FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1497446066> ?p ?o ?g. }

• W1497446066 endingPage "23479" @default.
• W1497446066 startingPage "23472" @default.
• W1497446066 abstract "Some Gq-coupled receptors have been shown to antagonize growth factor activation of phosphatidylinositol 3-kinase (PI3K) and its downstream effector, Akt. We used a constitutively active Gαq(Q209L) mutant to explore the effects of Gαq activation on signaling through the PI3K/Akt pathway. Transient expression of Gαq(Q209L) in Rat-1 fibroblasts inhibited Akt activation induced by platelet-derived growth factor or insulin treatment. Expression of Gαq(Q209L) also attenuated Akt activation promoted by coexpression of constitutively active PI3K in human embryonic kidney 293 cells. Gαq(Q209L) had no effect on the activity of an Akt mutant in which the two regulatory phosphorylation sites were changed to acidic amino acids. Inducible expression of Gαq(Q209L) in a stably transfected 293 cell line caused a decrease in PI3K activity in p110α (but not p110β) immunoprecipitates. Receptor activation of Gαq also selectively inhibited PI3K activity in p110α immunoprecipitates. Active Gαq still inhibited PI3K/Akt in cells pretreated with the phospholipase C inhibitor U73122. Finally, Gαq(Q209L) co-immunoprecipitated with the p110α-p85α PI3K heterodimer from lysates of COS-7 cells expressing these proteins, and incubation of immunoprecipitated Gαq(Q209L) with purified recombinant p110α-p85α in vitro led to a decrease in PI3K activity. These results suggest that agonist binding to Gq-coupled receptors blocks Akt activation via the release of active Gαq subunits that inhibit PI3K. The inhibitory mechanism seems to be independent of phospholipase C activation and might involve an inhibitory interaction between Gαq and p110α PI3K. Some Gq-coupled receptors have been shown to antagonize growth factor activation of phosphatidylinositol 3-kinase (PI3K) and its downstream effector, Akt. We used a constitutively active Gαq(Q209L) mutant to explore the effects of Gαq activation on signaling through the PI3K/Akt pathway. Transient expression of Gαq(Q209L) in Rat-1 fibroblasts inhibited Akt activation induced by platelet-derived growth factor or insulin treatment. Expression of Gαq(Q209L) also attenuated Akt activation promoted by coexpression of constitutively active PI3K in human embryonic kidney 293 cells. Gαq(Q209L) had no effect on the activity of an Akt mutant in which the two regulatory phosphorylation sites were changed to acidic amino acids. Inducible expression of Gαq(Q209L) in a stably transfected 293 cell line caused a decrease in PI3K activity in p110α (but not p110β) immunoprecipitates. Receptor activation of Gαq also selectively inhibited PI3K activity in p110α immunoprecipitates. Active Gαq still inhibited PI3K/Akt in cells pretreated with the phospholipase C inhibitor U73122. Finally, Gαq(Q209L) co-immunoprecipitated with the p110α-p85α PI3K heterodimer from lysates of COS-7 cells expressing these proteins, and incubation of immunoprecipitated Gαq(Q209L) with purified recombinant p110α-p85α in vitro led to a decrease in PI3K activity. These results suggest that agonist binding to Gq-coupled receptors blocks Akt activation via the release of active Gαq subunits that inhibit PI3K. The inhibitory mechanism seems to be independent of phospholipase C activation and might involve an inhibitory interaction between Gαq and p110α PI3K. Phosphatidylinositol 3-kinase (PI3K) 1The abbreviations used are: PI3K, phosphatidylinositol 3-kinase; PI, phosphatidylinositol; PE, phenylephrine; PDGF, platelet-derived growth factor; GTPγS, guanosine 5′-O-(3-thiotriphosphate); HA, hemagglutinin; myr-, myristoylated; HEK, human embryonic kidney; HPLC, high pressure liquid chromatography; PIPES, 1,4-piperazinediethanesulfonic acid; HIR, human insulin receptor. 