FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1539471755> ?p ?o ?g. }

• W1539471755 endingPage "37778" @default.
• W1539471755 startingPage "37769" @default.
• W1539471755 abstract "O-Linked fucose modification is rare and has been shown to occur almost exclusively within epidermal growth factor (EGF)-like modules. We have found that the EGF-CFC family member human Cripto-1 (CR) is modified with fucose and through a combination of peptide mapping, mass spectrometry, and sequence analysis localized the site of attachment to Thr-88. The identification of a fucose modification on human CR within its EGF-like domain and the presence of a consensus fucosylation site within all EGF-CFC family members suggest that this is a biologically important modification in CR, which functionally distinguishes it from the EGF ligands that bind the type 1erbB growth factor receptors. A single CR point mutation, Thr-88 → Ala, results in a form of the protein that is not fucosylated and has substantially weaker activity in cell-based CR/Nodal signaling assays, indicating that fucosylation is functionally important for CR to facilitate Nodal signaling. O-Linked fucose modification is rare and has been shown to occur almost exclusively within epidermal growth factor (EGF)-like modules. We have found that the EGF-CFC family member human Cripto-1 (CR) is modified with fucose and through a combination of peptide mapping, mass spectrometry, and sequence analysis localized the site of attachment to Thr-88. The identification of a fucose modification on human CR within its EGF-like domain and the presence of a consensus fucosylation site within all EGF-CFC family members suggest that this is a biologically important modification in CR, which functionally distinguishes it from the EGF ligands that bind the type 1erbB growth factor receptors. A single CR point mutation, Thr-88 → Ala, results in a form of the protein that is not fucosylated and has substantially weaker activity in cell-based CR/Nodal signaling assays, indicating that fucosylation is functionally important for CR to facilitate Nodal signaling. Cripto-1 epidermal growth factor electrospray mass spectrometry, MALDI-TOF MS, matrix-assisted laser desorption ionization time-of-flight mass spectrometry reversed phase high performance liquid chromatography transforming growth factor Chinese hamster ovary polyacrylamide gel electrophoresis monoclonal antibody Human Cripto-1 (CR)1 is the original member of the EGF-CFC gene family, which includes a group of structurally related proteins that play essential roles in early embryogenesis during normal development and have been implicated as oncogenes in cell transformation (reviewed in Refs. 1Salomon D.S. Bianco C. De Santis M. Bioessays. 1999; 21: 61-70Crossref PubMed Scopus (69) Google Scholar and 2Salomon D.S. Bianco C. Ebert A.D. Khan N.I. De Santis M. Normanno N. Wechselberger C. Seno M. Williams K. Sanicola M. Foley S. Gullick W.J. Persico G. Endocr. Relat. Cancer. 2000; 7: 199-226Crossref PubMed Scopus (117) Google Scholar). The EGF-CFC family members contain two conserved domains: a variant of the EGF domain (often called “EGF-like”) and a unique cysteine-rich domain, CFC, named for the founding members of the family:CR in humans (3Ciccodicola A. Dono R. Obici S. Simeone A. Zollo M. Persico M.G. EMBO J. 1989; 8: 1987-1991Crossref PubMed Scopus (214) Google Scholar), FRL-1 in Xenopus(4Kinoshita N. Minshull J. Kirschner M.W. Cell. 1995; 83: 621-630Abstract Full Text PDF PubMed Scopus (131) Google Scholar), and Cryptic in mice (5Shen M.M. Wang H. Leder P. Development. 1997; 124: 429-442Crossref PubMed Google Scholar). The EGF-like domain in EGF-CFC proteins differs from the canonical three-loop EGF structure in that loop 1 is deleted, loop 2 is truncated, and loop 3 is well conserved (6Lohmeyer M. Harrison P.M. Kannan S. DeSantis M. O'Reilly N.J. Sternberg M.J. Salomon D.S. Gullick W.J. Biochemistry. 