FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1527045449> ?p ?o ?g. }

• W1527045449 endingPage "285" @default.
• W1527045449 startingPage "284" @default.
• W1527045449 abstract "In 2003, we carried out a field survey in order to investigate the significance of sub-clinical tickborne bacterial infections in African dogs from the Ivory Coast (n = 137) and Gabon (n = 255). So far, only limited data on this topic are available in Africa when compared with the USA and Europe, and in most of the cases, serological techniques have been applied [1Davoust B Bourry O Gomez J et al.Surveys on seroprevalence of canine monocytic ehrlichiosis among dogs living in the Ivory Coast and Gabon and evaluation of a quick commercial test kit dot-ELISA.Ann N Y Acad Sci. 2006; 1078: 464-469Crossref PubMed Scopus (11) Google Scholar]. In this study, we used PCR amplification and DNA sequencing to screen different tick-borne bacterial pathogens in the blood of dogs. The dogs from the Ivory Coast were resident in the capital Abidjan and were used for surveillance purposes by protection companies. They were kept in 16 different kennels and received regular medical prophylaxis including vaccinations and external anti-parasitic treatments. Dogs from Gabon were recruited in 15 small villages in the area of Ogooué-Ivindo, situated in the northeastern part of the country. They were nonkennelled companion animals and received no specific medical prevention. All the dogs appeared healthy at the time of the examination. All Gabonese dogs were infested by fleas and some of them by Haemaphysalis leachi ticks, while no ectoparasites were found in dogs from the Ivory Coast. Blood was collected in EDTA-anticoagulated tubes kept deep-frozen at –20°C until further processing. In the laboratory, DNA extraction was carried out using QIAamp DNA Mini Kits (Qiagen Ltd, Crawley, UK) according to the manufacturer's recommendations. Briefly, blood samples were digested for 10 min with a mixture of proteinase K and detergents at 56°C to liberate host and pathogen DNA. DNA was extracted from 200 μL of blood and purified DNA was eluted in 100 μL of low ionic strength buffer, pH 8.0. DNA from individual dogs was screened by PCR, using specific primers, for the presence of Ehrlichia and Anaplasma species (Ivory Coast), and Ehrlichia and Anaplasma species, Mycoplasma spp. and Rickettsia spp. (Gabon). PCR assays amplified a 350 base pair fragment of the 16S rRNA gene for Ehrlichia/Anaplasma species (primer sequences: ggtaccyacagaagaagtcc and tagcactcatcgtttacagc), 16S rRNA gene for Mycoplasma spp. (primer sequences: atacggcccatattcctacg and tgctccaccacttgttca) and ompB gene for Rickettsia spp. (primer sequences: gacaattaatatcggtgacgg and tgcatcagcattaccgcttgc). Sequencing was required to further characterise positive results for Ehrlichia/Anaplasma PCR and limited sequencing was performed for Mycoplasma spp. Overall, 10/392 (2.6%) of the tested dogs were positive for E. canis and 5/392 (1.3%) for A. platys (Table 1). The majority of them was from the Ivory Coast; 10 were positive for E. canis and two for A. platys. In Gabon, only three dogs were positive for A. platys and none was positive for E. canis. In this latter country, a high proportion of dogs (114/255, 44.7%) was positive for Mycoplasma spp. Sequencing of 10 Mycoplasma positive samples revealed four Mycoplasma haemocanis, one Mycoplasma haemofelis, and five samples of a novel Mycoplasma. No sample was positive for Rickettsia spp. The three Gabonese dogs positive for A. platys were co-infected with Mycoplasma spp. No E. canis and A. platys co-infections were present in the Ivory Coast dogs.TABLE 1Molecular detection of bacterial tick-transmitted pathogens in dogs of western AfricaEhrlichia canisAnaplasma platysMycoplasma spp.Rickettsia spp.Ivory Coast Abidjan n = 13710/137 7.3%2/137 1.5%Not-detectedNot-detectedGabon Ogooué-Ivindo area n = 2550 0%3/255 1.2%114/255 44.7%0 0%Total n = 39210/392 2.6%5/392 1.3%114/255 44.7%0 0% Open table in a new tab Ehrlichia canis is responsible for canine monocytic ehrlichiosis, a widespread infectious disease in the distribution area of its vector Rhipicephalus sanguineus, the brown dog tick. Interestingly, in a previous seroprevalence survey of E. canis infection in the same population of dogs [1Davoust B Bourry O Gomez J et al.Surveys on seroprevalence of canine monocytic ehrlichiosis among dogs living in the Ivory Coast and Gabon and evaluation of a quick commercial test kit dot-ELISA.Ann N Y Acad Sci. 2006; 1078: 464-469Crossref PubMed Scopus (11) Google