1The abbreviations used are: PI3K, phosphatidylinositol 3-kinase; PI, phosphatidylinositol; PE, phenylephrine; PDGF, platelet-derived growth factor; GTPγS, guanosine 5′-O-(3-thiotriphosphate); HA, hemagglutinin; myr-, myristoylated; HEK, human embryonic kidney; HPLC, high pressure liquid chromatography; PIPES, 1,4-piperazinediethanesulfonic acid; HIR, human insulin receptor. mediates many of the cellular actions of receptor tyrosine kinases, including effects on glucose metabolism, cell survival, and cytoskeletal rearrangements (1Katso R. Okkenhaug K. Ahmadi K. White S. Timms J. Waterfield M.D. Annu. Rev. Cell Dev. Biol. 2001; 17: 615-675Google Scholar). Of the three classes of PI3K, only the class I enzymes preferentially phosphorylate phosphatidylinositol (PI) 4,5-bisphosphate in vivo. Class I PI3Ks are divided into two groups: IA enzymes are heterodimers between a p110 catalytic subunit and a p85 or p55 (or their splice variants) regulatory subunit. Mammals have three class IA p110 catalytic subunits (α, β, and δ) that can associate with at least seven regulatory subunits that are generated by alternative splicing of three different genes (p85α, p85β, and p55γ). p110α and p110β are ubiquitously expressed, whereas p110δ is present almost exclusively in leukocytes. Class IA PI3Ks can be activated by receptor tyrosine kinases, and the p110β isoform is also activated by some G protein-coupled receptors (2Roche S. Downward J. Raynal P. Courtneidge S.A. Mol. Cell. Biol. 1998; 18: 7119-7129Google Scholar). The p85 regulatory subunit contains two SH2 (Src homology 2) domains that bind to specific phosphotyrosine motifs on receptor tyrosine kinases or their substrates. This binding leads to translocation of p110 to the membrane and enhances its catalytic activity. The class IB PI3K consists of a p110γ catalytic subunit and a p101 regulatory protein and is activated by some receptors coupled to heterotrimeric G proteins.An important downstream effector of PI3K is the serine/threonine protein kinase Akt. Akt is activated by phosphorylation of Thr308 in the activation loop of the kinase domain and Ser473 in the C-terminal tail (reviewed in Ref. 3Alessi D.R. Cohen P. Curr. Opin. Genet. Dev. 1998; 8: 55-62Google Scholar). It is believed that phosphorylation of both sites requires an interaction between the N-terminal pleckstrin homology domain of Akt and membrane phosphoinositides generated by PI3K. Although a few cell treatments have been reported to activate Akt in a PI3K-independent manner (4Sable C.L. Filippa N. Hemmings B. Van Obberghen E. FEBS Lett. 1997; 409: 253-257Google Scholar, 5Yano S. Tokumitsu H. Soderling T.R. Nature. 1998; 396: 584-587Google Scholar), receptor tyrosine kinases that activate Akt also in general activate PI3K.Cell-surface receptors that transmit signals through heterotrimeric G proteins regulate the PI3K/Akt pathway in a variety of ways. Receptors that couple to proteins in the Gi/o family can increase PI3K activity. This effect is mediated mainly by Gβγ heterodimers, which activate both the p110β and p110γ PI3Ks (6Stoyanov B. Volinia S. Hanck T. Rubio I. Loubtchenkov M. Malek D. Stoyanova S. Vanhaesebroeck B. Dhand R. Nurnberg B. Gierschik P. Seedorf K. Hsuan J.J. Waterfield M.D. Wetzker R. Science. 1995; 269: 690-693Google Scholar, 7Stephens L.R. Eguinoa A. Erdjument-Bromage H. Lui M. Cooke F. Coadwell J. Smrcka A.S. Thelen M. Cadwallader K. Tempst P. Hawkins P.T. Cell. 1997; 89: 105-114Google Scholar, 8Kurosu H. Maehama T. Okada T. Yamamoto T. Hoshino S. Fukui Y. Ui M. Hazeki O. Katada T. J. Biol. Chem. 1997; 272: 24252-24256Google Scholar). Recent reports indicate that Gi/o-coupled receptors also active Akt (9Tilton B. Andjelkovic M. Didichenko S.A. Hemmings B.A. Thelen M. J. Biol. Chem. 1997; 272: 28096-28101Google Scholar, 10Franke T.F. Kaplan D.R. Cantley L.C. Toker A. Science. 1997; 275: 665-668Google Scholar, 11Bommakanti R.K. Vinayak S. Simonds W.F. J. Biol. Chem. 2000; 275: 38870-38876Google Scholar). Receptors that couple to Gs have also been shown to activate Akt. In some cases, this response is unusual in that it appears to be independent of PI3K (4Sable C.L. Filippa N. Hemmings B. Van Obberghen E. FEBS Lett. 1997; 409: 253-257Google Scholar, 12Moule S.K. Welsh G.I. Edgell N.J. Foulstone E.J. Proud C.G. Denton R.M. J. Biol. Chem. 1997; 272: 7713-7719Google Scholar), whereas in other cases, it is thought to be due to activation of PI3K by Gβγ subunits (11Bommakanti R.K. Vinayak S. Simonds W.F. J. Biol. Chem. 2000; 275: 38870-38876Google Scholar).The data regarding regulation of PI3K and/or Akt by Gq-coupled receptors are more controversial. One body of evidence suggests that some receptors that can couple to Gq might activate PI3K/Akt signaling in certain cellular settings (13Kowalski-Chauvel A. Pradayrol L. Vaysse N. Seva C. J. Biol. Chem. 1996; 271: 26356-26361Google Scholar, 14Saward L. Zahradka P. Circ. Res. 1997; 81: 249-257Google Scholar, 15Graness A. Adomeit A. Heinze R. Wetzker R. Liebmann C. J. Biol. Chem. 1998; 273: 32016-32022Google Scholar, 16Takahashi T. Taniguchi T. Konishi H. Kikkawa U. Ishikawa Y. Yokoyama M. Am. J. Physiol. 