1997; 36: 3837-3845Crossref PubMed Scopus (25) Google Scholar). Studies on the zebrafish CR ortholog, one-eyed pinhead (oep), indicated that the C-terminal region of oep may contain a putative GPI anchorage site (7Zhang J. Talbot W.S. Schier A.F. Cell. 1998; 92: 241-251Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar, 8Gritsman K. Zhang J. Cheng S. Heckscher E. Talbot W.S. Schier A.F. Cell. 1999; 97: 121-132Abstract Full Text Full Text PDF PubMed Scopus (601) Google Scholar) that serves to tether the protein to the membrane and that removal of the C-terminal stretch generated a soluble form of oep that was able to partially rescueoep mutant embryos (8Gritsman K. Zhang J. Cheng S. Heckscher E. Talbot W.S. Schier A.F. Cell. 1999; 97: 121-132Abstract Full Text Full Text PDF PubMed Scopus (601) Google Scholar). The recent characterization of murine cripto (9Minchiotti G. Parisi S. Liguori G. Signore M. Lania G. Adamson E.D. Lago C.T. Persico M.G. Mech. Dev. 2000; 90: 133-142Crossref PubMed Scopus (93) Google Scholar) confirmed the presence of a GPI modification within the C-terminal region of this EGF-CFC protein (9Minchiotti G. Parisi S. Liguori G. Signore M. Lania G. Adamson E.D. Lago C.T. Persico M.G. Mech. Dev. 2000; 90: 133-142Crossref PubMed Scopus (93) Google Scholar) and again that removing this C-terminal stretch of residues generates Cripto forms that are soluble. During embryogenesis, EGF-CFC family members are essential for the formation of mesoderm during gastrulation and cardiomyocyte formation. Genetic studies in zebrafish (8Gritsman K. Zhang J. Cheng S. Heckscher E. Talbot W.S. Schier A.F. Cell. 1999; 97: 121-132Abstract Full Text Full Text PDF PubMed Scopus (601) Google Scholar) define oep as necessary for gastrulation and left-right patterning during development. These studies have defined an obligatory role for EGF-CFC proteins as “co-factors” for the correct signaling of the TGFβ family member, Nodal (reviewed in Refs. 10Shen M.M. Schier A.F. Trends Genet. 2000; 16: 303-309Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar and 11Schier A.F. Shen M.M. Nature. 2000; 403: 385-389Crossref PubMed Scopus (423) Google Scholar). Murine Nodal also plays a major role in gastrulation and regulating left-right asymmetry during mesoderm formation in early embryogenesis. Phenotypic similarities are exhibited by nodal and cripto null mice, suggesting that the Cripto-Nodal signaling pathway defined in zebrafish is likely to be conserved for at least a subset of Nodal activities (12Collignon J. Varlet I. Robertson E.J. Nature. 1996; 381: 155-158Crossref PubMed Scopus (485) Google Scholar, 13Lowe L.A. Supp D.M. Sampath K. Yokoyama T. Wright C.V. Potter S.S. Overbeek P. Kuehn M.R. Nature. 1996; 381: 158-161Crossref PubMed Scopus (417) Google Scholar, 14Levin M. Bioessays. 1997; 19: 287-296Crossref PubMed Scopus (91) Google Scholar). Cripto-dependent Nodal signaling has been shown to be mediated by phosphorylated Smad2, Smad4, and the transcription factor FAST2 (15Saijoh Y. Adachi H. Sakuma R. Yeo C.Y. Yashiro K. Watanabe M. Hashiguchi H. Mochida K. Ohishi S. Kawabata M. Miyazono K. Whitman M. Hamada H. Mol. Cell. 2000; 5: 35-47Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar), which in turn binds to a left-right-specific enhancer (ASE) on the nodal gene and another TGFβ gene family member, lefty2. Thus Nodal is autoregulated. Although a specific receptor for the EGF-CFC and Nodal proteins has not yet been identified, activin type I and II receptors have been genetically implicated in zebrafish (8Gritsman K. Zhang J. Cheng S. Heckscher E. Talbot W.S. Schier A.F. Cell. 1999; 97: 121-132Abstract Full Text Full Text PDF PubMed Scopus (601) Google Scholar) and mouse studies (11Schier A.F. Shen M.M. Nature. 2000; 403: 385-389Crossref PubMed Scopus (423) Google Scholar). InXenopus, Cripto-dependent Nodal signaling has been shown to involve ALK4 (activin receptor-like kinase 4, or ActR-IB) (16Yeo C.-Y. Whitman M. Mol. Cell. 2001; 7: 949-957Abstract Full Text Full Text PDF PubMed Scopus (310) Google Scholar); however, a receptor type II partner has yet to be identified. The O-linked fucose modification is rare and until recently had been shown to occur exclusively within EGF-like modules of secreted proteins involved in blood clotting and clot dissolution such as factor XII (17Harris R.J. Ling V.T. Spellman M.W. J. Biol. Chem. 1992; 267: 5102-5107Abstract Full Text PDF PubMed Google Scholar), factor IX (18Harris R.J. van Halbeek H. Glushka J. Basa L.J. Ling V.T. Smith K.J. Spellman M.W. Biochemistry. 