Scholar], 67.8% of dogs in the Ivory Coast were positive and only 3.1% in Gabon, while our molecular study found 7.3% and 0%, respectively. Moreover, the average titres of positive samples from the Ivory Coast dogs were much higher than those from the Gabonese dogs. The absence of E. canis DNA among 255 dogs in Gabon is consistent with the low prevalence of its vector, R. sanguineus. Rhipicephalus sanguineus is also considered as being the main vector of A. platys, the cause of canine infectious cyclic thrombocytopenia, although naturally infected dogs do not necessarily exhibit clinical signs [2Sanogo YO Davoust B Inokuma H et al.First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida) collected from dogs in Africa.Onderstepoort J Vet Res. 2003; 70: 205-212PubMed Google Scholar]. Anaplasma platys has already been isolated from a dog in the Democratic Republic of the Congo [2Sanogo YO Davoust B Inokuma H et al.First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida) collected from dogs in Africa.Onderstepoort J Vet Res. 2003; 70: 205-212PubMed Google Scholar]. The presence of A. platys in the Gabon dog population despite the apparently low exposure to Rhipicephalus ticks requires further investigation. However, our study suggests that specific testing for A. platys is recommended when a clinical suspicion of E. canis infection is not confirmed. Mycoplasma haemocanis is responsible for anaemia in dogs but clinical signs mainly appear in those that are immuno-compromised or splenectomised [3Chalker VJ Canine mycoplasmas.Res Vet Sci. 2005; 79: 1-8Crossref PubMed Scopus (56) Google Scholar, 4Wengi N Willi B Boretti FS et al.Real-time PCR-based prevalence study, infection follow-up and molecular characterization of canine hemotropic mycoplasmas.Vet Microbiol. 2008; 126: 132-141Crossref PubMed Scopus (61) Google Scholar]. The prevalence of Mycoplasma infection in the Gabonese dogs of this study is high and this may be explained by persistent infection, which has been previously reported in dogs [4Wengi N Willi B Boretti FS et al.Real-time PCR-based prevalence study, infection follow-up and molecular characterization of canine hemotropic mycoplasmas.Vet Microbiol. 2008; 126: 132-141Crossref PubMed Scopus (61) Google Scholar]. Transmission by R. sanguineus is suspected [3Chalker VJ Canine mycoplasmas.Res Vet Sci. 2005; 79: 1-8Crossref PubMed Scopus (56) Google Scholar] but this does not correlate with the high prevalence of Mycoplasma infection in an environment of low R. sanguineus exposure. The dogs sampled in Gabon were parasited by fleas and Haemaphysalis leachi ticks, and the role of these arthropods in the transmission of Mycoplasma spp. should be further investigated. The finding of novel haemoplasma species, including one with high similarity to M. haemofelis, in this dog population, requires further investigation in light of the new canine haemoplasma species being recognised elsewhere [5Sykes JE Ball LM Bailiff NL et al.‘Candidatus Mycoplasma haematoparvum’, a novel small haemotropic mycoplasma from a dog.Int J Syst Evol Microbiol. 2005; 55: 27-30Crossref PubMed Scopus (55) Google Scholar]. The high level of Mycoplasma infection in Gabon could be responsible for an increased morbidity and mortality, when combined with stress or in the case of co-infection with other arthropod-transmitted infections. In our study, the three dogs positive for A. platys were also infected by Mycoplasma spp. Overall, the high prevalence of sub-clinical canine tick-borne bacterial infections from these two African countries indicates the circulation of these agents, more particularly Mycoplasma spp.; however, the transmission biology may differ from those described previously. The authors thank Dr Philippe Parola for his excellent cooperation. This research was supported in part by Merial SAS." @default.
• W1527045449 created "2016-06-24" @default.
• W1527045449 creator A5000417296 @default.
• W1527045449 creator A5003122561 @default.
• W1527045449 creator A5011187103 @default.
• W1527045449 creator A5050040238 @default.
• W1527045449 creator A5067951227 @default.
• W1527045449 creator A5074314300 @default.
• W1527045449 date "2009-12-01" @default.
• W1527045449 modified "2023-09-28" @default.
• W1527045449 title "Sub-clinical infection of dogs from the Ivory Coast and Gabon with Ehrlichia, Anaplasma, Mycoplasma and Rickettsia species" @default.
• W1527045449 cites W1994969070 @default.
• W1527045449 cites W2040875845 @default.
• W1527045449 cites W2142157988 @default.
• W1527045449 cites W2168547540 @default.