1999; 276: H1927-H1934Google Scholar, 17Imamura T. Ishibashi K. Dalle S. Ugi S. Olefsky J.M. J. Biol. Chem. 1999; 274: 33691-33695Google Scholar, 18Eguchi S. Iwasaki H. Ueno H. Frank G.D. Motley E.D. Eguchi K. Marumo F. Hirata Y. Inagami T. J. Biol. Chem. 1999; 274: 36843-36851Google Scholar, 19Tang X. Batty I.H. Downes C.P. J. Biol. Chem. 2002; 277: 338-344Google Scholar). Indeed, we reported that norepinephrine stimulation of α1-adrenergic receptors in human aortic smooth muscle cells increases PI3K activity (20Hu Z.W. Shi X.Y. Lin R.Z. Hoffman B.B. J. Biol. Chem. 1996; 271: 8977-8982Google Scholar). However, this effect is completely blocked by pretreatment with pertussis toxin, indicating that it is not mediated by Gαq (20Hu Z.W. Shi X.Y. Lin R.Z. Hoffman B.B. J. Biol. Chem. 1996; 271: 8977-8982Google Scholar). A second body of evidence suggests that Gq-coupled receptors do not activate PI3K or Akt and in fact antagonize activation of these enzymes by growth factors that act through tyrosine kinase receptors (11Bommakanti R.K. Vinayak S. Simonds W.F. J. Biol. Chem. 2000; 275: 38870-38876Google Scholar, 21Batty I.H. Downes C.P. Biochem. J. 1996; 317: 347-351Google Scholar, 22Velloso L.A. Folli F. Sun X.J. White M.F. Saad M.J. Kahn C.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12490-12495Google Scholar, 23Folli F. Kahn C.R. Hansen H. Bouchie J.L. Feener E.P. J. Clin. Invest. 1997; 100: 2158-2169Google Scholar, 24Hajduch E. Rencurel F. Balendran A. Batty I.H. Downes C.P. Hundal H.S. J. Biol. Chem. 1999; 274: 13563-13568Google Scholar, 25Jiang Z.Y. Zhou Q.L. Chatterjee A. Feener E.P. Myers Jr., M.G. White M.F. King G.L. Diabetes. 1999; 48: 1120-1130Google Scholar). In agreement with these reports, we found that stimulation of the α1A-adrenergic receptor in Rat-1 cells with the agonist phenylephrine (PE) does not increase PI(3,4,5)P3 levels or PI3K activity and does not activate Akt (26Ballou L.M. Cross M.E. Huang S. McReynolds E.M. Zhang B.-X. Lin R.Z. J. Biol. Chem. 2000; 275: 4803-4809Google Scholar). Furthermore, the α1A-adrenergic receptor inhibits activation of PI3K/Akt in response to platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor I (26Ballou L.M. Cross M.E. Huang S. McReynolds E.M. Zhang B.-X. Lin R.Z. J. Biol. Chem. 2000; 275: 4803-4809Google Scholar, 27Ballou L.M. Tian P.-Y. Lin H.-Y. Jiang Y.-P. Lin R.Z. J. Biol. Chem. 2001; 276: 40910-40916Google Scholar). To further explore the mechanism by which the α1A-adrenergic receptor and other Gq-coupled receptors inhibit PI3K signaling, we used Gαq(Q209L) to test whether activated Gαq inhibits Akt activation by inhibiting PI3K.EXPERIMENTAL PROCEDURESMaterials—Human recombinant PDGF-A/B, PE, doxycycline, insulin, PI, U73122, GTPγS, and monoclonal antibody to FLAG were purchased from Sigma. [γ-32P]ATP (3000 Ci/mmol) and myo-[3H]inositol (10–25 Ci/mmol) were from PerkinElmer Life Sciences. Rabbit polyclonal antibodies against Gαq and Akt (H-136) were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-p110α, anti-p110β, and anti-p85α antibodies were from Upstate Biotechnology, Inc. (Lake Placid, NY). Anti-phospho-Ser473 Akt antibody was from Cell Signaling Technology (Beverly, MA). Anti-HA and anti-Myc antibodies were from Covance (Richmond, CA).Constructs—An epitope-tagged Akt construct (Akt-HA) was obtained from Dr. Richard Roth (Stanford University, Stanford, CA). PCR with primers 5′-CGCCTCGAGGCCACCATGGGCAGCGACGTGGCTATTGTGAAG (forward) and 5′-CGCGATATCTCAGGCCGTGCTGCTGGCCGA (reverse) was used to amplify Akt from Akt-HA, and the cDNA fragment was subcloned into pBluescript II SK. Akt was excised using XbaI and XhoI and subcloned into pcDNA3.1/Myc-His (Invitrogen) to obtain Akt-Myc. The Akt(T308D/S473D) double mutant (referred to as AktDD-Myc) was constructed using the QuikChange site-directed mutagenesis kit (Stratagene) and forward primers 5′-GGTGCCACCATGAAGGACTTTTGCGGCACACCT (T308D) and 5′-CACTTCCCCCAGTTCGACTACTCGGCCAGC (S473D).Mouse wild-type p110α and constitutively active myristoylated (myr) p110α