FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1549228081> ?p ?o ?g. }

• W1549228081 endingPage "61" @default.
• W1549228081 startingPage "55" @default.
• W1549228081 abstract "SummaryBackground: Myeloproliferative disorders (MPDs) represent a risk factor for thrombosis in the portal, mesenteric, and hepatic districts. Objective: We aimed to assess whether the Janus kinase 2 (JAK2) V617F mutation, an acquired mutation that occurs in MPD patients, is a risk factor for portal and mesenteric venous thrombosis (PMVT) independently of the presence of overt MPDs. Patients and methods: The medical histories of 99 patients presenting with PMVT were obtained. The presence of the JAK2 V617F and VHL 598C > T mutations was determined by polymerase chain reaction followed by restriction enzyme analysis and direct cycle sequence analysis. Results: Over a 10‐year period of observation, of the 99 patients presenting with PMVT, the JAK2 V617F mutation was detected in heterozygous state in 17 individuals [17.2%; 95% confidence interval (95% CI) 10.9–25.9]. None of the patients presenting with the JAK2 V617F mutation carried an inherited thrombophilic risk factor. Seven patients with (43.8%; 95% CI 19.8–70.1) and two without (2.4%; 95% CI 0.3–8.4) the JAK2 V617F mutation had a diagnosis of MPD at the occurrence of the venous thrombotic event. After a median follow‐up of 41 months (range 3–114 months), three out of the 10 patients carrying the JAK2 V617F mutation were then diagnosed as having idiopathic myelofibrosis (n = 2) or polycythemia vera (n = 1), whereas in seven patients a MPD was not detected. Two of the 83 patients without the JAK2 V617F mutation went on to develop MPDs. Conclusions: Determination of the JAK2 V617F mutation may contribute to the search for genetic determinants of PMVT and may be useful to recognize patients who should be carefully observed for the subsequent development of overt MPDs. Background: Myeloproliferative disorders (MPDs) represent a risk factor for thrombosis in the portal, mesenteric, and hepatic districts. Objective: We aimed to assess whether the Janus kinase 2 (JAK2) V617F mutation, an acquired mutation that occurs in MPD patients, is a risk factor for portal and mesenteric venous thrombosis (PMVT) independently of the presence of overt MPDs. Patients and methods: The medical histories of 99 patients presenting with PMVT were obtained. The presence of the JAK2 V617F and VHL 598C > T mutations was determined by polymerase chain reaction followed by restriction enzyme analysis and direct cycle sequence analysis. Results: Over a 10‐year period of observation, of the 99 patients presenting with PMVT, the JAK2 V617F mutation was detected in heterozygous state in 17 individuals [17.2%; 95% confidence interval (95% CI) 10.9–25.9]. None of the patients presenting with the JAK2 V617F mutation carried an inherited thrombophilic risk factor. Seven patients with (43.8%; 95% CI 19.8–70.1) and two without (2.4%; 95% CI 0.3–8.4) the JAK2 V617F mutation had a diagnosis of MPD at the occurrence of the venous thrombotic event. After a median follow‐up of 41 months (range 3–114 months), three out of the 10 patients carrying the JAK2 V617F mutation were then diagnosed as having idiopathic myelofibrosis (n = 2) or polycythemia vera (n = 1), whereas in seven patients a MPD was not detected. Two of the 83 patients without the JAK2 V617F mutation went on to develop MPDs. Conclusions: Determination of the JAK2 V617F mutation may contribute to the search for genetic determinants of PMVT and may be useful to recognize patients who should be carefully observed for the subsequent development of overt MPDs. Venous thrombosis is the third most common cardiovascular affliction after ischemic heart disease and stroke [1Kniffin W.D. Baron J.A. Barret J. Birkmeyer J.D. Anderson Jr, F.A. The epidemiology of diagnosed pulmonary embolism and deep venous thrombosis in the elderly.Arch Intern Med. 1994; 154: 861-6Crossref PubMed Google Scholar]. The pathogenesis of venous thrombosis is multifactorial, involving acquired and genetic factors. In addition to circumstantial predisposing factors (e.g. surgery, pregnancy, immobilization, malignancy), genetic predisposition because of molecular abnormalities of components of the coagulation pathway have been found in subjects who had suffered from thromboembolic disease [2De Stefano V. Finazzi G. Mannucci P.M. Inherited thrombophilia. Pathogenesis, clinical syndromes and management.Blood. 