• W1527045449 doi "https://doi.org/10.1111/j.1469-0691.2008.02237.x" @default.
• W1527045449 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19456802" @default.
• W1527045449 hasPublicationYear "2009" @default.
• W1527045449 type Work @default.
• W1527045449 sameAs 1527045449 @default.
• W1527045449 citedByCount "9" @default.
• W1527045449 countsByYear W15270454492013 @default.
• W1527045449 countsByYear W15270454492015 @default.
• W1527045449 countsByYear W15270454492016 @default.
• W1527045449 countsByYear W15270454492017 @default.
• W1527045449 countsByYear W15270454492018 @default.
• W1527045449 countsByYear W15270454492019 @default.
• W1527045449 countsByYear W15270454492020 @default.
• W1527045449 crossrefType "journal-article" @default.
• W1527045449 hasAuthorship W1527045449A5000417296 @default.
• W1527045449 hasAuthorship W1527045449A5003122561 @default.
• W1527045449 hasAuthorship W1527045449A5011187103 @default.
• W1527045449 hasAuthorship W1527045449A5050040238 @default.
• W1527045449 hasAuthorship W1527045449A5067951227 @default.
• W1527045449 hasAuthorship W1527045449A5074314300 @default.
• W1527045449 hasBestOaLocation W15270454491 @default.
• W1527045449 hasConcept C104317684 @default.
• W1527045449 hasConcept C159654299 @default.
• W1527045449 hasConcept C203014093 @default.
• W1527045449 hasConcept C2777479583 @default.
• W1527045449 hasConcept C2779620486 @default.
• W1527045449 hasConcept C2779657035 @default.
• W1527045449 hasConcept C42972112 @default.
• W1527045449 hasConcept C45189115 @default.
• W1527045449 hasConcept C49105822 @default.
• W1527045449 hasConcept C55493867 @default.
• W1527045449 hasConcept C71924100 @default.
• W1527045449 hasConcept C78063203 @default.
• W1527045449 hasConcept C86803240 @default.
• W1527045449 hasConceptScore W1527045449C104317684 @default.
• W1527045449 hasConceptScore W1527045449C159654299 @default.
• W1527045449 hasConceptScore W1527045449C203014093 @default.
• W1527045449 hasConceptScore W1527045449C2777479583 @default.
• W1527045449 hasConceptScore W1527045449C2779620486 @default.
• W1527045449 hasConceptScore W1527045449C2779657035 @default.
• W1527045449 hasConceptScore W1527045449C42972112 @default.
• W1527045449 hasConceptScore W1527045449C45189115 @default.
• W1527045449 hasConceptScore W1527045449C49105822 @default.
• W1527045449 hasConceptScore W1527045449C55493867 @default.
• W1527045449 hasConceptScore W1527045449C71924100 @default.
• W1527045449 hasConceptScore W1527045449C78063203 @default.
• W1527045449 hasConceptScore W1527045449C86803240 @default.
• W1527045449 hasLocation W15270454491 @default.
• W1527045449 hasLocation W15270454492 @default.
• W1527045449 hasOpenAccess W1527045449 @default.
• W1527045449 hasPrimaryLocation W15270454491 @default.
• W1527045449 hasRelatedWork W1994666140 @default.
• W1527045449 hasRelatedWork W2002771864 @default.
• W1527045449 hasRelatedWork W2079623538 @default.
• W1527045449 hasRelatedWork W2341883876 @default.
• W1527045449 hasRelatedWork W2342312467 @default.
• W1527045449 hasRelatedWork W2549502020 @default.
• W1527045449 hasRelatedWork W2712124014 @default.
• W1527045449 hasRelatedWork W2754813916 @default.
• W1527045449 hasRelatedWork W2769360063 @default.
• W1527045449 hasRelatedWork W2803289383 @default.
• W1527045449 hasRelatedWork W2893245586 @default.
• W1527045449 hasRelatedWork W2901734693 @default.
• W1527045449 hasRelatedWork W2905033132 @default.
• W1527045449 hasRelatedWork W3028973724 @default.
• W1527045449 hasRelatedWork W3047104454 @default.
• W1527045449 hasRelatedWork W3047278508 @default.
• W1527045449 hasRelatedWork W3096342633 @default.
• W1527045449 hasRelatedWork W3132248314 @default.
• W1527045449 hasRelatedWork W39117756 @default.
• W1527045449 hasRelatedWork W2724969668 @default.
• W1527045449 hasVolume "15" @default.
• W1527045449 isParatext "false" @default.
• W1527045449 isRetracted "false" @default.
• W1527045449 magId "1527045449" @default.
• W1527045449 workType "article" @default.