in pUSEamp were purchased from Upstate Biotechnology, Inc. FLAG-p110α was obtained by subcloning p110α from pUSEamp into the XbaI and BamHI sites of p3XFLAG-CMV-10 (Sigma). Mouse p85α was obtained by PCR from mouse liver cDNA (Clontech) using primers 5′-GCGGAATTCATGAGTGCAGAGGGCTACCA (forward) and 5′-GCGGGATCCTCATCGCCTCTGTTGTGC (reverse). The p85α cDNA fragment was subcloned into the BamHI and EcoRI sites of pBluescript II SK and then subcloned into pcDNA3.1 using XbaI and EcoRV. PCR with primers 5′-CGCGGTACCGCCACCATGGCATACCCCTACGACGTGCCCGACTACGCCACTCTGGAGTCCATCATGGC (forward) and 5′-CGCGGATCCTTAGACCAGATTGTACTCCTTCAG (reverse) was used to obtain HA-Gαq from Swiss mouse 3T3 cell cDNA. The cDNA fragment was subcloned into pcDNA3.1 using KpnI and EcoRV. HA-Gαq(Q209L) was constructed from HA-Gαq using the QuikChange site-directed mutagenesis kit and the forward primer 5′-GTCGATGTAGGGGGCCTAAGGTCAGAGAGAAG. PCR with primers 5′-CGCGGATCCGCCACCATGACTCTGGAGTCCATCATGGC (forward) and 5′-CGCGGATCCTTAGACCAGATTGTACTCCTTCAG (reverse) was used to obtain Gαq(Q209L) from HA-Gαq(Q209L). Gαq(Q209L) was subcloned into pcDNA5/FRT/TO (Invitrogen) using NotI and ApaI.Cell Culture—Rat-1 fibroblasts stably expressing the human α1A-adrenergic receptor (28Kenny B.A. Miller A.M. Williamson I.J. O'Connell J. Chalmers D.H. Naylor A.M. Br. J. Pharmacol. 1996; 118: 871-878Google Scholar) or the human insulin receptor (29McClain D. Maegawa H. Lee J. Dull T. Ulrich A. Olefsky J. J. Biol. Chem. 1987; 262: 14663-14671Google Scholar), human embryonic kidney (HEK) 293 cells, and COS-7 cells were maintained in Dulbecco's modified Eagle's medium (Mediatech, Herndon, VA) with 10% fetal bovine serum (Sigma) in 5% CO2 at 37 °C. Before agonist treatments, the cells were incubated overnight in serum-free medium. COS-7 cells were transfected using LipofectAMINE (Invitrogen). After 5 h, the transfection solutions were replaced with growth medium, and cell lysates were prepared 2 days later. Rat-1 cells were transfected using TransIT-LT1 (Mirus, Madison, WI) following a protocol supplied by the manufacturer. Cells at ∼50% confluence were transfected in a mixture containing 3 μl of TransIT-LT1 for each microgram of DNA in growth medium. The cells were left in the transfection solution for 24 h and then incubated in serum-free medium for another 16–18 h prior to the experiment.Stable HEK 293 cell lines expressing Gαq(Q209L) under the control of a doxycycline-inducible promoter and control cells were generated using the Flp-In T-REx system (Invitrogen) following the protocol supplied by the manufacturer. Briefly, Flp-In T-REx/293 cells growing in medium containing Zeocin were cotransfected with either Gαq(Q209L)/pcDNA5/FRT/TO or the empty vector pcDNA5/FRT/TO together with pOG44. Transfected cells were then selected for Zeocin and hygromycin resistance. Clones with inducible expression of Gαq(Q209L) were confirmed by Western blotting.Cell Lysate Preparation—After treatment, cells were rinsed with ice-cold phosphate-buffered saline and scraped into lysis buffer (50 mm HEPES (pH 7.5), 50 mm NaCl, 5 mm EDTA, 50 mm NaF, 10 mm pyrophosphate, 1 mm sodium orthovanadate, 0.5 mm phenylmethylsulfonyl fluoride, and 10 μg/ml each aprotinin and leupeptin) with either 1% Triton X-100 or 1% Nonidet P-40 plus 0.25% sodium deoxycholate. Homogenates were centrifuged at 15,000 × g for 15 min at 4 °C, and protein concentrations were determined using the Bradford assay (Bio-Rad).Immunoprecipitation—Cell lysates containing equal amounts of protein were incubated with the appropriate antibody for 2 h and then with 25 μl of protein A- or protein G-agarose (Sigma) for 1 h. The beads were either washed three times with lysis buffer and used for immunoblotting or washed three times with lysis buffer and once with the appropriate kinase assay buffer prior to performing kinase assays.Western Blotting—Immunoprecipitates or equal amounts of cell lysate protein were subjected to SDS-PAGE, followed by electrophoretic transfer onto nitrocellulose or polyvinylidene difluoride membranes. Signals were visualized using horseradish peroxidase-linked secondary antibodies (Amersham Biosciences) and a chemiluminescence kit (PerkinElmer Life Sciences). Blots were stripped as described (26Ballou L.M. Cross M.E. Huang S. McReynolds E.M. Zhang B.