acids Res. 1991; 19: 674Google Scholar). Purity was examined by denaturing 12% polyacrylamide gel electrophoresis (46Maxam A.M. Gilbert W. Methods Enzymol. 1980; 65: 499-560Google Scholar) and quantified by measuring the absorbance at 260 nm. Hybridization of primer and template was achieved by heating 1-4 μg of radiolabeled primer with equimolar amounts of the complementary unlabeled 45-mer template oligonucleotide in TE buffer for 10 min at 70°C followed by slow cooling to room temperature over approximately 2 h. The primer-templates were kept at −20°C before use.Fig. 6Primer-extension and 3′-5′-exonuclease activity on mispaired 3′-32P-labeled primer termini by recombinant HSV Pol. Reactions were performed as described in Fig. 5 but with 80 ng (1.5 × 104 cpm) of the 3′-32P-labeled primer-template illustrated in A and prepared as described in the presence or absence of dNTPs as stated. B and C represent the analysis of reaction products from two independent experiments after sequencing gel electrophoresis and autoradiography. Reaction products of primer-extension and 3′-5′-exonucleolytic degradation are indicated.View Large Image Figure ViewerDownload (PPT) Reaction mixtures contained in a final volume of 10 μl, 25 ng (4.5 × 104 cpm) of 5′-32P-labeled or 80 ng (1.5 × 104 cpm) of the 3′-[32P]dTMP-labeled primer-template, 50 mM Tris-Cl, pH 8.0, 5 μg of bovine serum albumin, 0.5 mM dithiothreitol, 7.5 mM MgCl2, 50 mM ammonium sulfate, and 0.25 mM each of dATP, dCTP, dGTP, and dTTP. Reactions were initiated by the addition of 4 μl of the stated enzyme preparations. After incubation for 3 min at 37°C, reactions were terminated by adding 5 μl of a formamide/dye mixture, containing 95% formamide, 0.05% bromphenol blue, 0.05% xylene cyanol, and 20 mM EDTA, pH 8. Aliquots (5 μl) of each reaction mixture were boiled briefly, chilled rapidly, and then subjected to electrophoresis on 12% DNA sequencing gels, containing 8 M urea (46Maxam A.M. Gilbert W. Methods Enzymol. 1980; 65: 499-560Google Scholar). The gels were prerun to a temperature of 55°C, and the samples were then electrophoresed for 2 h at 30 watts (constant power). Gels were covered with Saran wrap and directly autoradiographed on x-ray films (Kodak X-Omat). For site-directed mutagenesis the 2031-base pair SalI-fragment from nucleotide position 1229 to 3260 of the DNA polymerase gene of the PAAr variant of HSV-1 strain ANG, containing the complete 3′-5′-exonuclease domain, was subcloned from pH1381 into phagemid vector pMa as described under “Experimental Procedures.” Recombinant single-stranded phagemid DNA together with the mutagenic oligonucleotides, as shown in Table I, were used for in vitro mutagenesis as described under “Experimental Procedures.” Mutagenic oligonucleotides were designed such that restriction endonuclease recognition sites were deleted. Recombinant phagemid clones containing the desired mutations were then screened by restriction endonuclease analysis, and the mutations were verified by DNA sequencing. The changes introduced were intended to neutralize functionally interacting side chains, e.g. carboxyl and OH groups were changed to methyl and phenyl groups, respectively. In addition, 19 residues located between the Exo II and Exo III motifs of HSV Pol (position 539-557) were deleted, and likely candidate residues for a role in base positioning, such as the tyrosines in position 538 and 557, were changed from aromatic to aliphatic side chains. Sequence analysis revealed that from seven mutations six were successfully introduced by the chosen site-directed mutagenesis protocol (39Kunkel T.A. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 488-492Google Scholar) but that one phagemid clone (Y538S) contained an extra mutation downstream from the oligonucleotide primer at nucleotide position 1937 (32Knopf C.W. Nucleic Acids Res. 1986; 14: 8225-8226Google Scholar). This was a conversion of A → C that resulted in the conservative amino acid substitution, isoleucine to leucine, and yielded the amino acid sequence KLKLSSSKL. For the engineering of recombinant baculoviral transfer vector pVL1393 with mutated HSV Pol genes, the LORF of HSV Pol of strain ANG from nucleotide position 325 to 4190 (32Knopf C.W. Nucleic Acids Res. 1986; 14: 8225-8226Google Scholar) was subcloned into pVL1393, yielding pPOL, cleaved with NheI and SstI or MstII, and ligated with mutation bearing NheI-SstI and NheI-MstII fragments from mutated recombinant phagemids. Presence of introduced mutations was confirmed by restriction endonuclease analysis. Deletion mutant Δ19 with a deletion of amino acids 539-557 was constructed directly from baculoviral transfer vectors pY538S and pY557S by inserting the unique SstI fragment, spanning from nucleotide position 2009-2133 (32Knopf C.W. Nucleic Acids Res. 1986; 14: 8225-8226Google Schola" @default.
• W1488753522 created "2016-06-24" @default.