1993; 32: 6539-6547Crossref PubMed Scopus (96) Google Scholar), factor VII (19Kao Y.H. Lee G.F. Wang Y. Starovasnik M.A. Kelley R.F. Spellman M.W. Lerner L. Biochemistry. 1999; 38: 7097-7110Crossref PubMed Scopus (36) Google Scholar), or urokinase-type plasminogen activator (20Rabbani S.A. Mazar A.P. Bernier S.M. Haq M. Bolivar I. Henkin J. Goltzman D. J. Biol. Chem. 1992; 267: 14151-14156Abstract Full Text PDF PubMed Google Scholar). From these studies a consensus site forO-fucosylation was defined (21Harris R.J. Spellman M.W. Glycobiology. 1993; 3: 219-224Crossref PubMed Scopus (221) Google Scholar) as the sequence2CXXGG(S/T)C3, which falls within the second and third cysteines of an EGF-like module. Fucosylation has been implicated in modulating the function of a number of proteins. For example, O-fucosylation of urokinase-type plasminogen activator within its EGF-like module is critical for signaling through its receptor (20Rabbani S.A. Mazar A.P. Bernier S.M. Haq M. Bolivar I. Henkin J. Goltzman D. J. Biol. Chem. 1992; 267: 14151-14156Abstract Full Text PDF PubMed Google Scholar), O-fucosylation of the E-selectin ligand ESL-1 is required for binding to E-selectin (22Steegmaier M. Levinovitz A. Isenmann S. Borges E. Lenter M. Kocher H.P. Kleuser B. Vestweber D. Nature. 1995; 373: 615-620Crossref PubMed Scopus (323) Google Scholar), and recent studies on the Notch-Delta/Serrate signaling system have implicated the fucosylation state of Notch as important for modulating its ability to interact more favorably with the Delta ligandversus the Serrate ligand (23Moloney D.J. Panin V.M. Johnston S.H. Chen J. Shao L. Wilson R. Wang Y. Stanley P. Irvine K.D. Haltiwanger R.S. Vogt T.F. Nature. 2000; 406: 369-375Crossref PubMed Scopus (719) Google Scholar, 24Moloney D.J. Shair L.H. Lu F.M. Xia J. Locke R. Matta K.L. Haltiwanger R.S. J. Biol. Chem. 2000; 275: 9604-9611Abstract Full Text Full Text PDF PubMed Scopus (290) Google Scholar, 25Bruckner K. Perez L. Clausen H. Cohen S. Nature. 2000; 406: 411-415Crossref PubMed Scopus (592) Google Scholar, 26Hicks C. Johnston S.H. diSibio G. Collazo A. Vogt T.F. Weinmaster G. Nat. Cell Biol. 2000; 2: 515-520Crossref PubMed Scopus (336) Google Scholar). Here we identify by mass spectroscopy and peptide mapping that recombinant human CR produced as a soluble form in CHO cells is fucosylated. The modification was mapped to a 7-amino acid sequence within the EGF-like domain that fits the fucosylation consensus site (21Harris R.J. Spellman M.W. Glycobiology. 1993; 3: 219-224Crossref PubMed Scopus (221) Google Scholar). This consensus site is present in all EGF-CFC proteins but not in the EGF-family member ligands that bind type I erbB growth factor receptor family members. Mutating Thr-88 of human CR to alanine blocks the addition of the fucose modification on the CR protein, and this alteration abolishes the ability of CR to function as a co-factor for Nodal. The significance of the fucosylation in modulating CR function with respect to the role of CR in development and cancer is discussed. Recombinant human CR was expressed in CHO cells as a C-terminally truncated form fused to human IgG1 hinge and Fc domain. An expression plasmid (pSGS480) was constructed by subcloning a cDNA encoding human CR residues 1–169, fused in frame after residue 169 to the Fc hinge and CH2CH3 portion of human IgG1(CR(ΔC)-Fc) into the vector pEAG1100. pEAG1100 is a derivative of plasmid pCMV-Sport-β-gal (Life Technologies, Inc.) and was made by removing the reporter gene β-galactosidase NotI fragment from the plasmid. CHO cells in serum-free medium (CD-CHO medium; Life Technologies, Inc.) were transiently transfected with plasmid pSGS480 at room temperature for 15 min using DMRIE-C (Life Technologies, Inc.) cationic lipid plus cholesterol solution. The transfected cells were grown as a suspension culture in a spinner flask for 8 days at 28 °C. The conditioned medium was clarified by centrifugation, filtered through a 0.2-μm filter, and stored at −70 °C. CR(ΔC)-Fc protein expression was assessed by Western blot analysis. For Western blot analysis, conditioned medium and cells from CR transfected cells were subjected to SDS-PAGE on 4–20% gradient gels under reducing conditions and transferred electrophoretically to nitrocellulose, and the CR protein was detected with a rabbit polyclonal antibody (antibody 1579) raised against a CR 17-mer peptide (comprising residues 97–113 of human CR)-KLH conjugate (27Saeki T. Stromberg K. Qi C.F. Gullick W.J. Tahara E. Normanno N. Ciardiello F. Kenney N. Johnson G.R. Salomon D.S. Cancer Res. 1992; 52: 3467-3473PubMed Google Scholar) or with the anti-CR mouse monoclonal antibody A10B2.18. 