-X. Lin R.Z. J. Biol. Chem. 2000; 275: 4803-4809Google Scholar).PI3K and Akt Assays—PI3K and Akt activities were assayed following methods described previously (26Ballou L.M. Cross M.E. Huang S. McReynolds E.M. Zhang B.-X. Lin R.Z. J. Biol. Chem. 2000; 275: 4803-4809Google Scholar).Phospholipid Analysis—Rat-1 cells were labeled with myo-[3H]inositol as described (26Ballou L.M. Cross M.E. Huang S. McReynolds E.M. Zhang B.-X. Lin R.Z. J. Biol. Chem. 2000; 275: 4803-4809Google Scholar) and treated with agonists. Phospholipids were extracted and analyzed as described previously (26Ballou L.M. Cross M.E. Huang S. McReynolds E.M. Zhang B.-X. Lin R.Z. J. Biol. Chem. 2000; 275: 4803-4809Google Scholar), except the HPLC gradient was modified to better separate the PI(3,4,5)P3 derivative from other compounds (30Serunian L.A. Auger K.R. Cantley L.C. Methods Enzymol. 1991; 198: 78-87Google Scholar). The solutions used to develop the gradient were ultrapure water (solution A) and 1.25 m (NH4)2HPO4 (pH 3.8) (solution B). The gradient was developed as follows: 0% solution B from 0 to 10 min, increased to 15% from 10 to 48 min; 15% solution B from 48 to 60 min, increased to 25% from 60 to 75 min, and increased to 30% from 75 to 100 min. The flow rate was 1 ml/min, and 1-ml fractions were collected. The PI(3,4,5)P3 derivative emerged after ∼82 min. Elution positions were confirmed using 32P-labeled standards as described (26Ballou L.M. Cross M.E. Huang S. McReynolds E.M. Zhang B.-X. Lin R.Z. J. Biol. Chem. 2000; 275: 4803-4809Google Scholar).Purification of Recombinant p110α-p85α—Baculovirus expressing human p85α was purchased from Orbigen (San Diego, CA). To produce baculovirus expressing p110α, mouse p110α from pUSEamp was subcloned into pBlueBacHis2A (Invitrogen). Sf9 cells were cotransfected with the plasmid and linear Autographa californica nuclear polyhedrosis virus viral DNA using the Invitrogen BAC-N-BLUE transfection kit, and a baculovirus clone expressing recombinant p110α protein was isolated. To make the p110α-p85α complex, a 400-ml culture of Sf9 cells was co-infected with the two baculoviruses. Two days later, the cells were pelleted and lysed, and the lysate was passed over a 5-ml HiTrap QFF column (Amersham Biosciences). The proteins were eluted with a gradient of NaCl; PI3K activity emerging at 180–270 mm NaCl was pooled. Material from three QFF columns was passed over a column of Ni2+-nitrilotriacetic acid-agarose (QIAGEN Inc.). After extensive washing with 50 mm imidazole, the PI3K complex was eluted with 200 mm imidazole. Fractions with the highest activity contained equivalent amounts of two major Coomassie Blue-stained proteins corresponding to recombinant p110α and p85α.Quantitation of Inositol Phosphates—Rat-1 cells expressing the human α1A-adrenergic receptor were seeded in 24-well plates at 2.5 × 104 cells/well. The next day, cells were labeled for 16–24 h in 1 ml of serum-free medium containing 3 μCi/ml myo-[3H]inositol. After labeling, the cells were washed with phosphate-buffered saline and incubated in 0.5 ml of buffer A (120 mm NaCl, 0.5 mm CaCl2, 5 mm KCl, 5.6 mm glucose, 0.4 mm MgCl2, 20 mm LiCl, and 25 mm PIPES (pH 7.2)) with or without 5 μm U73122 for 30 min. Cells were then treated with agonists for another 30 min. COS-7 cells were seeded at 2.5 × 104 cells/well in 24-well plates 1 day before transfection with FLAG-p110α and p85α in the presence of either empty vector or HA-Gαq(Q209L). Twenty-four hours after transfection, cells were incubated in 1 ml of growth medium containing 3 μCi/ml myo-[3H]inositol for 16–24 h. Cells were then washed and incubated in buffer A with or without 5 μm U73122 for 1 h. After cell treatments, 1 ml of 16 mm HCl in methanol was added to each well, and the solutions were applied to 500-μl columns of Dowex 1-X8 (formate form). The columns were washed with 5 mm sodium tetraborate and 60 mm sodium formate, and then total inositol phosphates were eluted with 2 ml of 1 m ammonium formate and 100 mm formic acid. Radioactivity in the eluted material was determined by scintillation counting. Assays were performed in triplicate.RESULTSGαq(Q209L) Inhibits Growth Factor Activation of Akt—Stimulation of G protein-coupled receptors leads to GTP loading of the Gα subunit and release of the Gβγ subunits. The Gα and Gβγ subunits can then independently exert their effects on downstream