FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1522965187> ?p ?o ?g. }

• W1522965187 endingPage "16618" @default.
• W1522965187 startingPage "16607" @default.
• W1522965187 abstract "SET7/9 is an enzyme that methylates histone 3 at lysine 4 (H3K4) to maintain euchromatin architecture. Although SET7/9 is enriched in islets and contributes to the transactivation of β cell-specific genes, including Ins1 and Slc2a, SET7/9 has also been reported to bind the p65 subunit of nuclear factor κB in non-β cells and modify its transcriptional activity. Given that inflammation is a central component of β cell dysfunction in Type 1 and Type 2 diabetes, the aim of this study was to elucidate the role of SET7/9 in proinflammatory cytokine signaling in β cells. To induce inflammation, βTC3 insulinoma cells were treated with IL-1β, TNF-α, and IFN-γ. Cytokine treatment led to increased expression of inducible nitric-oxide synthase, which was attenuated by the diminution of SET7/9 using RNA interference. Consistent with previous reports, SET7/9 was co-immunoprecipitated with p65 and underwent cytosolic to nuclear translocation in response to cytokines. ChIP analysis demonstrated augmented H3K4 mono- and dimethylation of the proximal Nos2 promoter with cytokine exposure. SET7/9 was found to occupy this same region, whereas SET7/9 knockdown attenuated cytokine-induced histone methylation of the Nos2 gene. To test this relationship further, islets were isolated from SET7/9-deficient and wild-type mice and treated with IL-1β, TNF-α, and IFN-γ. Cytokine-induced Nos2 expression was reduced in the islets from SET7/9 knock-out mice. Together, our findings suggest that SET7/9 contributes to Nos2 transcription and proinflammatory cytokine signaling in the pancreatic β cell through activating histone modifications. SET7/9 is an enzyme that methylates histone 3 at lysine 4 (H3K4) to maintain euchromatin architecture. Although SET7/9 is enriched in islets and contributes to the transactivation of β cell-specific genes, including Ins1 and Slc2a, SET7/9 has also been reported to bind the p65 subunit of nuclear factor κB in non-β cells and modify its transcriptional activity. Given that inflammation is a central component of β cell dysfunction in Type 1 and Type 2 diabetes, the aim of this study was to elucidate the role of SET7/9 in proinflammatory cytokine signaling in β cells. To induce inflammation, βTC3 insulinoma cells were treated with IL-1β, TNF-α, and IFN-γ. Cytokine treatment led to increased expression of inducible nitric-oxide synthase, which was attenuated by the diminution of SET7/9 using RNA interference. Consistent with previous reports, SET7/9 was co-immunoprecipitated with p65 and underwent cytosolic to nuclear translocation in response to cytokines. ChIP analysis demonstrated augmented H3K4 mono- and dimethylation of the proximal Nos2 promoter with cytokine exposure. SET7/9 was found to occupy this same region, whereas SET7/9 knockdown attenuated cytokine-induced histone methylation of the Nos2 gene. To test this relationship further, islets were isolated from SET7/9-deficient and wild-type mice and treated with IL-1β, TNF-α, and IFN-γ. Cytokine-induced Nos2 expression was reduced in the islets from SET7/9 knock-out mice. Together, our findings suggest that SET7/9 contributes to Nos2 transcription and proinflammatory cytokine signaling in the pancreatic β cell through activating histone modifications. Glucose homeostasis is maintained in response to nutrient intake through finely tuned insulin secretion from the pancreatic β cells that is exquisitely coupled to the demands of insulin-sensitive organs, including muscle, liver, and adipose tissue. Impairments in glucose homeostasis result in the development of hyperglycemia and diabetes mellitus of which there are two main forms. Although the etiologies of Type 1 diabetes (T1D) 3The abbreviations used are: T1DType 1 diabetesT2DType 2 diabetesH3K4histone 3 at lysine 4iNOSinducible nitric-oxide synthaseH3histone 3TBPTATA-binding proteinqRT-PCRquantitative RT-PCRRIPAradioimmune precipitation assay. and Type 2 diabetes (T2D) are distinct, increasing evidence suggests a primary role for β cell dysfunction arising from inflammation in both disorders. T1D occurs as a result of loss of self-tolerance, activation of innate and adaptive immunity, and immune cell infiltration into islets, all eventually culminating in T cell-mediated destruction of the pancreatic β cell (1Roep B.O. Tree T.I. Immune modulation in humans: implications for type 1 diabetes mellitus.Nat. Rev. Endocrinol. 