2H. Adkins, S. Schiffer, P. Rayhorn, D. Salomon, K. P. Williams and M. Sanicola, unpublished data. CR(ΔC)-Fc was purified from the conditioned medium on a protein A-Sepharose column (Amersham Pharmacia Biotech). Bound protein was eluted with 25 mm sodium phosphate, pH 2.8, 100 mm NaCl. The eluate was neutralized with 0.5 msodium phosphate, pH 8.6, analyzed for total protein content from absorbance at 280 nm (Extinction coefficient = 59181 mol−1 cm−1), and analyzed for purity by SDS-PAGE. The eluted protein was filtered through a 0.2-μm filter and stored at −70 °C. N-terminal sequencing was carried out on a PerkinElmer Life Sciences Procise HT sequencer and run in the pulsed liquid mode equipped with an on-line phenylthiohydantoin analyzer. The EGF-like domain of human CR comprising residues 75–112 was also expressed as a Fc fusion protein. An expression plasmid (pSGS422) was constructed by subcloning a cDNA encoding human VCAM-1 signal peptide (28Hession C. Tizard R. Vassallo C. Schiffer S.B. Goff D. Moy P. Chi-Rosso G. Luhowskyj S. Lobb R. Osborn L. J. Biol. Chem. 1991; 266: 6682-6685Abstract Full Text PDF PubMed Google Scholar) fused to human CR residues 75–112 fused in frame after residue 112 of the hinge and Fc domain of human IgG1 into vector pEAG1100 (CR(EGF)-Fc). Plasmid pSGS422 was transiently transfected into CHO cells, and the CR(EGF)-Fc protein was purified from the conditioned medium by chromatography on protein A as described above for CR(ΔC)-Fc. A C-terminally truncated form of CR (CR(ΔC)) that was not fused to Fc was generated by transiently transfecting into CHO a cDNA encoding human CR amino acid residues 1–169 as described above. The cells were grown as above, and CR(ΔC) was purified from the conditioned medium by immunoaffinity chromatography on the anti-CR mAb column A40G12.8 that was prepared by conjugating 4 mg of the anti-CR mAb A40G12.8/ml of CNBr-activated Sepahrose 4B resin. 3H. Adkins, S. Schiffer, P. Rayhorn, D. Salomon, K. P. Williams, and M. Sanicola, manuscript in preparation. Bound protein was eluted with 25 mm sodium phosphate, pH 2.8, 100 mm NaCl, and the eluate was neutralized with 0.5m sodium phosphate, pH 8.6. Aliquots of CR protein (CR(ΔC)-Fc or CR(EGF)-Fc) in 40 mm sodium phosphate, pH 7.5, 5% acetonitrile were treated with 5 milliunits of PNGase F (Glyko, Inc.) for 18 h at 37 °C. The PNGase F-treated sample in 0.5 m guanidine HCl, 25 mm Tris-Cl, pH 8, was reduced with 4 mm dithiothreitol for 30 min at 37 °C. The sample was desalted on-line prior to electrospray mass spectrometry (ESI-MS) analysis using a LC-Packings Ultimate HPLC interfaced to a Micromass Quattro II triple quadrupole mass spectrometer equipped with an electrospray ion source (Micromass, Manchester, UK). The protein was desalted on a Vydac C4 guard column at a flow rate of 50 μl/min with a 15-min 5–65% acetonitrile gradient in 0.05% trifluoroacetic acid. The mass spectra were acquired by scanning them/z range 400–2000 in 5 s/scan. The raw data were deconvoluted using the Micromass MaxEnt program to generate zero charge mass spectra. All masses are averages unless otherwise noted. CR protein (CR(ΔC)-Fc or CR(EGF)-Fc) in phosphate-buffered saline, 5 mm EDTA was reduced with 5 mm dithiothreitol for 6 h at room temperature and then treated with 150 milliunits of PNGase F (Glyko, Inc.)