1996; 87: 3531-44Crossref PubMed Google Scholar]. Splanchnic venous thrombosis, including thrombosis of the hepatic veins or portal venous system, is anuncommon event and may be caused by a variety of conditions including cirrhosis and cancer, and abdominal infectious and inflammatory processes [3Denninger M.H. Chait Y. Casadevall N. Hillaire S. Guillin M.C. Bezeaud A. Erlinger S. Briere J. Valla D. Cause of portal or hepatic vein thrombosis in adults: the role of multiple concurrent factors.Hepatology. 2000; 31: 587-91Crossref PubMed Scopus (576) Google Scholar]. Coexistence of causative factors was observed in a large setting of patients, indicating that thrombosis of the portal vein, like other manifestations of thrombosis, can be a result of combined pathogenetic mechanisms. Myeloproliferative disorders (MPDs), whether overt or latent, represent a main intrinsic factor for the development of thrombosis in the portal, mesenteric, and hepatic areas [4Gruppo Italiano Studio PolicitemiaPolycythemia vera: the natural history of 1,213 patients followed for 20 years.Ann Intern Med. 1995; 123: 656-64Crossref PubMed Scopus (468) Google Scholar, 5Randi M.L. Rossi C. Fabris F. Girolami A. Essential thrombocythemia in young adults: major thrombotic complications and complications during pregnancy – a follow up study of 68 patients.Clin Appl Thromb Hemost. 2000; 6: 31-5Crossref PubMed Scopus (26) Google Scholar, 6Kessler C.M. Propensity for hemorrhage and thrombosis in chronic myeloproliferative disorders.Semin Hematol. 2004; 41: 10-4Crossref PubMed Scopus (40) Google Scholar, 7Brodmann S. Passweg J.R. Gratwohl A. Tichelli A. Skoda R.C. Myeloproliferative disorders: complications, survival and causes of death.Ann Hematol. 2000; 79: 312-8Crossref PubMed Scopus (45) Google Scholar]. Venous thrombosis can involve all territories but MPDs, mainly polycythemia vera (PV) and essential thrombocythemia (ET), are the commonest underlying etiology for Budd–Chiari syndrome and PMVT; spontaneous endogenous erythroid‐colony formation being seen in up to 78% of patients thought to have Budd–Chiari Syndrome and in 48% of patients with splanchnic venous thrombosis [8De Stefano V. Teofili L. Leone G. Michiels J.J. Spontaneous erythroid colony formation as the clue to an underlying myeloproliferative disorder in patients with Budd‐Chiari syndrome or portal vein thrombosis.Semin Thromb Hemost. 1997; 23: 411-8Crossref PubMed Scopus (145) Google Scholar]. On the other hand, venous thromboses significantly affect morbidity and mortality of patients with MPD and are associated with severe organ damage and high mortality [9Passamonti F. Rumi E. Pungolino E. Malabarba L. Bertazzoni P. Valentini M. Orlandi E. Arcaini L. Brusamolino E. Pascutto C. Life expectancy and prognostic factors for survival in patients with polycythemia vera and essential thrombocythemia.Am J Med. 2004; 117: 755-61Abstract Full Text Full Text PDF PubMed Scopus (363) Google Scholar]. Recently, several groups identified a recurrent activating tyrosine kinase mutation, Val617Phe, in the JH2 pseudo‐kinase domain of the Janus kinase 2 (JAK2) gene in patients with sporadic MPDs. This mutation was found in most patients with PV and in about half of the patients with ET or myelofibrosis (MF) [10Baxter E.J. Scott L.M. Campbell P.J. East C. Fourouclas N. Swanton S. Vassiliou G.S. Bench A.J. Boyd E.M. Curtin N. Scott M.A. Erber W.N. Green A.R. Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders.Lancet. 2005; 365: 1054-61Abstract Full Text Full Text PDF PubMed Scopus (2300) Google Scholar, 11James C. Ugo V. Le Couedic J.P. Staerk J. Delhommeau F. Lacout C. Garcon L. Raslova H. Berger R. Bennaceur‐Griscelli A. Villeval J.L. Constantinescu S.N. Casadevall N. Vainchenker W. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera.Nature. 2005; 434: 1144-8Crossref PubMed Scopus (2898) Google Scholar, 12Kralovics R. Teo S.S. Buser A.S. Brutsche M. Tiedt R. Tichelli A. Passamonti F. Pietra D. Cazzola M. Skoda R.C. Altered gene expression in myeloproliferative disorders correlates with activation of signaling by the V617F mutation of Jak2.Blood. 