2014; 10: 229-242Crossref PubMed Scopus (105) Google Scholar, 2Eizirik D.L. Mandrup-Poulsen T. A choice of death—the signal-transduction of immune-mediated β-cell apoptosis.Diabetologia. 2001; 44: 2115-2133Crossref PubMed Scopus (738) Google Scholar). In contrast, T2D arises from impaired peripheral insulin sensitivity and progressive β cell dysfunction. Recently, T2D-associated metabolic dysfunction has been linked to macrophage infiltration of a variety of metabolic tissues, including the pancreatic islets (3Donath M.Y. Dalmas É. Sauter N.S. Böni-Schnetzler M. Inflammation in obesity and diabetes: islet dysfunction and therapeutic opportunity.Cell Metab. 2013; 17: 860-872Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 4Ehses J.A. Perren A. Eppler E. Ribaux P. Pospisilik J.A. Maor-Cahn R. Gueripel X. Ellingsgaard H. Schneider M.K. Biollaz G. Fontana A. Reinecke M. Homo-Delarche F. Donath M.Y. Increased number of islet-associated macrophages in type 2 diabetes.Diabetes. 2007; 56: 2356-2370Crossref PubMed Scopus (559) Google Scholar5Richardson S.J. Willcox A. Bone A.J. Foulis A.K. Morgan N.G. Islet-associated macrophages in type 2 diabetes.Diabetologia. 2009; 52: 1686-1688Crossref PubMed Scopus (178) Google Scholar). Local and systemic elevations of proinflammatory cytokines lead to the activation of deleterious signaling cascades within the β cell, including those regulated by NF-κB, JAK, and STAT1 (6Gysemans C. Callewaert H. Overbergh L. Mathieu C. Cytokine signalling in the β-cell: a dual role for IFNγ.Biochem. Soc. Trans. 2008; 36: 328-333Crossref PubMed Scopus (57) Google Scholar, 7Eizirik D.L. Colli M.L. Ortis F. The role of inflammation in insulitis and β-cell loss in type 1 diabetes.Nat. Rev. Endocrinol. 2009; 5: 219-226Crossref PubMed Scopus (736) Google Scholar). The NOS2 gene is a key downstream target of NF-κB, leading to translation of inducible nitric-oxide synthase (iNOS) and the catalysis of l-arginine to produce nitric oxide (NO). In both T1D and T2D, NO-supplied reactive oxygen species contribute to mitochondrial dysfunction, impacting cellular energy status, glucose-stimulated insulin secretion, and ultimately β cell survival (8Eizirik D.L. Sandler S. Hallberg A. Bendtzen K. Sener A. Malaisse W.J. Differential sensitivity to β-cell secretagogues in cultured rat pancreatic islets exposed to human interleukin-1β.Endocrinology. 1989; 125: 752-759Crossref PubMed Scopus (57) Google Scholar9Corbett J.A. Wang J.L. Hughes J.H. Wolf B.A. Sweetland M.A. Lancaster Jr., J.R. McDaniel M.L. Nitric oxide and cyclic GMP formation induced by interleukin 1β in islets of Langerhans. Evidence for an effector role of nitric oxide in islet dysfunction.Biochem. J. 1992; 287: 229-235Crossref PubMed Scopus (135) Google Scholar, 10Corbett J.A. Wang J.L. Sweetland M.A. Lancaster Jr., J.R. McDaniel M.L. Interleukin 1β induces the formation of nitric oxide by β-cells purified from rodent islets of Langerhans. Evidence for the β-cell as a source and site of action of nitric oxide.J. Clin. Investig. 1992; 90: 2384-2391Crossref PubMed Scopus (298) Google Scholar, 11Comens P.G. Wolf B.A. Unanue E.R. Lacy P.E. McDaniel M.L. Interleukin 1 is potent modulator of insulin secretion from isolated rat islets of Langerhans.Diabetes. 1987; 36: 963-970Crossref PubMed Scopus (137) Google Scholar, 12Corbett J.A. Sweetland M.A. Wang J.L. Lancaster Jr., J.R. McDaniel M.L. Nitric oxide mediates cytokine-induced inhibition of insulin secretion by human islets of Langerhans.Proc. Natl. Acad. Sci. U.S.A. 1993; 90: 1731-1735Crossref PubMed Scopus (403) Google Scholar13Shimabukuro M. Ohneda M. Lee Y. Unger R.H. Role of nitric oxide in obesity-induced β cell disease.J. Clin. Investig. 