/mg of protein for 16 h at 37 °C. The sample was adjusted to 6 m guanidine hydrochloride, reduced with 10 mm dithiothreitol for 35 min at 45 °C, and then alkylated with 30 mm iodoacetamide for 30 min at 20 °C. The alkylated protein was precipitated by addition of 40 volumes of ice-cold ethanol. The solution was stored at −20 °C for 1 h and then centrifuged at 14,000 × g for 12 min at 4 °C. The supernatant was discarded, and the precipitate was washed twice with ice-cold ethanol. The alkylated protein was resuspended in 1m urea, 200 mm Tris-HCl, pH 8.5, and digested with endoproteinase (Endo) Lys-C from Achromobacter lyticus (WAKO Pure Chemical Industrials, Ltd.) at a 1:10 enzyme:substrate ratio for 16 h at room temperature. Analytical scale digests were desalted on-line prior to ESI-MS analysis using a YMC C18 column (1 × 25 cm) on the Ultimate HPLC. The running conditions were a 120-min 0–45% acetonitrile gradient in 0.05% trifluoroacetic acid at a flow rate of 50 μl/min. The mass spectra were acquired by scanning the m/z range 300–1900 in 2.05 s/scan. Preparative digests were analyzed by RP-HPLC using a Waters Alliance System (Waters Corp., Milford, MA) equipped with a YMC C18column (1 mm × 25 cm). Individual peaks were collected for further analysis. The molecular masses of peptides were determined by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) on a Voyager-DE STR mass spectrometer (PerSeptive Biosystems). Peptides were sequenced by Edman degradation on a PerkinElmer Life Sciences Procise HT Protein Sequencer equipped with an on-line phenylthiohydantoin analyzer. Nonreduced CR(ΔC)-Fc protein in phosphate-buffered saline, 5 mm EDTA was treated with PNGase F and ethanol precipitated as described above. The pellet was resuspended in 200 μl of 70% formic acid. Cyanogen bromide (10 m in acetonitrile) was added to a final concentration of 1 m, and the sample was incubated in the dark for 24 h at room temperature. The digest was analyzed by MALDI-TOF MS. Peptides were separated by RP-HPLC on a Vydac C4 column using the following gradient (Solvent A, 0.1% trifluoroacetic acid; Solvent B, 0.085% trifluoroacetic acid, 75% acetonitrile: 0–20% B from 0–10 min; 20–75% B from 10–120 min; and 75–100% B from 120–130 min), and collected fractions were analyzed by MALDI-TOF MS and Edman sequencing as described above. CNBr-generated CR peptides purified from this digest by RP-HPLC were reduced with 5 mm dithiothreitol and cleaved with Carboxypeptidase Y (Roche Molecular Biochemicals). Portions of the digest were analyzed at 10-min intervals by MALDI-TOF MS. Mutagenesis of CR, threonine 88 to alanine (T88A), was accomplished by spliced overlap extension polymerase chain reaction (29Horton R.M. Hunt H.D. Ho S.N. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 61-68Crossref PubMed Scopus (2638) Google Scholar, 30Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6825) Google Scholar). The following mutagenic primers (5′ to 3′) are the top and bottom strands creating the T88A mutation. The asterisks indicate the mutant (Thr to Ala) codon: 5′-GCCTGAATGGGGGAG*C*C*TGCATGCTGGGATCCTTTTGTGCCTGC-3′ and 5′-GCAGG- CACAAAAGGATCCCAGCATGCAG*G*C*TCCCCCATTCAGGC-3′. In addition to changing the threonine codon ACC to the codon for alanine, GCC, the same oligonucleotides also inserts a silent change to the sequence to introduce a BamHI site, changing the glycine 92 codon from GGG to GGA. This new site gave the ability to screen for the mutant clone. The T88A mutant was constructed in both the full-length CR (1) (CR T88A) in the pCS2+ vector (31Turner D.L. Weintraub H. Genes Dev. 1994; 8: 1434-1447Crossref PubMed Scopus (951) Google Scholar) and in the C-terminally truncated CR (1) (CR(ΔC) T88A). The latter was purified as for wild type CR(ΔC) by immunoaffinity chromatography. Mouse teratocarcinoma F9 cripto−/− cells (9Minchiotti G. Parisi S. Liguori G. Signore M. Lania G. Adamson E.D. Lago C.T. Persico M.G. Mech. Dev. 2000; 90: 133-142Crossref PubMed Scopus (93) Google Scholar) were a gift from Dr. Eileen Adamson (The Burnham Institute, La Jolla, CA). The nodal enhancer ASE (n2)7 (15Saijoh Y. Adachi H. Sakuma R. Yeo C.Y. Yashiro K. Watanabe M. Hashiguchi H. Mochida K. Ohishi S. Kawabata M. Miyazono K. Whitman M. Hamada H. Mol. Cell. 2000; 5: 35-47Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar) cDNA was a gift of Dr. Masaharu Seno (Okayama University, Okayama, Japan) and was used to construct a luciferase reporter plasmid p(n2)7-lux. F9 cripto−/− cells (6.5 × 105 cells/well) were transfected using LipofectAMINE (Bethesda Research Laboratories) with equal amounts of FAST2 (15Saijoh Y. Adachi H. Sakuma R. Yeo C.Y. Yashiro K. Watanabe M. Hashiguchi H. Mochida K. Ohishi S. Kawabata M. Miyazono K. Whitman M. Hamada H. Mol. Cell. 2000; 5: 35-47Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar) andp(n2)7-lux cDNA and in the absence and presence of CR full-length (residues 1–188) wild type DNA and in the absence and presence of CR T88A mutant full-length DNA. Total DNA transfected per well was always 1.0 μg, and control vector DNA (pEAG1100) was used to bring the total up to 1.0 μg. 48 h following transfection, the cells were lysed with LucLite (Packard Instrument Company), and luciferase activity was measured in a luminometer (PerkinElmer Life Sciences). Cripto-dependent Nodal signaling was measured as described previously (16Yeo C.