2005; 106: 3374-6Crossref PubMed Scopus (153) Google Scholar, 13Levine R.L. Loriaux M. Huntly B.J. Loh M.L. Beran M. Stoffregen E. Berger R. Clark J.J. Willis S.G. Nguyen K.T. Flores N.J. Estey E. Gattermann N. Armstrong S. Look A.T. Griffin J.D. Bernard O.A. Heinrich M.C. Gilliland D.G. Druker B. et al.The JAK2V617F activating mutation occurs in chronic myelomonocytic leukemia and acute myeloid leukemia, but not in acute lymphoblastic leukemia or chronic lymphocytic leukemia.Blood. 2005; 106: 3377-9Crossref PubMed Scopus (320) Google Scholar, 14Levine R.L. Wadleigh M. Cools J. Ebert B.L. Wernig G. Huntly B.J. Boggon T.J. Wlodarska I. Clark J.J. Moore S. Adelsperger J. Koo S. Lee J.C. Gabriel S. Mercher T. D'Andrea A. Frohling S. Dohner K. Marynen P. Vandenberghe P. et al.Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis.Cancer Cell. 2005; 7: 387-97Abstract Full Text Full Text PDF PubMed Scopus (2444) Google Scholar]. This JAK2 mutation is an acquired somatic event in sporadic MPDs, leading to a constitutive activation of the JAK–signal transducer and activator of transcription signal transduction pathway [15Kralovics R. Passamonti F. Buser A.S. Teo S.S. Tiedt R. Passweg J.R. Tichelli A. Cazzola M. Skoda R.C. A gain‐of‐function mutation of JAK2 in myeloproliferative disorders.N Engl J Med. 2005; 352: 1779-90Crossref PubMed Scopus (2947) Google Scholar]. It is well‐known that PMVT may be an early or presenting complication of an undiagnosed MPD, particularly in young patients [4Gruppo Italiano Studio PolicitemiaPolycythemia vera: the natural history of 1,213 patients followed for 20 years.Ann Intern Med. 1995; 123: 656-64Crossref PubMed Scopus (468) Google Scholar, 8De Stefano V. Teofili L. Leone G. Michiels J.J. Spontaneous erythroid colony formation as the clue to an underlying myeloproliferative disorder in patients with Budd‐Chiari syndrome or portal vein thrombosis.Semin Thromb Hemost. 1997; 23: 411-8Crossref PubMed Scopus (145) Google Scholar] and that a portion of these patients do not fulfill the diagnostic criteria for MPD but have features suggestive of a latent form based on hyperplastic bone marrow and erythroid progenitor cell culture; these cases may subsequently develop overt MPD. Actually, a meta‐analysis of 120 patients from seven studies indicated that the estimated incidence of underlying MPD depends on the diagnostic criteria used [8De Stefano V. Teofili L. Leone G. Michiels J.J. Spontaneous erythroid colony formation as the clue to an underlying myeloproliferative disorder in patients with Budd‐Chiari syndrome or portal vein thrombosis.Semin Thromb Hemost. 1997; 23: 411-8Crossref PubMed Scopus (145) Google Scholar]. Very recently, the JAK2 V617F mutation has been found to occur in a high proportion of patients with Budd–Chiari syndrome, a heterogeneous group of disorders resulting from obstruction to hepatic venous outflow [16Patel R.K. Lea N.C. Heneghan M.A. Westwood N.G. Milojkovic D. Thanigaikumar M. Yallop D. Arya R. Pagliuca A. Gäken J. Wendon J. Heaton N.D. Mufti G.J. Prevalence of the activating JAK2 tyrosine kinase mutation V617F in the Budd–Chiari syndrome.Gastroenterology. 2006; 130: 2031-8Abstract Full Text Full Text PDF PubMed Scopus (222) Google Scholar]. The Chuvash polycythemia is associated with specific germline mutations in the von Hippel–Lindau tumor suppressor (VHL) gene, mainly the 598C > T, [17Pastore Y.D. Jelinek J. Ang S. Guan Y. Liu E. Jedlickova K. Krishnamurti L. Prchal J.T. Mutations in the VHL gene in sporadic apparently congenital polycythemia.Blood. 2003; 101: 1591-5Crossref PubMed Scopus (133) Google Scholar] and is characterized by a higher occurrence of splanchnic venous thrombosis [18Gordeuk V.R. Sergueeva A.I. Miasnikova G.Y. Okhotin D. Voloshin Y. Choyke P.L. Butman J.A. Jedlickova K. Prchal J.T. Polyakova L.A. Congenital disorder of oxygensensing: association of the homozygous Chuvash polycythemia VHL mutation with thrombosis and vascular abnormalities but not tumors.Blood. 2004; 103: 3924-32Crossref PubMed Scopus (210) Google Scholar, 19Bento M.C. Chang K.‐.T. Guan Y. Liu E. Caldas G. Gatti R.A. Prchal J.T. Congenital polycythemia with homozygous and heterozygous mutations of von Hippel‐Lindau gene: five new Caucasian patients.Haematologica. 