effectors. Although the α1A-adrenergic receptor couples mainly to α proteins in the Gq/11 family, the receptor can also activate α proteins in other families (31Schwinn D.A. Johnston G.I. Page S.O. Mosley M.J. Wilson K.H. Worman N.P. Campbell S. Fidock M.D. Furness L.M. Parry-Smith D.J. Peter B. Bailey D.S. J. Pharmacol. Exp. Ther. 1995; 272: 134-142Google Scholar, 32Ruan Y. Kan H. Parmentier J.H. Fatima S. Allen L.F. Malik K.U. J. Pharmacol. Exp. Ther. 1998; 284: 576-585Google Scholar). Inhibition of Akt upon PE stimulation of the α1A-adrenergic receptor in Rat-1 cells is probably not due to coupling of the receptor to Gαi or Gαs because the effect was not blocked by pretreatment with pertussis toxin or 2′,5′-dideoxyadenosine, an adenylyl cyclase inhibitor, respectively (data not shown). Because Gβγ subunits have been shown to activate PI3K, we decided to explore a possible role for Gαq in PI3K/Akt inhibition. To do this, we used an HA-tagged version of the Q209L mutant of Gαq, which is GTPase-deficient and therefore constitutively activates downstream effectors such as phospholipase Cβ without agonist stimulation of a receptor (33Wu D.Q. Lee C.H. Rhee S.G. Simon M.I. J. Biol. Chem. 1992; 267: 1811-1817Google Scholar).Rat-1 cells were cotransfected with Akt-Myc and with either HA-Gαq(Q209L) or empty vector as a control. The cells were treated with or without PDGF, and Akt activity was assayed in Myc immunoprecipitates. PDGF treatment stimulated Akt activity 3.6-fold in control cells, and this response was suppressed 58% by expression of HA-Gαq(Q209L) (Fig. 1A, graph). Western blotting showed that Akt-Myc and HA-Gαq(Q209L) were expressed appropriately (Fig. 1A, blots). An additional experiment using a different growth factor was done to test the generality of Akt inhibition by HA-Gαq(Q209L). Rat-1 cells stably expressing the human insulin receptor (Rat-1/HIR cells) were transfected with either HA-Gαq(Q209L) or empty vector as a control. The cells were treated with or without insulin, and the activity of endogenous Akt was assayed in Akt immunoprecipitates. Insulin activated Akt 3.4-fold in control cells, and this response was suppressed 38% by expression of HA-Gαq(Q209L) (Fig. 1B, graph). Western blot analysis showed that the reduction in Akt activity was paralleled by a reduction in Ser473 phosphorylation (Fig. 1B, upper blot). HA-Gαq(Q209L) did not affect the expression of the Akt protein (Fig. 1B, middle blot). The blot was also probed with anti-HA antibody to demonstrate that HA-Gαq(Q209L) was appropriately expressed (Fig. 1B, lower blot). Thus, expression of HA-Gαq(Q209L) opposes the activation of Akt induced by both the PDGF and insulin receptors. The apparently stronger effect of HA-Gαq(Q209L) in Fig. 1A compared with Fig. 1B is due to the fact that Akt-Myc was cotransfected with HA-Gαq(Q209L) in the former experiment, whereas endogenous Akt was analyzed in the latter. Transfection of Rat-1/HIR cells with a vector expressing green fluorescent protein showed that the transfection efficiency under the conditions used in Fig. 1B was ∼60% (data not shown).Gαq(Q209L) Inhibits Myristoylated p110α Activation of Akt—The inhibitory effect of Gαq(Q209L) on Akt activation induced by two distinct receptors raised the possibility that active Gαq might have a direct inhibitory effect on either Akt or PI3K. To test whether Gαq(Q209L) targets Akt, HEK 293 cells were cotransfected with HA-Gαq(Q209L) or empty vector as a control and with an activated form of Akt in which the two phosphorylation sites were mutated to Asp (AktDD-Myc). Cells were serum-starved overnight prior to assaying Akt activity in Myc immunoprecipitates. Extracts from cells transfected with AktDD-Myc had four to six times more Akt kinase activity than extracts from cells transfected with Akt-Myc (Fig. 2A). The presence of HA-Gαq(Q209L) did not affect the activity of AktDD-Myc (Fig. 2A). These results suggest that activated Gαq does not have a direct inhibitory effect on Akt.Fig. 2Effect of Gαq(Q209L) on myr-p110α activation of Akt.A, HEK 293 cells were cotransfected with Akt-Myc or AktDD-Myc and with combinations of myr-p110α, HA-Gαq(Q209L), or empty vector as a control. Cells were serum-starved overnight, and Akt activity was assayed in Myc immunoprecipitates. Data shown are means ± S.E. from three independent experiments. B, cell