1997; 100: 290-295Crossref PubMed Scopus (254) Google Scholar). Because the inflammatory response responsible for NO generation could be a potential target to treat diabetes mellitus, an improved understanding of the transcriptional pathways that regulate iNOS production is needed. Type 1 diabetes Type 2 diabetes histone 3 at lysine 4 inducible nitric-oxide synthase histone 3 TATA-binding protein quantitative RT-PCR radioimmune precipitation assay. Gene transcription is regulated epigenetically through alterations in patterns of DNA methylation and covalent histone modifications that either promote or restrict the accessibility of components of the transcriptional machinery to gene promoters (14Li B. Carey M. Workman J.L. The role of chromatin during transcription.Cell. 2007; 128: 707-719Abstract Full Text Full Text PDF PubMed Scopus (2677) Google Scholar, 15Berger S.L. The complex language of chromatin regulation during transcription.Nature. 2007; 447: 407-412Crossref PubMed Scopus (2146) Google Scholar). SET7/9 is a SET (Su(var)3–9, Enhancer-of-zeste, Trithorax) domain-containing enzyme that exhibits methyltransferase activity and promotes open chromatin architecture and target gene expression through methylation of histone 3 at lysine 4 (H3K4) (16Nishioka K. Chuikov S. Sarma K. Erdjument-Bromage H. Allis C.D. Tempst P. Reinberg D. Set9, a novel histone H3 methyltransferase that facilitates transcription by precluding histone tail modifications required for heterochromatin formation.Genes Dev. 2002; 16: 479-489Crossref PubMed Scopus (454) Google Scholar). In addition to its activity as a histone methyltransferase, SET7/9 is also known to methylate lysine residues of non-histone proteins, including TAF10, pRB, p53, and the estrogen and androgen receptors, where SET7/9-mediated methylation has been shown to regulate target protein stability and/or activity (17Kouskouti A. Scheer E. Staub A. Tora L. Talianidis I. Gene-specific modulation of TAF10 function by SET9-mediated methylation.Mol. Cell. 2004; 14: 175-182Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar18Munro S. Khaire N. Inche A. Carr S. La Thangue N.B. Lysine methylation regulates the pRb tumour suppressor protein.Oncogene. 2010; 29: 2357-2367Crossref PubMed Scopus (87) Google Scholar, 19Chuikov S. Kurash J.K. Wilson J.R. Xiao B. Justin N. Ivanov G.S. McKinney K. Tempst P. Prives C. Gamblin S.J. Barlev N.A. Reinberg D. Regulation of p53 activity through lysine methylation.Nature. 2004; 432: 353-360Crossref PubMed Scopus (631) Google Scholar, 20Subramanian K. Jia D. Kapoor-Vazirani P. Powell D.R. Collins R.E. Sharma D. Peng J. Cheng X. Vertino P.M. Regulation of estrogen receptor α by the SET7 lysine methyltransferase.Mol. Cell. 2008; 30: 336-347Abstract Full Text Full Text PDF PubMed Scopus (226) Google Scholar21Ko S. Ahn J. Song C.S. Kim S. Knapczyk-Stwora K. Chatterjee B. Lysine methylation and functional modulation of androgen receptor by Set9 methyltransferase.Mol. Endocrinol. 2011; 25: 433-444Crossref PubMed Scopus (65) Google Scholar). Previously, we have shown that SET7/9 is enriched in rodent and human islets and methylates H3K4 in a number of β cell-specific genes, including Ins1 and Slc2a2. Furthermore, mice with attenuated islet SET7/9 expression exhibited glucose intolerance and impaired glucose-stimulated insulin secretion (22Deering T.G. Ogihara T. Trace A.P. Maier B. Mirmira R.G. Methyltransferase Set7/9 maintains transcription and euchromatin structure at islet-enriched genes.Diabetes. 2009; 58: 185-193Crossref PubMed Scopus (95) Google Scholar, 23Maganti A.V. Maier B. Tersey S.A. Sampley M.L. Mosley A.L. Özcan S. Pachaiyappan B. Woster P.M. Hunter C.S. Stein R. Mirmira R.G. Transcriptional activity of the islet β cell factor Pdx1 is augmented by lysine methylation catalyzed by the methyltransferase Set7/9.J. Biol. Chem. 2015; 290: 9812-9822Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar). However, several groups have also shown that SET7/9 contributes to inflammation through interactions with components of the NF-κB signaling cascade. In monocytes, SET7/9 forms a complex with NF-κB and is recruited specifically to the CCL2 and TNFA promoters where it methylates H3K4 (24Li Y. Reddy M.A. Miao F. Shanmugam N. Yee J.K. Hawkins D. Ren B. Natarajan R. Role of the histone H3 lysine 4 methyltransferase, SET7/9, in the regulation of NF-κB-dependent inflammatory genes. Relevance to diabetes and inflammation.J. Biol. Chem. 2008; 283: 26771-26781Abstract Full Text Full Text PDF PubMed Scopus (287) Google Scholar). In mouse embryonic fibroblast cells, SET7/9 has also been shown to methylate Lys-37 of the p65 subunit of NF-κB and up-regulate NF-κB transcriptional activity (25Ea C.K. Baltimore D. Regulation of NF-κB activity through lysine monomethylation of p65.Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 18972-18977Crossref PubMed Scopus (178) Google Scholar). In contrast, in human osteosarcoma cells, p65 is methylated at lysine residues 314 and 315, leading to its ubiquitination and degradation and subsequent down-regulation of NF-κB activity (26Yang X.D. Huang B. Li M. Lamb A. Kelleher N.L. Chen L.F. Negative regulation of NF-λB action by Set9-mediated lysine methylation of the RelA subunit.EMBO J. 2009; 28: 1055-1066Crossref PubMed Scopus (163) Google Scholar). Therefore, the effects of SET7/9 on NF-κB activity remain controversial. Moreover, at present, the role of SET7/9 in the pathogenesis of islet inflammation has not been explored. In this report, we investigate the role of SET7/9 in cytokine-induced inflammatory gene expression and β cell apoptosis. Our results show that SET7/9 interacts with NF-κB and is recruited to and enhances cytokine-induced H3K4 methylation of the Nos2 promoter. Diminution of SET7/9 attenuates cytokine-induced iNOS expression as well as apoptosis in a murine insulinoma cell. Furthermore, we show that cytokine-induced Nos2 expression was reduced in islets isolated from SET7/9 knock-out mice compared with wild-type mice. Together, these data suggest a novel role for SET7/9 in the regulation of proinflammatory β cell gene expression. Monoclonal antibodies against SET7/9 were obtained from Epitomics (5131-1) and LifeSpan BioSciences (LS-C138726). Polyclonal antibodies against dimethyl-H3 Lys-4 (07-030), monomethyl-H3 Lys-4 (07-436), and iNOS (06-573) were obtained from Millipore. Polyclonal antibodies against p65 (ab7970) and TATA-binding protein (TBP) (ab63766) were obtained from Abcam. A polyclonal antibody against cleaved caspase-3 (9661) and a monoclonal antibody for p53 (2524) were from Cell Signaling Technology. Anti-FLAG® M2 affinity gel was obtained from Sigma-Aldrich. Mouse TNF-α, mouse IL-1β, and mouse IFN-γ were obtained from PeproTech. βTC3 mouse insulinoma cells were maintained in high glucose Dulbecco's modified Eagle's medium supplemented with 15% horse serum, 2.5% fetal bovine serum (FBS), and 1% penicillin/streptomycin. MIN6 mouse insulinoma cells were maintained in high glucose Dulbecco's modified Eagle's medium supplemented with 15% FBS, 10 mm HEPES, and 1% penicillin/streptomycin. βTC3 cells were treated with or without a mixture of cytokines that included 5 ng/ml IL-1β, 10 ng/ml TNF-α, and 100 ng/ml IFN-γ. Stealth RNAiTM siRNAs against Setd7 (si-Set7/9) or non-targeting sequences (si-scramble) were purchased from Life Technologies and transfected into βTC3 cells and MIN6 cells using Lipofectamine RNAiMAX transfection reagent (Life Technologies) according to the manufacturer's instructions. Ninety-six hours after transfection, cells were treated with or without a cytokine mixture for the indicated times. siRNA sequences used were as follows: si-Set7/9, 5′-CCUGGACGAGGAGACAGUCAUUGAU-3′; si-scramble, 5′-UAAAUGUACUGCGCGUGGAGAGGAA-3′. βTC3 cells (7 × 105) were seeded in 6-well plates, transfected with si-Set7/9 or si-scramble, and treated with cytokines 96 h after transfection. Total RNA was isolated from βTC3 cells using the RNeasy® kit (Qiagen) and subjected to cDNA synthesis using SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions. PCR mixtures were prepared using Fast SYBR Green Master Mix (Life Technologies), and qRT-PCR was performed using the 7300 real time PCR system (Applied Biosystems). Forward and reverse primers used for quantitative RT-PCR are listed in Table 1.TABLE 1The primer sequences for quantitative PCRGeneForward sequencesReverse sequencesPrimers for RT-PCRTbpGCTGCAGTCATCATGAGAATAAGAGCACCATGTTCTGGATCTTGAAGTSetd7GGCCGGTCCATTCAGCTCTCCGCAGGGCCAGGGCGTTTACANos2CACCACAAGGCCACATCGGATTCCGACCTGATGTTGCCATTGTTTnfaGGCAGGTCTACTTTGGAGTCATTGCACATTCGAGGCTCCAGTGAATTCGGSod2CTCCCGGCACAAGCACAGCCGCGCGTTAATGTGTGGCTCCABaxTCTCCGGCGAATTGGAGATGCGTGTCCACGTCAGCAATCAPtenCTGGGCTCTGGACCATACACAGCAGCCAATCTCTCGGATGTnfrsf6AGAAGATGCACACTCTGCGAGGTATTCTGGGTCAGGGTGCCdkn1aCAGCTCAGTGGACTGGAAGGCTGTCTCACCACCAAGGACCPrimers for ChIP assayβ-galTCAATCCGCCGTTTGTTCCCACTCCAGATAACTGCCGTCACTCCAACProximal