2005; 90: 128-9PubMed Google Scholar]. Thus, we have investigated whether the clonal JAK2 V617F mutation and/or the VHL 598C > T mutation occur in a high proportion of non‐cirrhotic patients with portal and mesenteric venous thrombosis (PMVT) and whether determination of these mutations would be useful in the characterization of latent MPD in this patient setting. Patients with PMVT consecutively diagnosed and followed‐up at Gastroenterology Unit of the ‘A. Cardarelli’ Hospital, Naples were referred to the Thrombosis Centre of the same hospital for a work‐up at least 3 months after the thrombotic episode. All subjects with liver cirrhosis, hepatocellular carcinoma, or who reported a personal history of Budd–Chiari syndrome, were excluded from the study. Between January 1997 and June 2006, we investigated 112 non‐anticoagulated patients (median age 42 years; range 10–85 years), 50 men and 62 women, with a documented portal and/or mesenteric venous thrombosis. A complete clinical summary, with emphasis on personal and family history of thromboembolic disease and circumstantial vascular risk factors (surgery, immobilization, pregnancy, post‐partum, trauma, oral contraception, varicose veins and malignancy), was obtained from all subjects by a specially trained staff. Portal and mesenteric venous thromboses were diagnosed by Doppler ultrasonography, spiral computed tomography, or magnetic resonance imaging as required during the routine diagnostic work‐up. MPDs were diagnosed according to established criteria [20Pierre R.M.I. Thiele J. Vardiman J.W. Brunning R.D. Flandrin G. Pathology and genetics of tumors of haematopoietic and lymphoid tissues.in: Jaffe ES Harris NL Stein H Vardiman JW The World Health Organization Classification of Tumors. IARC Press, 2001: 32-44Google Scholar]. Two‐hundred and thirty apparently healthy subjects (98 men and 132 women; median age 44 years; range 21–73 years) randomly selected from a southern Italian general population of employees of the ‘Casa Sollievo della Sofferenza’ Hospital, S. Giovanni Rotondo, without a history of venous thromboembolism, served as controls. All subjects who reported a personal history of clinical venous thrombosis were excluded from the study. Both cases and controls were Caucasian and were from the same region. The two groups were comparable for sex, social status, and age. After approval from the local Ethics Committees, the study was carried out according to the Principles of the Declaration of Helsinki. Informed consent was obtained from all the subjects. Blood samples were collected into vacuum plastic tubes containing 3.8% trisodium citrate and centrifuged at 2000 × g for 15 min to obtain platelet‐poor plasma. After having filtered a portion for the assessment of lupus anticoagulant, samples were frozen and stored in small aliquots at −70 °C until tested. Antiphospholipid antibodies [lupus anticoagulant and immunoglobulin G anticardiolipin antibodies (ELISA, Byk Gulden, Italy)], antithrombin, protein C, amidolytic and immunological (Behring, Marburg, Germany) and total and free protein S antigen (ELISA, Diagnostica Stago, Asnières, France) were determined in all patients, as reported elsewhere [21Margaglione M. D'Andrea G. D'Addedda M. Giuliani N. Cappucci G. Iannaccone L. Vecchione G. Grandone E. Brancaccio V. Di Minno G. The Methylenetetrahydrofolate reductase TT677 genotype is associated with venous thrombosis independently of the coexistence of the FV Leiden and the prothrombin A20210 mutations.Thromb Haemost. 1998; 79: 907-11Crossref PubMed Scopus (142) Google Scholar]. Clotting assays were performed on a KC4 Amelung coagulometer (Amelung, Germany). Inter‐ and intra‐assay coefficients of all the variables never exceeded 8.0% and 5.0%, respectively. DNA was extracted from peripheral blood leukocytes according to standard protocols [22Margaglione M. Brancaccio V. Giuliani N. D'Andrea G. Cappucci G. Iannaccone L. Vecchione G. Grandone E. Di Minno G. Increased risk of venous thrombosis in carriers of the prothrombin A20210 gene variant.Ann Intern Med. 1998; 129: 89-93Crossref PubMed Scopus (219) Google Scholar]. A 220‐bp DNA fragment of the factor (F) V gene that includes the nucleotide 1691 was amplified and digested with MnlI as previously described [23Koeleman B.P.C. Reitsma P.H. Allart C.F. Bertina R.M. Activated protein C resistance as an additional risk factor for thrombosis in protein C‐deficient families.Blood. 