-Y. Whitman M. Mol. Cell. 2001; 7: 949-957Abstract Full Text Full Text PDF PubMed Scopus (310) Google Scholar, 32Faure S. Lee M.A. Keller T. ten Dijke P. Whitman M. Development. 2000; 127: 2917-2931Crossref PubMed Google Scholar). Xenopus embryos between cell stages 2 and 4 were used for injection. Synthetic mRNAs were injected into each blastomere in the animal hemisphere. Constructs were generated with the pCS2+ vector (31Turner D.L. Weintraub H. Genes Dev. 1994; 8: 1434-1447Crossref PubMed Scopus (951) Google Scholar). RNAs were transcribed from the following constructs using the SP6 mMessage mMachine Kit (Ambion): pCS-Nodal (16Yeo C.-Y. Whitman M. Mol. Cell. 2001; 7: 949-957Abstract Full Text Full Text PDF PubMed Scopus (310) Google Scholar), pSGS151-CR WT, pSGS904-CR T88A, and pSGS150-CR(ΔC). Ectodermal explants were isolated between stages 8 and 9 and were harvested when sibling uninjected embryos reached stage 10. The explants were lysed in a buffer containing 50 mm Tris-Cl, pH 8.0, 150 mm NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 2 mm EDTA, 2× Complete, EDTA-free protease inhibitor mixture (Roche Molecular Biochemicals), 4 μg/ml pepstatin A, 1 mm phenylmethylsulfonyl fluoride, 20 nmcalyculin A, 25 mm α-glycerophosphate, 100 mmsodium fluoride, 2 mm sodium orthovanadate, and 10 mm sodium pyrophosphate. After centrifugation, the supernatants were mixed with equal volume of 4× Laemmli loading buffer and subjected to SDS-PAGE. Western blot analysis was performed as described (32Faure S. Lee M.A. Keller T. ten Dijke P. Whitman M. Development. 2000; 127: 2917-2931Crossref PubMed Google Scholar). The following antibodies were used for Western blot analysis: anti-Smad1/5/8 goat polyclonal antibody (Santa Cruz Biotechnology), anti-Smad2 mouse monoclonal antibody (clone 18; Transduction Laboratories), anti-actin mouse monoclonal antibody (clone AC-40; Sigma), and anti-phospho-Smad2 rabbit polyclonal antibodies (32Faure S. Lee M.A. Keller T. ten Dijke P. Whitman M. Development. 2000; 127: 2917-2931Crossref PubMed Google Scholar). For detecting Cripto protein expression, the anti-Cripto antibody 1579 described above was used. When we expressed human CR in CHO cells as the full-length protein (comprising residues 1–188; Fig.1), it was produced as an insoluble membrane-associated form that was difficult to purify (data not shown). Others have reported similar difficulties in mammalian (33Brandt R. Normanno N. Gullick W.J. Lin J.H. Harkins R. Schneider D. Jones B.W. Ciardiello F. Persico M.G. Armenante F. J. Biol. Chem. 1994; 269: 17320-17328Abstract Full Text PDF PubMed Google Scholar) and bacterial (34Seno M. DeSantis M. Kannan S. Bianco C. Tada H. Kim N. Kosaka M. Gullick W.J. Yamada H. Salomon D.S. Growth Factors. 1998; 15: 215-229Crossref PubMed Scopus (32) Google Scholar) systems. We were able to express human CR as a soluble form by making a C-terminal truncated form analogous to that generated for the zebrafish oep (8Gritsman K. Zhang J. Cheng S. Heckscher E. Talbot W.S. Schier A.F. Cell. 1999; 97: 121-132Abstract Full Text Full Text PDF PubMed Scopus (601) Google Scholar) and murine Cripto (9Minchiotti G. Parisi S. Liguori G. Signore M. Lania G. Adamson E.D. Lago C.T. Persico M.G. Mech. Dev. 2000; 90: 133-142Crossref PubMed Scopus (93) Google Scholar). Consequently, we transiently expressed in CHO cells a C-terminally truncated form of human CR, comprising residues 1–169 (Fig. 1), as an Fc fusion protein (CR(ΔC)-Fc) that was efficiently secreted into the supernatant. CR(ΔC)-Fc was purified from the conditioned medium by chromatography on protein A-Sepharose. Edman N-terminal sequencing of CR(ΔC)-Fc identified a single N terminus that starts with Leu-31 (Fig. 1). This is consistent with predictions for processing of the signal peptide using the SIGNALP