• W1488753522 creator A5029976365 @default.
• W1488753522 creator A5062031059 @default.
• W1488753522 date "1996-11-01" @default.
• W1488753522 modified "2023-10-18" @default.
• W1488753522 title "Herpes Simplex Virus Type 1 DNA Polymerase" @default.
• W1488753522 cites W1017710698 @default.
• W1488753522 cites W1483196427 @default.
• W1488753522 cites W1501357974 @default.
• W1488753522 cites W1501732289 @default.
• W1488753522 cites W1502391241 @default.
• W1488753522 cites W1509692938 @default.
• W1488753522 cites W1530517085 @default.
• W1488753522 cites W1547854436 @default.
• W1488753522 cites W1558516755 @default.
• W1488753522 cites W1560115326 @default.
• W1488753522 cites W1587060900 @default.
• W1488753522 cites W1593554557 @default.
• W1488753522 cites W1605012879 @default.
• W1488753522 cites W1625770513 @default.
• W1488753522 cites W1634217411 @default.
• W1488753522 cites W1661691401 @default.
• W1488753522 cites W1762887467 @default.
• W1488753522 cites W1967551177 @default.
• W1488753522 cites W1967653471 @default.
• W1488753522 cites W1971681144 @default.
• W1488753522 cites W1977761195 @default.
• W1488753522 cites W1979144756 @default.
• W1488753522 cites W1990083018 @default.
• W1488753522 cites W2004164424 @default.
• W1488753522 cites W2017950533 @default.
• W1488753522 cites W2023515409 @default.
• W1488753522 cites W2031842720 @default.
• W1488753522 cites W2032527591 @default.
• W1488753522 cites W2036931150 @default.
• W1488753522 cites W2039623414 @default.
• W1488753522 cites W2045776421 @default.
• W1488753522 cites W2047388928 @default.
• W1488753522 cites W204747317 @default.
• W1488753522 cites W2055097794 @default.
• W1488753522 cites W2058317622 @default.
• W1488753522 cites W2058847852 @default.
• W1488753522 cites W2063634415 @default.
• W1488753522 cites W2072768518 @default.
• W1488753522 cites W2073510308 @default.
• W1488753522 cites W2075074108 @default.
• W1488753522 cites W2076839448 @default.
• W1488753522 cites W2086008536 @default.
• W1488753522 cites W2092197029 @default.
• W1488753522 cites W2095333277 @default.
• W1488753522 cites W2097379979 @default.
• W1488753522 cites W2100837269 @default.
• W1488753522 cites W2114710738 @default.
• W1488753522 cites W2117686162 @default.
• W1488753522 cites W2142238046 @default.
• W1488753522 cites W2150981906 @default.
• W1488753522 cites W2152264576 @default.
• W1488753522 cites W2157821159 @default.
• W1488753522 cites W2159847993 @default.
• W1488753522 cites W2163043365 @default.
• W1488753522 cites W2173897158 @default.
• W1488753522 cites W235836333 @default.
• W1488753522 cites W29362848 @default.
• W1488753522 cites W32978508 @default.
• W1488753522 doi "https://doi.org/10.1074/jbc.271.46.29245" @default.
• W1488753522 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/8910584" @default.
• W1488753522 hasPublicationYear "1996" @default.
• W1488753522 type Work @default.
• W1488753522 sameAs 1488753522 @default.
• W1488753522 citedByCount "64" @default.
• W1488753522 countsByYear W14887535222012 @default.
• W1488753522 countsByYear W14887535222013 @default.
• W1488753522 countsByYear W14887535222014 @default.
• W1488753522 countsByYear W14887535222015 @default.
• W1488753522 countsByYear W14887535222016 @default.
• W1488753522 countsByYear W14887535222017 @default.
• W1488753522 countsByYear W14887535222018 @default.
• W1488753522 countsByYear W14887535222019 @default.
• W1488753522 countsByYear W14887535222021 @default.
• W1488753522 countsByYear W14887535222023 @default.
• W1488753522 crossrefType "journal-article" @default.
• W1488753522 hasAuthorship W1488753522A5029976365 @default.
• W1488753522 hasAuthorship W1488753522A5062031059 @default.
• W1488753522 hasConcept C153911025 @default.
• W1488753522 hasConcept C159047783 @default.
• W1488753522 hasConcept C2522874641 @default.
• W1488753522 hasConcept C2756471 @default.
• W1488753522 hasConcept C2781196997 @default.
• W1488753522 hasConcept C54355233 @default.
• W1488753522 hasConcept C552990157 @default.
• W1488753522 hasConcept C82381507 @default.
• W1488753522 hasConcept C86803240 @default.
• W1488753522 hasConceptScore W1488753522C153911025 @default.
• W1488753522 hasConceptScore W1488753522C159047783 @default.
• W1488753522 hasConceptScore W1488753522C2522874641 @default.
• W1488753522 hasConceptScore W1488753522C2756471 @default.
• W1488753522 hasConceptScore W1488753522C2781196997 @default.

• next