1994; 84: 1031-5Crossref PubMed Google Scholar]. To identify the G > A mutation of the prothrombin gene, a 345‐bp fragment was obtained and then digested using the HindIII endonuclease, as reported [24Poort S.R. Rosendal F.R. Reitsma P.H. Bertina R.M. A common genetic variation in the 3′‐untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis.Blood. 1996; 88: 3698-703Crossref PubMed Google Scholar]. Amplifications of regions of JAK2 gene containing the V617F were performed as previously described [25Campbell P.J. Scott L.M. Buck G. Wheatley K. East C.L. Marsden J.T. Duffy A. Boyd E.M. Bench A.J. Scott M.A. Vassiliou G.S. Milligan D.W. Smith S.R. Erber W.N. Bareford D. Wilkins B.S. Reilly J.T. Harrison C.N. Green A.R. United Kingdom Myeloproliferative Disorders Study Group; Medical Research Council Adult Leukaemia Working Party; Australasian Leukaemia and Lymphoma GroupDefinition of subtypes of essential thrombocythaemia and relation to polycythaemia vera based on JAK2 V617F mutation status: a prospective study.Lancet. 2005; 366: 1945-53Abstract Full Text Full Text PDF PubMed Scopus (601) Google Scholar]. Genomic DNA was amplified by polymerase chain reaction (PCR), and successful amplification was confirmed by electrophoresis on an ethidium bromide‐impregnated 2.0% agarose gel. Oligonucleotide custom synthesis service was from Life Technologies (Paisley, UK). PCRs were carried out on 50 μL volume samples, in a Perkin Elmer Cetus thermal cycler (Perkin Elmer Cetus, Norwalk, CT, USA). Each sample contained 0.1 μg of genomic DNA, and 20 pmol L−1 each of sense and antisense primers (5′‐AGCAAGCTTTCTCACAAGCA‐3′ and 5′‐CTGACACCTAGCTGTGATCCTG‐3′, respectively), 125 μm of dNTP, 5 mm Tris–HCl pH 8.3, 50 mm KCl, 1.5 mm MgCl2, and 1 U Taq polymerase. The solution was overlaid with 50 μL of mineral oil and, after an initial denaturation step (3 min at 95 °C), it was put through 30 cycles, each consisting of 1 min at 95 °C, 1 min at 56–60 °C and 2 min at 72 °C. Then, 5 μL volumes of the amplification product were separated in a 2% agarose‐gel electrophoresis in TAE buffer (40 mm Tris‐acetate, 1 mm EDTA, pH 7.7) containing 0.5 μg mL−1 ethidium bromide, and visualized under ultraviolet light. Amplification products were subjected to restriction enzyme analysis using 2 IU of the BsaXI endonuclease (New England Biolabs Inc., Beverly, MA, USA), as previously reported [25Campbell P.J. Scott L.M. Buck G. Wheatley K. East C.L. Marsden J.T. Duffy A. Boyd E.M. Bench A.J. Scott M.A. Vassiliou G.S. Milligan D.W. Smith S.R. Erber W.N. Bareford D. Wilkins B.S. Reilly J.T. Harrison C.N. Green A.R. United Kingdom Myeloproliferative Disorders Study Group; Medical Research Council Adult Leukaemia Working Party; Australasian Leukaemia and Lymphoma GroupDefinition of subtypes of essential thrombocythaemia and relation to polycythaemia vera based on JAK2 V617F mutation status: a prospective study.Lancet. 2005; 366: 1945-53Abstract Full Text Full Text PDF PubMed Scopus (601) Google Scholar]. The G‐to‐T transversion in exon 12 leads to the missing of a site of digestion of BsaXI, giving rise to an uncut product instead of the two expected restriction fragments (96 and 56 bp). Then, amplified DNA fragments showing an abnormal pattern of digestion were cleaned with a QIAquick PCR purification kit (Qiagen, Valencia, CA, USA) and subjected to direct cycle sequence analysis using the Taq dye‐deoxy terminator method, the same primers used for amplification, and an ABI PRISM 310 Genetic Analyzer sequencer (PE Biosystems, Foster City, CA, USA). Because the JAK2 V617F mutation is an acquired somatic event, we indirectly assessed the sensitivity of methods employed to detect it using serial dilutions of the amplification product from a patient homozygous for the FV Q506 allele with that from a subject homozygous for the FV R506 allele. Using the restriction enzyme analysis, we were able to detect dilutions as low as 5%, whereas the lower limit of the direct cycle sequence analysis was 20%. The genotyping of the VHL 598C > T mutation was performed as previously described [17Pastore Y.D. Jelinek J. Ang S. Guan Y. Liu E. Jedlickova K. Krishnamurti L. Prchal J.T. Mutations in the VHL gene in sporadic apparently congenital polycythemia.Blood. 