Nos2TCACTCAGCACAGCCCATCCACTATGGAAGGCAAGCTGTGGGCANos2 −5 kbTCCTTGCTCTGAAGGGCATCGCTCACAGACCACGGATGAANos2 +1 kbCGCCAAGGAGAAGCCACATATTGGGAGTCATCACGCATCCProximal TnfaGCCAGCCAGCAGAAGCTCCCGCGCCTTGGGCCAGTGAGTGTnfa −5 kbAGTGCTCAGAACCCTAAGCCCATGTGTGAGCCCCTGAGTCTnfa +1 kbTCGAGCCAGGCTGAGAAAAGGCAGCTACCCACACTTCACTProximal Sod2ACACGCAAACCTGCGACGTGAGCCAAGGCTCTGCTGCTGGTSod2 −5 kbGGAGCATGCTAGCTTCTGGACTTCCCAGTCACCGTTGTCASod2 +1 kbAGCTAGCATTGGTGGTGGTCAAACTCTCCTGAAGCCACGTAlbTGGGAAAACTGGGAAAACCATCCACTCTCACACATACACTCCTGCTG Open table in a new tab For isolation of total protein, βTC3 cells were washed twice with PBS and then lysed by adding RIPA buffer containing 140 mm NaCl, 20 mm Tris, 1 mm EDTA, 50 mm NaF, 2 mm MgCl2, 1 mm PMSF, 25 units/ml Benzonase, and 1× HaltTM protease-phosphatase inhibitor mixture. Cytosolic and nuclear fractions were prepared as described previously (27Sadowski H.B. Shuai K. Darnell Jr., J.E. Gilman M.Z. A common nuclear signal transduction pathway activated by growth factor and cytokine receptors.Science. 1993; 261: 1739-1744Crossref PubMed Scopus (640) Google Scholar). Approximately 20 μg of total protein, 20 μg of the cytosolic fraction, or 10 μg of the nuclear fraction were separated in 12% SDS-polyacrylamide gels, transferred to a polyvinylidene fluoride membrane, and incubated with antibodies against SET7/9, iNOS, p65, cleaved caspase-3, p53, β-actin, or TBP. Bound primary antibodies were detected with peroxidase-coupled secondary mouse or rabbit antibodies and IRDye®-conjugated secondary mouse or rabbit antibody. Immunoblots were visualized using the Odyssey (LI-COR Biosciences), LAS-3000 (Fuji Film) with ECL-PlusTM (Amersham Biosciences), or a SuperSignal West Pico system (Pierce). Approximately 1 × 106 βTC3 cells were treated with the cytokine mixture for 20 h, single cell-suspended using trypsin/EDTA, and washed twice with PBS. Apoptosis analysis was performed using an Annexin V-FITC/PI Apoptosis Detection kit (Merck Millipore) according to the manufacturer's instructions. Fluorescence-labeled cells were analyzed using a BD FACSCalibur HGTM flow cytometer and BD CellQuest Pro software version 6.0 (BD Biosciences). βTC3 cells treated without cytokines were used as a negative control. βTC3 cells treated with 150 μm hydrogen peroxide were used for the gating of Annexin V to detect apoptotic cells. A/G Mag Sepharose (GE Healthcare) was preincubated with anti-SET7/9 antibody or mouse IgG, transferred into 500 μl of RIPA buffer containing 500 μg of total protein, incubated at 4 °C for 2 h, and washed three times with RIPA buffer. Approximately 1 × 107 βTC3 cells were seeded in a 10-cm dish for 24 h before transfection. Cells were next transfected with 10 μg of an expression plasmid for FLAG-SET7/9 (16Nishioka K. Chuikov S. Sarma K. Erdjument-Bromage H. Allis C.D. Tempst P. Reinberg D. Set9, a novel histone H3 methyltransferase that facilitates transcription by precluding histone tail modifications required for heterochromatin formation.Genes Dev. 2002; 16: 479-489Crossref PubMed Scopus (454) Google Scholar) or an empty vector using Effectene (Qiagen) according to the manufacturer's instructions. Total protein was obtained using RIPA buffer, immunoprecipitated with anti-FLAG M2 affinity gel at 4 °C for 2 h, and washed three times with RIPA buffer. Eluted proteins were subjected to immunoblotting as described previously. Chromatin immunoprecipitation (ChIP) assays were performed as described previously (28Chakrabarti S.K. James J.C. Mirmira R.G. Quantitative assessment of gene targeting in vitro and in vivo by the pancreatic transcription factor, Pdx1. Importance of chromatin structure in directing promoter binding.J. Biol. Chem. 2002; 277: 13286-13293Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). Briefly, ∼2 × 107 βTC3 cells were treated with 1% formaldehyde to cross-link protein to DNA. Chromatin was next fragmented by sonication using a Q500 Sonicator (QSonica) and then immunoprecipitated with anti-monomethyl-H3 Lys-4 or anti-dimethyl-H3 Lys-4 antibodies or normal rabbit serum. DNA fragments extracted from immunoprecipitated protein and DNA complexes were subjected to quantitative PCR as described. Forward and reverse primers used for PCR are listed in Table 1. Setd7-deficient mice were established and provided by the