extracts from A (representing the first, fourth, and fifth bars) were analyzed on a Western blot probed sequentially with antibodies to phospho-Ser473 Akt (P-S473 Akt-myc), Myc, HA, and p110α. Western blotting was repeated with similar results.View Large Image Figure ViewerDownload (PPT)Expression of membrane-localized myr-p110α is sufficient to trigger downstream signaling events in the absence of growth factors. It is believed that when p110 is directed to the membrane, the increased availability of lipid substrates leads to increased production of PI(3,4,5)P3 and subsequent activation of Akt, even though the enzymatic activity of myr-p110α is no higher than that of wild-type p110α (34Klippel A. Reinhard C. Kavanaugh W.M. Apell G. Escobedo M.A. Williams L.T. Mol. Cell. Biol. 1996; 16: 4117-4127Google Scholar). We tested whether activated Gαq can inhibit myr-p110α signaling to Akt. HEK 293 cells were cotransfected with Akt-Myc in the presence or absence of myr-p110α or HA-Gαq(Q209L). Cells were serumstarved overnight, and extracts were analyzed on a Western blot to detect phospho-Ser473 in Akt-Myc. (Akt-Myc migrated more slowly than wild-type endogenous Akt on SDS-polyacrylamide gels, so the two proteins were well separated on Western blots.) The level of Ser473 phosphorylation was strongly increased in cells expressing myr-p110α, and coexpression of HA-Gαq(Q209L) reduced the phosphorylation at this site (Fig. 2B, upper panel). Consistent with these results, Akt activity in Myc immunoprecipitates was 40% lower in cells expressing both myr-p110α and HA-Gαq(Q209L) than in cells expressing only myr-p110α (Fig. 2A). The blot was reprobed with antibodies to Myc, HA, and p110α to demonstrate that Akt-Myc, HA-Gαq(Q209L), and myr-p110α were appropriately expressed (Fig. 2B, lower three panels). Together, these results suggest that Gαq(Q209L) might have a direct inhibitory effect on PI3K, but not on Akt.Activated GαqInhibits p110α PI3K Activity—To further examine the effect of constitutively active Gαq on PI3K, a stable cell line that expresses untagged Gαq(Q209L) in a doxycycline-responsive manner was constructed using a commercially available system (see “Experimental Procedures”). Flp-in T-REx/HEK 293 cells containing the empty vector (control) or Gαq(Q209L) were treated overnight with 1 μm doxycycline. Western blotting of cell lysates using antibody to Gαq detected the wild-type endogenous protein in control cells and a stronger signal comprising the wild-type and mutant proteins in Gαq(Q209L) cells (Fig. 3A). Cell extracts were mixed with polyclonal antibody to either p110α or p110β, and the immunoprecipitates were assayed for PI3K activity. The activity in p110α immunoprecipitates from cells expressing Gαq(Q209L) was only 39% of that in immunoprecipitates from control cells (Fig. 3B). In contrast, PI3K activities in p110β immunoprecipitates from control cells and cells expressing Gαq(Q209L) were not significantly different (Fig. 3B). Western blotting showed that expression of the p110α and p110β proteins was the same in control and Gαq(Q209L) cells (Fig. 3A).Fig. 3Effect of Gαq(Q209L) on PI3K activity. Flp-in T-REx/HEK 293 cells containing Gαq(Q209L) or empty vector as a control were treated overnight with 1 μm doxycycline prior to making extracts. A, expression of Gαq(Q209L) was confirmed by Western blotting with antibody to Gαq (upper panel). The blot was reprobed with antibodies to p110α (middle panel) and p110β (lower panel). B, PI3K activity was assayed in p110α or p110β immunoprecipitates (IP). The autoradiogram shows a typical result from four independent experiments. Spots containing radioactive PI(3)P were scraped off the silica gel plates and quantitated by scintillation counting. Mean p110α activity in cells expressing Gαq(Q209L) was 39% of the activity in control cells containing the empty vector (S.E. = 2.3%; p < 0." @default.
• W1497446066 created "2016-06-24" @default.
• W1497446066 creator A5008203077 @default.
• W1497446066 creator A5034901082 @default.
• W1497446066 creator A5049800961 @default.
• W1497446066 creator A5063649172 @default.
• W1497446066 creator A5071013128 @default.
• W1497446066 date "2003-06-01" @default.
• W1497446066 modified "2023-10-16" @default.
• W1497446066 title "Activated Gαq Inhibits p110α Phosphatidylinositol 3-Kinase and Akt" @default.