program (35Nielsen H. Brunak S. von Heijne G. Protein Eng. 1999; 12: 3-9Crossref PubMed Scopus (535) Google Scholar). ESI-MS data for the purified CR(ΔC)-Fc gave a complex broad spectra that was not resolvable, suggesting a complex carbohydrate pattern. On SDS-PAGE, the purified CR(ΔC)-Fc migrated as two diffuse bands (Fig.2A) with apparent masses of 50 and 52 kDa. After treatment of the reduced protein with PNGase F, these two bands both shift to lower molecular masses with masses of ∼45 and 47 kDa (Fig. 2A), suggesting that both of these bands are N-glycosylated. The ESI-MS spectra of the PNGase F-treated CR(ΔC)-Fc (Fig. 2B) was less complex than the fully glycosylated protein but still showed a number of ions with masses ranging from 41116 to 42870 Da (TableI). Theoretical assignments for the nine most intense ions based on their observed masses are shown in Table I. Some of these species had measured masses that matched the predicted mass for CR(ΔC)-Fc starting at residue 31 and being modified withO-linked glycans (HexNAc-Hex-NeuAc). Peak A with an observed mass of 41116 Da agrees exactly with the theoretical mass for residues 31–396. Because antibodies frequently end with a lysine residue, the C-terminal lysine is often lost because of carboxypeptidase B activity in serum. For CR(ΔC)-Fc this is reflected in the protein forms ending at residues 396 (peaks A, B, D, F, G, and H; Fig. 2B and Table I). However, some of the glycosylated forms appear to end in the terminal lysine. In contrast, others had measured masses that did not agree with any available prediction, although the difference in mass of 146 Da for each species was consistent with the addition of a deoxyhexosyl group, potentially fucose with an average mass of 146.14 Da.Figure 2Characterization of the CR(ΔC)-Fc fusion protein. A C-terminally truncated form of CR (comprising resides 1–169) was expressed as a Fc fusion protein in CHO cells. The CR(ΔC)-Fc was purified by protein A chromatography and analyzed by SDS-PAGE and mass spectrometry. CR(ΔC)-Fc was treated with PNGase F as described under “Experimental Procedures”. A, samples were run under reducing conditions on SDS-PAGE as follows. Lane a, Benchmark prestained protein ladder (New England Biolabs); lane b, CR(ΔC)-Fc; lane c, CR(ΔC)-Fc after PNGase F treatment. The gel was stained with Coomassie Blue. B, the PNGase F-treated CR(ΔC)-Fc protein was analyzed by ESI-MS on a triple quadrupole instrument (Quattro II; Micromass).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table IAnalysis of CR(ΔC)-Fc by MSPeakObserved massTheoretical massIdentity of CR(ΔC)-Fc residuesDaDaA41,11641,11731–396B41,26241,26331–396 + 146C41,39141,39131–397 + 146D41,77341,77431–396 + HexNAcHexNeuAcE41,91941,92031–396 + HexNAcHexNeuAc + 146F42,05242,04831–397 + HexNAcHexNeuAc + 146G42,21042,21131–396 + HexNAcHexNeuAc2 + 146H42,57542,57631–396 + HexNAc2Hex2NeuAc2 + 146I42,87042,86831–396 + HexNAc2Hex2NeuAc3 + 146CR(ΔC)-Fc was treated with PNGase F and analyzed by ESI-MS (see Fig.2) on a triple quadrupole instrument (Quattro II; Micromass). The average masses were used to calculate the theoretical masses. Open table in a new tab CR(ΔC)-Fc was treated with PNGase F and analyzed by ESI-MS (see Fig.2) on a triple quadrupole instrument (Quattro II; Micromass). The average masses were used to calculate the theoretical masses. The site of modification for the 146-Da group within the human sequence was identified by a combination of peptide mapping and mass spectrometry. PNGase F treated CR(ΔC)-Fc was reduced, alkylated, and treated with endoproteinase (Endo) Lys-C. Fig.3 shows results from a Endo Lys-C peptide mapping LC-MS analysis of CR(ΔC)-Fc with a total ion current readout. For a complete digestion, 25 potential Endo Lys-C cleavage products would be predicted and were designated CR-En, where E1 is the peptide from the N terminus of CR(ΔC)-Fc and E25 is the peptide from the C terminus" @default.
• W1539471755 created "2016-06-24" @default.
• W1539471755 creator A5001314644 @default.
• W1539471755 creator A5011464500 @default.
• W1539471755 creator A5013128421 @default.
• W1539471755 creator A5023276487 @default.
• W1539471755 creator A5025336528 @default.
• W1539471755 creator A5025658833 @default.
• W1539471755 creator A5027758178 @default.