laboratory of Dr. Danny Reinberg (New York University). Animal studies were performed under protocols approved by the Indiana University School of Medicine Animal Care and Use Committee. Islets were isolated following collagenase digestion of the pancreas as described previously (29Stull N.D. Breite A. McCarthy R. Tersey S.A. Mirmira R.G. Mouse islet of Langerhans isolation using a combination of purified collagenase and neutral protease.J. Vis. Exp. 2012; 67: e4137Google Scholar) and maintained in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin. Islets were treated with or without a mixture of cytokines for 4 h and then harvested for mRNA isolation. All data are presented as the means ± S.E. Student's t tests were used for comparisons involving two conditions. Differences between groups were analyzed for significance using one-way analysis of variance with multiple comparisons and a Tukey-Kramer post-test. Statistical significance was assumed at p < 0.05. To investigate the role of SET7/9 in inflammatory signaling in the β cell, the gene encoding SET7/9 (Setd7) was first knocked down using RNA interference. Setd7 mRNA levels were reduced by ∼75%, whereas protein levels were reduced by 60% in βTC3 cells treated with an siRNA against Setd7 (si-Set7/9) compared with those treated with an siRNA for a nonspecific target (si-scramble) (Fig. 1, A and B). Next, βTC3 cells were treated with a mixture of proinflammatory cytokines that included 10 ng/ml TNF-α, 5 ng/ml IL-1β, and 100 ng/ml IFN-γ. Consistent with previous reports using rodent islets and rat insulinoma cell lines (30Eizirik D.L. Cagliero E. Björklund A. Welsh N. Interleukin-1β induces the expression of an isoform of nitric oxide synthase in insulin-producing cells, which is similar to that observed in activated macrophages.FEBS Lett. 1992; 308: 249-252Crossref PubMed Scopus (117) Google Scholar, 31Corbett J.A. Kwon G. Misko T.P. Rodi C.P. McDaniel M.L. Tyrosine kinase involvement in IL-1β-induced expression of iNOS by β-cells purified from islets of Langerhans.Am. J. Physiol. Cell Physiol. 1994; 267: C48-C54Crossref PubMed Google Scholar), cytokine treatment led to increased expression of NF-κB target genes, including Nos2, Tnfa, and Sod2 (Fig. 1B). Diminution of SET7/9 expression attenuated cytokine-induced Nos2 mRNA expression as well as elevations in iNOS protein levels (Fig. 1, B and C). Interestingly, SET7/9 knockdown had no effect on the NF-κB target genes Tnfa and Sod2. To rule out potential off-target effects of si-Set7/9, we transfected different sequences of siRNA for Setd7 (si-Set7/9B), and results were similar (Fig. 2A). Furthermore, we performed SET7/9 depletion in a second mouse β cell line, MIN6 cells, and confirmed that SET7/9 knockdown led to a preferential inhibition of cytokine-induced expression of Nos2 (Fig. 2B).FIGURE 2SET7/9 knockdown attenuates cytokine-induced Nos2 expression in mouse MIN6 cells. A, 96 h after transfection with si-scramble, si-Set7/9, or si-Set7/9B (5′-AUAAGGGUCUGGAAGGAGAGCAUCG-3′), βTC3 cells were treated with or without cytokines (5 ng/ml IL-1β, 10 ng/ml TNF-α, and 100 ng/ml IFN-γ) for 4 h. Total RNA was isolated and subjected to qRT-PCR. B, after transfection with si-scramble or si-Set7/9, MIN6 cells were treated with a mixture of cytokines for 4 h. Total RNA was isolated, and the expression of NF-κB target genes was determined by qRT-PCR. The expression level of RNA was normalized to Tbp expression. Data represent the average of four independent transfections. * indicates a statistical difference (p < 0.05) compared with βTC3 cells transfected with si-scramble. Results are displayed as the means ± S.E. (error bars).View Large Image Figure ViewerDownload Hi-res image Download (PPT) To determine whether SET7/9 knockdown protected against cytokine and nitric oxide-induced β cell apoptosis, βTC3 cells were stained with Annexin V, and apoptotic cells were counted using flow cytometry. Treatment with cytokines for 20 h increased apoptotic cells, whereas SET7/9 knockdown significantly attenuated cytokine-induced apoptosis (si-Set7/9, 15.37 ± 1.02% versus si-scramble, 26.87 ± 1.12%) (Fig. 3, A and B). Furthermore, cytokine treatment increased expression of cleaved caspase-3, an effect that was partially reversed by knockdown of SET7/9 (Fig. 3C). Because p53 is a crucial regulator of apoptosis that has been shown to be stabilized by SET7/9-induced lysine methylation (19Chuikov S. Kurash J.K. Wilson J.R. Xiao B. Justin N. Ivanov G.S. McKinney K. Tempst P. Prives C. Gamblin S.J. Barlev N.A. Reinberg D. Regulation of p53 activity through lysine methylation.Nature. 