2003; 101: 1591-5Crossref PubMed Scopus (133) Google Scholar]. The VHL 598C > T mutation was identified by Fnu4HI restriction endonuclease (New England Biolabs) that digests the nucleotide sequence of the wild allele (C), but its targeted restriction site is abolished by the C‐to‐T transition. Then, amplified DNA fragments showing an abnormal pattern of digestion were cleaned with QIAquick PCR purification kit (Qiagen) and subjected to direct cycle sequence analysis using the Taq dye‐deoxy terminator method, the same primers used for amplification, and an ABI PRISM 310 Genetic Analyzer sequencer (PE Biosystems). All analyses were performed according using spss version 11.0 (SPSS Inc., Chicago, IL, USA). The significance of any difference in means was evaluated by non‐parametric test, whereas the significance of any difference in proportions was tested by chi‐squared statistics. The allele frequencies were estimated by gene counting, and genotypes were scored. The observed numbers of each gene mutation [Factor V Leiden (FV Leiden), FII A20210, JAK2 V617F, and VHL 598C > T] were compared with those expected for a population in Hardy–Weinberg equilibrium using a chi‐squared test. The significance of the difference of observed alleles and genotypes between the groups was tested using the chi‐squared analysis after grouping homozygous and heterozygous carriers of the FV Leiden mutation. Odds ratio (ORs) and 95% confidence intervals (95% CIs) were calculated. 95% CIs of a proportion were calculated using the modified Wald or exact method as required. Statistical significance was taken as P < 0.05. Between January 1997 and June 2006, 112 patients (50 men and 62 women) were diagnosed with documented PMVT. Thirteen patients (11.6%) were not studied: consent was refused in one; DNA samples were not available in four; six were lost in the follow‐up; and there were technical problems in two. Thus, we analyzed 99 patients (44 men and 55 women; median age 41 years; range 10–85 years). Demographic characteristics and the incidence of circumstantial and thrombophilic risk factors both in patients and in controls are shown in Table 1. An acquired thrombophilic risk factor was identified in 38 (38.4%; 95% CI 28.8–48.7) patients. The most represented were: history of a hematological malignancy (n = 11: MPD in nine and lymphoma in two); previous surgical intervention (n = 10); and the prescription of oral contraceptives (n = 8). In five patients a moderate hyperhomocysteinemia was found, and no patient displayed antiphospholipid antibodies.Table 1Clinical characteristics and thrombophilic risk factors in controls and patients investigatedVariablesControlsPatientsAge (years), median (range)44.0 (21–73)41.0 (10–85)Men, n (%)98 (42.6%)44 (44.4%)Acquired risk factors, n (%)NA38 (38.4%)* Hematologic malignancy, n (%)NA11 (11.1%) Surgery, n (%)NA10 (10.1%) Oral contraceptives, n (%)NA8 (8.1%) Homocysteine > 95 centile, n (%)NA5 (5.1%) Others, n (%)NA8 (8.2%)Inherited risk factors, n (%)NA21 (21.2%)† Factor V Leiden, n (%)9 (3.9)8 (8.1)‡ Factor II A20210 allele, n (%)7 (3.0)12 (12.1)§ Antithrombin deficiency, n (%)NA0 Protein C deficiency, n (%)NA2 (2.0) Protein S deficiency, n (%)NA0Risk factors, n (%)NA53 (53.5%)Combined risk factors, n (%)NA12 (12.1%)*Four patients carried combined acquired risk factors; †one patient carried combined inherited risk factors. ‡OR 2.2; 95% CI 0.8–5.6;§ OR 4.4; 95% CI 1.7–11.2. NA, not applicable. Open table in a new tab *Four patients carried combined acquired risk factors; †one patient carried combined inherited risk factors. ‡OR 2.2; 95% CI 0.8–5.6;§ OR 4.4; 95% CI 1.7–11.2. NA, not applicable. Patients had a higher incidence of the FII A20210 but not of the FV Leiden mutation. Actually, in this setting, the number of carriers of the FV Leiden mutation was eight (8.1%; 95% CI 3.6–15.3), seven heterozygotes and one homozygote, among patients, and nine heterozygotes (3.9%; 95% CI 1.8–7.3; OR 2.2; 95% CI 0.8–5.6) in healthy individuals. The FII A20210 mutation was detected in 12 cases (12.1%; 95% CI 6.4–20.2), all heterozygotes, and, in the heterozygous state, only in seven controls (3.0%; 95% CI 1.2–6.2; OR 4.4; 95% CI 1.7–11.2). Frequencies of all the mutations were similar in men and women (not shown). One patient was homozygous for the FV Leiden mutation and heterozygous for the FII A20210 mutation. In seven patients the coexistence of acquired and inherited thrombophilic risk factors was observed. Two additional patients had an isolated protein C deficiency. As a whole, a thrombophilic risk