• W1539471755 creator A5045088057 @default.
• W1539471755 creator A5065289549 @default.
• W1539471755 creator A5068362750 @default.
• W1539471755 creator A5077443874 @default.
• W1539471755 creator A5082970981 @default.
• W1539471755 creator A5089749747 @default.
• W1539471755 date "2001-10-01" @default.
• W1539471755 modified "2023-10-15" @default.
• W1539471755 title "Fucosylation of Cripto Is Required for Its Ability to Facilitate Nodal Signaling" @default.
• W1539471755 cites W1513929030 @default.
• W1539471755 cites W1527164932 @default.
• W1539471755 cites W1557616402 @default.
• W1539471755 cites W1670027677 @default.
• W1539471755 cites W1904561619 @default.
• W1539471755 cites W1968146121 @default.
• W1539471755 cites W1973836804 @default.
• W1539471755 cites W1976880781 @default.
• W1539471755 cites W1977393336 @default.
• W1539471755 cites W1981332765 @default.
• W1539471755 cites W1987553694 @default.
• W1539471755 cites W1990803574 @default.
• W1539471755 cites W1995473388 @default.
• W1539471755 cites W1998591058 @default.
• W1539471755 cites W2005462392 @default.
• W1539471755 cites W2017816671 @default.
• W1539471755 cites W2017952840 @default.
• W1539471755 cites W2020778164 @default.
• W1539471755 cites W2020798714 @default.
• W1539471755 cites W2021556801 @default.
• W1539471755 cites W2022005838 @default.
• W1539471755 cites W2028994347 @default.
• W1539471755 cites W2034265732 @default.
• W1539471755 cites W2041111200 @default.
• W1539471755 cites W2044424168 @default.
• W1539471755 cites W2050429474 @default.
• W1539471755 cites W2053483926 @default.
• W1539471755 cites W2060913542 @default.
• W1539471755 cites W2067493400 @default.
• W1539471755 cites W2070539534 @default.
• W1539471755 cites W2076718142 @default.
• W1539471755 cites W2077557886 @default.
• W1539471755 cites W2081193786 @default.
• W1539471755 cites W2082955515 @default.
• W1539471755 cites W2084105838 @default.
• W1539471755 cites W2088217641 @default.
• W1539471755 cites W2092766186 @default.
• W1539471755 cites W2094543087 @default.
• W1539471755 cites W2095313585 @default.
• W1539471755 cites W2102159048 @default.
• W1539471755 cites W2111898474 @default.
• W1539471755 cites W2119452210 @default.
• W1539471755 cites W2146570831 @default.
• W1539471755 cites W2161821489 @default.
• W1539471755 cites W2162097271 @default.
• W1539471755 cites W2165040677 @default.
• W1539471755 cites W2165857084 @default.
• W1539471755 cites W2321607498 @default.
• W1539471755 cites W2414358272 @default.
• W1539471755 cites W2483951904 @default.
• W1539471755 cites W4323053944 @default.
• W1539471755 cites W44741267 @default.
• W1539471755 cites W66170935 @default.
• W1539471755 doi "https://doi.org/10.1074/jbc.m104774200" @default.
• W1539471755 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11500501" @default.
• W1539471755 hasPublicationYear "2001" @default.
• W1539471755 type Work @default.
• W1539471755 sameAs 1539471755 @default.
• W1539471755 citedByCount "78" @default.
• W1539471755 countsByYear W15394717552013 @default.
• W1539471755 countsByYear W15394717552014 @default.
• W1539471755 countsByYear W15394717552017 @default.
• W1539471755 countsByYear W15394717552018 @default.
• W1539471755 countsByYear W15394717552019 @default.
• W1539471755 countsByYear W15394717552020 @default.
• W1539471755 countsByYear W15394717552021 @default.
• W1539471755 countsByYear W15394717552022 @default.
• W1539471755 crossrefType "journal-article" @default.
• W1539471755 hasAuthorship W1539471755A5001314644 @default.
• W1539471755 hasAuthorship W1539471755A5011464500 @default.
• W1539471755 hasAuthorship W1539471755A5013128421 @default.
• W1539471755 hasAuthorship W1539471755A5023276487 @default.
• W1539471755 hasAuthorship W1539471755A5025336528 @default.
• W1539471755 hasAuthorship W1539471755A5025658833 @default.
• W1539471755 hasAuthorship W1539471755A5027758178 @default.
• W1539471755 hasAuthorship W1539471755A5045088057 @default.
• W1539471755 hasAuthorship W1539471755A5065289549 @default.
• W1539471755 hasAuthorship W1539471755A5068362750 @default.
• W1539471755 hasAuthorship W1539471755A5077443874 @default.
• W1539471755 hasAuthorship W1539471755A5082970981 @default.

• next