2004; 432: 353-360Crossref PubMed Scopus (631) Google Scholar, 32Ivanov G.S. Ivanova T. Kurash J. Ivanov A. Chuikov S. Gizatullin F. Herrera-Medina E.M. Rauscher 3rd, F. Reinberg D. Barlev N.A. Methylation-acetylation interplay activates p53 in response to DNA damage.Mol. Cell. Biol. 2007; 27: 6756-6769Crossref PubMed Scopus (150) Google Scholar), we next evaluated the expression of p53 and its downstream targets. Although SET7/9 knockdown decreased cleaved caspase-3 levels, expression of p53 (Fig. 1C) or p53 target genes, including p21 (gene symbol Cdkn1a), Pten, Fas (gene symbol Tnfrsf6), and Bax, was not decreased 4 h after cytokine treatment (Fig. 3D). Yang et al. (26Yang X.D. Huang B. Li M. Lamb A. Kelleher N.L. Chen L.F. Negative regulation of NF-λB action by Set9-mediated lysine methylation of the RelA subunit.EMBO J. 2009; 28: 1055-1066Crossref PubMed Scopus (163) Google Scholar) have shown that SET7/9 methylates the p65 subunit of NF-κB, leading to p65 ubiquitination and degradation. To evaluate whether SET7/9 regulates NF-κB protein stability in β cells, total protein from βTC3 cells was isolated before and after cytokine treatment, and immunoblotting for the p65 subunit of NF-κB was performed. SET7/9 knockdown had no effect on total p65 protein levels in βTC3 cells (Fig. 1C), indicating that SET7/9 does not regulate NF-κB protein stability in β cells. SET7/9 has also been shown to shuttle between the nucleus and cytosol in response to various stimuli (33Evans-Molina C. Robbins R.D. Kono T. Tersey S.A. Vestermark G.L. Nunemaker C.S. Garmey J.C. Deering T.G. Keller S.R. Maier B. Mirmira R.G. Peroxisome proliferator-activated receptor γ activation restores islet function in diabetic mice through reduction of endoplasmic reticulum stress and maintenance of euchromatin structure.Mol. Cell. Biol. 2009; 29: 2053-2067Crossref PubMed Scopus (116) Google Scholar, 34Okabe J. Orlowski C. Balcerczyk A. Tikellis C. Thomas M.C. Cooper M.E. El-Osta A. Distinguishing hyperglycemic changes by Set7 in vascular endothelial cells.Circ. Res. 2012; 110: 1067-1076Crossref PubMed Scopus (116) Google Scholar). To investigate the effect of cytokines on SET7/9 intracellular distribution, SET7/9 content was evaluated in total, nuclear, and cytosolic fractions isolated from βTC3 cells before and after cytokine treatment. Consistent with a previous study performed in THP1 cells (24Li Y. Reddy M.A. Miao F. Shanmugam N. Yee J.K. Hawkins D. Ren B. Natarajan R. Role of the histone H3 lysine 4 methyltransferase, SET7/9, in the regulation of NF-κB-dependent inflammatory genes. Relevance to diabetes and inflammation.J. Biol. Chem. 2008; 283: 26771-26781Abstract Full Text Full Text PDF PubMed Scopus (287) Google Scholar), p65 translocated into the nucleus in response to cytokine treatment, and this was unaffected by SET7/9 knockdown (Fig. 4, A and B). In response to cytokine treatment, SET7/9 significantly increased in the nuclear fraction and decreased in the cytosolic fraction, indicating that proinflammatory cytokines induced translocation of SET7/9 into the nucleus (Fig. 4, A and C). SET7/9 is known to form a complex with p65 in non-β cells (24Li Y. Reddy M.A. Miao F. Shanmugam N. Yee J.K. Hawkins D. Ren B. Natarajan R. Role of the histone H3 lysine 4 methyltransferase, SET7/9, in the regulation of NF-κB-dependent inflammatory genes. Relevance to diabetes and inflammation.J. Biol. Chem. 2008; 283: 26771-26781Abstract Full Text Full Text PDF PubMed Scopus (287) Google Scholar, 25Ea C.K. Baltimore D. Regulation of NF-κB activity through lysine monomethylation" @default.
• W1522965187 created "2016-06-24" @default.
• W1522965187 creator A5001816827 @default.
• W1522965187 creator A5004075617 @default.
• W1522965187 creator A5017309843 @default.
• W1522965187 creator A5027831207 @default.
• W1522965187 creator A5031560696 @default.
• W1522965187 creator A5043895658 @default.
• W1522965187 creator A5058286384 @default.
• W1522965187 creator A5063131669 @default.