factor was identified in 53 patients (53.5%; 95% CI 43.2–63.6) and in 12 of them (12.1%; 95% CI 6.4–20.2) more than one risk factor was recorded. The median age of patients carrying a thrombophilic risk factor was 42 years (range 15–80 years) and was similar to that of patients without thrombophilic risk factors (40.0 years; range 10–72 years) (P = 0.612; Mann–Whitney U‐test). Among patients with PMVT, 17 (17.2%; 95% CI 10.9–25.9), five men and 12 women, carried the JAK2 V617F mutation (Table 2); all were heterozygotes. No members of the control group were found to carry the mutant allele. Samples from all subjects with PMVT and carrying the JAK2 V617F mutation were sequenced. In 16 out of 17 patients, the sequencing analysis showed a concordance with results obtained with the restriction fragment length analysis. In these patients, allele quantization, estimated taking into account the relative area of both alleles, gave comparable results for the wild (G) and the mutant (T) allele, the ratio never exceeding 60%. In the remaining patient, a 28‐year‐old woman, the mutant allele was detected only by restriction enzyme analysis. The median age of positive patients was 44 years (range 28–85 years) and was slightly higher than that (39.5 years; range 10–72 years) of the 82 (82.8%; 95% CI 74.1–89.1) patients, 39 men and 43 women, without the JAK2 V617F mutation (0.195; Mann–Whitney U‐test). None of patients presenting with the JAK2 V617F mutation carried an inherited thrombophilic risk factor, such as FV Leiden, FII A20210 mutation, or protein C deficiency. The knowledge of a MPD at the occurrence of the venous thrombotic event was recorded in seven (41.2%; 95% CI 18.4–67.1) patients with and two (2.4%; 95% CI 0.3–8.5) without the JAK2 V617F mutation. As a whole, acquired thrombophilic risk factors were recorded in 11 patients (64.7%; 95% CI 41.2–82.8) carrying the JAK2 V617F mutation and in 25 (30.5%; 95% CI 21.6–41.2) without (P = 0.012; two‐tailed Fisher's exact text). However, after excluding MPD, the difference was no longer significant, other acquired risk factors being found in only four patients (Table 2). Overall, the JAK2 V617F mutation was detected in seven out of nine patients (77.8%; 95% CI 40.0–97.2) presenting with a known MPD, as shown by peripheral blood counts and bone marrow biopsy. In detail, three patients with idiopathic MF, two out of three with ET, one out of two with PV, and one woman with chronic myeloid leukemia showed the JAK2 V617F mutation.Table 2Clinical characteristics of patients carrying the JAK2 V617F mutationPatientSexAge at diagnosisYearMyeloproliferative disordersRisk factorsVein thrombosesSMPWoman491997PV during the work‐upNonePortal, mesentericVCWoman611997CML knownHypehomocysteinemiaSpleen, portal, mesentericCMRWoman521998ET knownNonePortal, mesentericCAWoman442000MF during follow‐upAbdominal surgeryPortal, mesentericDSMRWoman462000NoNonePortalLRWoman352000MF knownNonePortal, mesentericSMWoman802000MF knownNonePortalGRWoman522001NoNnonePortal, mesentericLRMan502001MF during follow‐upNonePortal, mesentericTAMan422002ET knownNonePortalCAMan852003NoHyperhomocysteinemiaPortalNCMan422003PV knownNonePortal, mesentericMMWoman282003NoNoneSpleen, portalLFWoman342004NoOral contraceptivesSpleen, portal, mesentericDMMan802006NoNoneSpleen, portal, mesentericNAWoman362006MF knownNonePortal, mesentericLAWoman382006NoNonePortalCML, chronic myeloid leukemia; ET, essential thrombocythemia; MF, idiopathic myelofibrosis; PV, polycythemia vera. Open table in a new tab CML, chronic myeloid leukemia; ET, es" @default.
• W1549228081 created "2016-06-24" @default.
• W1549228081 creator A5001848379 @default.
• W1549228081 creator A5018892710 @default.
• W1549228081 creator A5018930724 @default.
• W1549228081 creator A5027920606 @default.
• W1549228081 creator A5032453565 @default.
• W1549228081 creator A5062758107 @default.
• W1549228081 creator A5067669128 @default.
• W1549228081 creator A5070194668 @default.
• W1549228081 date "2007-01-01" @default.
• W1549228081 modified "2023-10-14" @default.
• W1549228081 title "The JAK2 V617F mutation frequently occurs in patients with portal and mesenteric venous thrombosis" @default.
• W1549228081 cites W1531281563 @default.
• W1549228081 cites W1543904568 @default.
• W1549228081 cites W1969138367 @default.
• W1549228081 cites W1972058538 @default.