• W1497446066 cites W1489654012 @default.
• W1497446066 cites W1496297920 @default.
• W1497446066 cites W1505075493 @default.
• W1497446066 cites W1565496454 @default.
• W1497446066 cites W1856121658 @default.
• W1497446066 cites W1970548320 @default.
• W1497446066 cites W1974981299 @default.
• W1497446066 cites W1976494080 @default.
• W1497446066 cites W1978810830 @default.
• W1497446066 cites W1984633752 @default.
• W1497446066 cites W1994860376 @default.
• W1497446066 cites W1994957003 @default.
• W1497446066 cites W2005339591 @default.
• W1497446066 cites W2006691521 @default.
• W1497446066 cites W2009650205 @default.
• W1497446066 cites W2016135608 @default.
• W1497446066 cites W2016388409 @default.
• W1497446066 cites W2017641447 @default.
• W1497446066 cites W2023585901 @default.
• W1497446066 cites W2024895303 @default.
• W1497446066 cites W2030338284 @default.
• W1497446066 cites W2038593831 @default.
• W1497446066 cites W2056982291 @default.
• W1497446066 cites W2064059449 @default.
• W1497446066 cites W2069405208 @default.
• W1497446066 cites W2078102222 @default.
• W1497446066 cites W2091083756 @default.
• W1497446066 cites W2093115609 @default.
• W1497446066 cites W2094068658 @default.
• W1497446066 cites W2125567150 @default.
• W1497446066 cites W2137238554 @default.
• W1497446066 cites W2145520734 @default.
• W1497446066 cites W2152186846 @default.
• W1497446066 cites W2154608911 @default.
• W1497446066 cites W2157982064 @default.
• W1497446066 cites W2159953124 @default.
• W1497446066 cites W2443009979 @default.
• W1497446066 cites W91266548 @default.
• W1497446066 doi "https://doi.org/10.1074/jbc.m212232200" @default.
• W1497446066 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12704201" @default.
• W1497446066 hasPublicationYear "2003" @default.
• W1497446066 type Work @default.
• W1497446066 sameAs 1497446066 @default.
• W1497446066 citedByCount "61" @default.
• W1497446066 countsByYear W14974460662012 @default.
• W1497446066 countsByYear W14974460662013 @default.
• W1497446066 countsByYear W14974460662014 @default.
• W1497446066 countsByYear W14974460662016 @default.
• W1497446066 countsByYear W14974460662017 @default.
• W1497446066 countsByYear W14974460662018 @default.
• W1497446066 countsByYear W14974460662019 @default.
• W1497446066 countsByYear W14974460662021 @default.
• W1497446066 countsByYear W14974460662023 @default.
• W1497446066 crossrefType "journal-article" @default.
• W1497446066 hasAuthorship W1497446066A5008203077 @default.
• W1497446066 hasAuthorship W1497446066A5034901082 @default.
• W1497446066 hasAuthorship W1497446066A5049800961 @default.
• W1497446066 hasAuthorship W1497446066A5063649172 @default.
• W1497446066 hasAuthorship W1497446066A5071013128 @default.
• W1497446066 hasBestOaLocation W14974460661 @default.
• W1497446066 hasConcept C184235292 @default.
• W1497446066 hasConcept C185592680 @default.
• W1497446066 hasConcept C2780610907 @default.
• W1497446066 hasConcept C55493867 @default.
• W1497446066 hasConcept C62478195 @default.
• W1497446066 hasConcept C75217442 @default.
• W1497446066 hasConcept C86803240 @default.
• W1497446066 hasConcept C95444343 @default.
• W1497446066 hasConceptScore W1497446066C184235292 @default.
• W1497446066 hasConceptScore W1497446066C185592680 @default.
• W1497446066 hasConceptScore W1497446066C2780610907 @default.
• W1497446066 hasConceptScore W1497446066C55493867 @default.
• W1497446066 hasConceptScore W1497446066C62478195 @default.
• W1497446066 hasConceptScore W1497446066C75217442 @default.
• W1497446066 hasConceptScore W1497446066C86803240 @default.
• W1497446066 hasConceptScore W1497446066C95444343 @default.
• W1497446066 hasIssue "26" @default.
• W1497446066 hasLocation W14974460661 @default.
• W1497446066 hasOpenAccess W1497446066 @default.
• W1497446066 hasPrimaryLocation W14974460661 @default.
• W1497446066 hasRelatedWork W1573935390 @default.
• W1497446066 hasRelatedWork W1589334735 @default.
• W1497446066 hasRelatedWork W2093177555 @default.
• W1497446066 hasRelatedWork W2104383425 @default.
• W1497446066 hasRelatedWork W2122818523 @default.
• W1497446066 hasRelatedWork W2306131653 @default.
• W1497446066 hasRelatedWork W2514937051 @default.
• W1497446066 hasRelatedWork W2528536172 @default.

• next