• W1522965187 creator A5087176674 @default.
• W1522965187 date "2015-07-01" @default.
• W1522965187 modified "2023-10-14" @default.
• W1522965187 title "SET7/9 Enzyme Regulates Cytokine-induced Expression of Inducible Nitric-oxide Synthase through Methylation of Lysine 4 at Histone 3 in the Islet β Cell" @default.
• W1522965187 cites W1967738557 @default.
• W1522965187 cites W1972272933 @default.
• W1522965187 cites W1986025611 @default.
• W1522965187 cites W2003119912 @default.
• W1522965187 cites W2005212414 @default.
• W1522965187 cites W2007684630 @default.
• W1522965187 cites W2011380521 @default.
• W1522965187 cites W2015416439 @default.
• W1522965187 cites W2018866981 @default.
• W1522965187 cites W2020808779 @default.
• W1522965187 cites W2026152957 @default.
• W1522965187 cites W2032165583 @default.
• W1522965187 cites W2034104594 @default.
• W1522965187 cites W2034974668 @default.
• W1522965187 cites W2035381044 @default.
• W1522965187 cites W2037687350 @default.
• W1522965187 cites W2037884311 @default.
• W1522965187 cites W2053963810 @default.
• W1522965187 cites W2058272773 @default.
• W1522965187 cites W2065431340 @default.
• W1522965187 cites W2072031497 @default.
• W1522965187 cites W2084885369 @default.
• W1522965187 cites W2089072284 @default.
• W1522965187 cites W2089689396 @default.
• W1522965187 cites W2089934054 @default.
• W1522965187 cites W2102397932 @default.
• W1522965187 cites W2102782172 @default.
• W1522965187 cites W2110588521 @default.
• W1522965187 cites W2110617730 @default.
• W1522965187 cites W2113145530 @default.
• W1522965187 cites W2115630484 @default.
• W1522965187 cites W2116818563 @default.
• W1522965187 cites W2120594989 @default.
• W1522965187 cites W2121053402 @default.
• W1522965187 cites W2129098267 @default.
• W1522965187 cites W2131161522 @default.
• W1522965187 cites W2133452708 @default.
• W1522965187 cites W2143182465 @default.
• W1522965187 cites W2156990969 @default.
• W1522965187 cites W2163002796 @default.
• W1522965187 cites W2171365253 @default.
• W1522965187 cites W2220441132 @default.
• W1522965187 cites W2401604147 @default.
• W1522965187 cites W3175311133 @default.
• W1522965187 doi "https://doi.org/10.1074/jbc.m115.661777" @default.
• W1522965187 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4505414" @default.
• W1522965187 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/25995453" @default.
• W1522965187 hasPublicationYear "2015" @default.
• W1522965187 type Work @default.
• W1522965187 sameAs 1522965187 @default.
• W1522965187 citedByCount "22" @default.
• W1522965187 countsByYear W15229651872015 @default.
• W1522965187 countsByYear W15229651872016 @default.
• W1522965187 countsByYear W15229651872017 @default.
• W1522965187 countsByYear W15229651872018 @default.
• W1522965187 countsByYear W15229651872019 @default.
• W1522965187 countsByYear W15229651872020 @default.
• W1522965187 countsByYear W15229651872021 @default.
• W1522965187 countsByYear W15229651872022 @default.
• W1522965187 countsByYear W15229651872023 @default.
• W1522965187 crossrefType "journal-article" @default.
• W1522965187 hasAuthorship W1522965187A5001816827 @default.
• W1522965187 hasAuthorship W1522965187A5004075617 @default.
• W1522965187 hasAuthorship W1522965187A5017309843 @default.
• W1522965187 hasAuthorship W1522965187A5027831207 @default.
• W1522965187 hasAuthorship W1522965187A5031560696 @default.
• W1522965187 hasAuthorship W1522965187A5043895658 @default.
• W1522965187 hasAuthorship W1522965187A5058286384 @default.
• W1522965187 hasAuthorship W1522965187A5063131669 @default.
• W1522965187 hasAuthorship W1522965187A5087176674 @default.
• W1522965187 hasBestOaLocation W15229651871 @default.
• W1522965187 hasConcept C104317684 @default.
• W1522965187 hasConcept C119157956 @default.
• W1522965187 hasConcept C134018914 @default.
• W1522965187 hasConcept C153911025 @default.
• W1522965187 hasConcept C164007495 @default.
• W1522965187 hasConcept C165220095 @default.
• W1522965187 hasConcept C178790620 @default.
• W1522965187 hasConcept C181199279 @default.
• W1522965187 hasConcept C185592680 @default.
• W1522965187 hasConcept C2776016237 @default.
• W1522965187 hasConcept C2777468819 @default.
• W1522965187 hasConcept C2777622882 @default.
• W1522965187 hasConcept C2779306644 @default.

• next