• W1549228081 cites W1979891446 @default.
• W1549228081 cites W1980568348 @default.
• W1549228081 cites W1996502308 @default.
• W1549228081 cites W1998721150 @default.
• W1549228081 cites W2000596340 @default.
• W1549228081 cites W2021336654 @default.
• W1549228081 cites W2023247498 @default.
• W1549228081 cites W2029497230 @default.
• W1549228081 cites W2032738172 @default.
• W1549228081 cites W2035150821 @default.
• W1549228081 cites W2049140059 @default.
• W1549228081 cites W2049145190 @default.
• W1549228081 cites W2057360098 @default.
• W1549228081 cites W2086955790 @default.
• W1549228081 cites W2089435005 @default.
• W1549228081 cites W2092777605 @default.
• W1549228081 cites W2093904358 @default.
• W1549228081 cites W2101502003 @default.
• W1549228081 cites W2103311738 @default.
• W1549228081 cites W2112503706 @default.
• W1549228081 cites W2114958842 @default.
• W1549228081 cites W2116533231 @default.
• W1549228081 cites W2125840023 @default.
• W1549228081 cites W2144664431 @default.
• W1549228081 cites W2156694334 @default.
• W1549228081 cites W2169405856 @default.
• W1549228081 cites W2269290009 @default.
• W1549228081 doi "https://doi.org/10.1111/j.1538-7836.2006.02277.x" @default.
• W1549228081 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17059429" @default.
• W1549228081 hasPublicationYear "2007" @default.
• W1549228081 type Work @default.
• W1549228081 sameAs 1549228081 @default.
• W1549228081 citedByCount "148" @default.
• W1549228081 countsByYear W15492280812012 @default.
• W1549228081 countsByYear W15492280812013 @default.
• W1549228081 countsByYear W15492280812014 @default.
• W1549228081 countsByYear W15492280812015 @default.
• W1549228081 countsByYear W15492280812016 @default.
• W1549228081 countsByYear W15492280812017 @default.
• W1549228081 countsByYear W15492280812018 @default.
• W1549228081 countsByYear W15492280812019 @default.
• W1549228081 countsByYear W15492280812020 @default.
• W1549228081 countsByYear W15492280812021 @default.
• W1549228081 countsByYear W15492280812023 @default.
• W1549228081 crossrefType "journal-article" @default.
• W1549228081 hasAuthorship W1549228081A5001848379 @default.
• W1549228081 hasAuthorship W1549228081A5018892710 @default.
• W1549228081 hasAuthorship W1549228081A5018930724 @default.
• W1549228081 hasAuthorship W1549228081A5027920606 @default.
• W1549228081 hasAuthorship W1549228081A5032453565 @default.
• W1549228081 hasAuthorship W1549228081A5062758107 @default.
• W1549228081 hasAuthorship W1549228081A5067669128 @default.
• W1549228081 hasAuthorship W1549228081A5070194668 @default.
• W1549228081 hasBestOaLocation W15492280811 @default.
• W1549228081 hasConcept C104317684 @default.
• W1549228081 hasConcept C126322002 @default.
• W1549228081 hasConcept C2779033008 @default.
• W1549228081 hasConcept C2780007613 @default.
• W1549228081 hasConcept C2780011451 @default.
• W1549228081 hasConcept C2780076729 @default.
• W1549228081 hasConcept C2780868729 @default.
• W1549228081 hasConcept C2908599710 @default.
• W1549228081 hasConcept C2909272587 @default.
• W1549228081 hasConcept C501734568 @default.
• W1549228081 hasConcept C54355233 @default.
• W1549228081 hasConcept C71924100 @default.
• W1549228081 hasConcept C86803240 @default.
• W1549228081 hasConcept C90924648 @default.
• W1549228081 hasConceptScore W1549228081C104317684 @default.
• W1549228081 hasConceptScore W1549228081C126322002 @default.
• W1549228081 hasConceptScore W1549228081C2779033008 @default.
• W1549228081 hasConceptScore W1549228081C2780007613 @default.
• W1549228081 hasConceptScore W1549228081C2780011451 @default.
• W1549228081 hasConceptScore W1549228081C2780076729 @default.
• W1549228081 hasConceptScore W1549228081C2780868729 @default.
• W1549228081 hasConceptScore W1549228081C2908599710 @default.
• W1549228081 hasConceptScore W1549228081C2909272587 @default.
• W1549228081 hasConceptScore W1549228081C501734568 @default.
• W1549228081 hasConceptScore W1549228081C54355233 @default.
• W1549228081 hasConceptScore W1549228081C71924100 @default.
• W1549228081 hasConceptScore W1549228081C86803240 @default.

• next