FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1569055773> ?p ?o ?g. }

• W1569055773 endingPage "843" @default.
• W1569055773 startingPage "833" @default.
• W1569055773 abstract "The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (author) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If author is substituted with d(TCTCCTCCTTC) (en), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and author (h : author) but not by h and en, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h : author is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (Δɛ=80 m−1 cm−1 at 242 nm and a stronger one (Δɛ=210 m−1 cm−1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py : Pu : Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h : s1 is accompanied by an average change in enthalpy (less the protonation contribution) of −73(±5) kcal/mol of triplex, which corresponds to −6·6(±0·4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions." @default.
• W1569055773 created "2016-06-24" @default.
• W1569055773 creator A5002664761 @default.
• W1569055773 creator A5010135314 @default.
• W1569055773 creator A5055386727 @default.
• W1569055773 creator A5058608501 @default.
• W1569055773 creator A5065165497 @default.
• W1569055773 creator A5078406609 @default.
• W1569055773 date "1990-06-01" @default.
• W1569055773 modified "2023-10-16" @default.
• W1569055773 title "Triple helix formation by oligopurine-oligopyrimidine DNA fragments" @default.
• W1569055773 cites W1966071066 @default.
• W1569055773 cites W1966342019 @default.
• W1569055773 cites W1968806585 @default.
• W1569055773 cites W1968922633 @default.
• W1569055773 cites W1990826437 @default.
• W1569055773 cites W1993005791 @default.
• W1569055773 cites W1993455604 @default.
• W1569055773 cites W1996088149 @default.
• W1569055773 cites W1997496514 @default.
• W1569055773 cites W1998239451 @default.
• W1569055773 cites W2006902722 @default.
• W1569055773 cites W2010731690 @default.
• W1569055773 cites W2012210882 @default.
• W1569055773 cites W2013399923 @default.
• W1569055773 cites W2017588515 @default.
• W1569055773 cites W2023839942 @default.
• W1569055773 cites W2024236380 @default.
• W1569055773 cites W2032952735 @default.
• W1569055773 cites W2034494410 @default.
• W1569055773 cites W2047122757 @default.
• W1569055773 cites W2047236748 @default.
• W1569055773 cites W2050822975 @default.
• W1569055773 cites W2066355347 @default.
• W1569055773 cites W2073811667 @default.
• W1569055773 cites W2074192067 @default.
• W1569055773 cites W2081446791 @default.
• W1569055773 cites W2090695071 @default.
• W1569055773 cites W2091252066 @default.
• W1569055773 cites W2096023285 @default.
• W1569055773 cites W2096324057 @default.
• W1569055773 cites W2133918133 @default.
• W1569055773 cites W2156163511 @default.
• W1569055773 cites W2471905887 @default.
• W1569055773 cites W4232909320 @default.
• W1569055773 doi "https://doi.org/10.1016/s0022-2836(05)80267-0" @default.
• W1569055773 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/2359124" @default.
• W1569055773 hasPublicationYear "1990" @default.
• W1569055773 type Work @default.
• W1569055773 sameAs 1569055773 @default.
• W1569055773 citedByCount "163" @default.
• W1569055773 countsByYear W15690557732012 @default.
• W1569055773 countsByYear W15690557732013 @default.
• W1569055773 countsByYear W15690557732014 @default.
• W1569055773 countsByYear W15690557732015 @default.
• W1569055773 countsByYear W15690557732016 @default.
• W1569055773 countsByYear W15690557732017 @default.
• W1569055773 countsByYear W15690557732019 @default.
• W1569055773 countsByYear W15690557732020 @default.
• W1569055773 countsByYear W15690557732022 @default.
• W1569055773 countsByYear W15690557732023 @default.
• W1569055773 crossrefType "journal-article" @default.
• W1569055773 hasAuthorship W1569055773A5002664761 @default.
• W1569055773 hasAuthorship W1569055773A5010135314 @default.
• W1569055773 hasAuthorship W1569055773A5055386727 @default.
• W1569055773 hasAuthorship W1569055773A5058608501 @default.
• W1569055773 hasAuthorship W1569055773A5065165497 @default.
• W1569055773 hasAuthorship W1569055773A5078406609 @default.
• W1569055773 hasConcept C10919887 @default.
• W1569055773 hasConcept C111921641 @default.
• W1569055773 hasConcept C133571119 @default.
• W1569055773 hasConcept C185592680 @default.
• W1569055773 hasConcept C18903297 @default.
• W1569055773 hasConcept C2778530040 @default.
• W1569055773 hasConcept C2779965526 @default.
• W1569055773 hasConcept C552990157 @default.
• W1569055773 hasConcept C55493867 @default.
• W1569055773 hasConcept C71240020 @default.
• W1569055773 hasConcept C8010536 @default.
• W1569055773 hasConcept C86803240 @default.
• W1569055773 hasConcept C99611785 @default.
• W1569055773 hasConceptScore W1569055773C10919887 @default.
• W1569055773 hasConceptScore W1569055773C111921641 @default.
• W1569055773 hasConceptScore W1569055773C133571119 @default.
• W1569055773 hasConceptScore W1569055773C185592680 @default.
• W1569055773 hasConceptScore W1569055773C18903297 @default.
• W1569055773 hasConceptScore W1569055773C2778530040 @default.
• W1569055773 hasConceptScore W1569055773C2779965526 @default.
• W1569055773 hasConceptScore W1569055773C552990157 @default.
• W1569055773 hasConceptScore W1569055773C55493867 @default.
• W1569055773 hasConceptScore W1569055773C71240020 @default.
• W1569055773 hasConceptScore W1569055773C8010536 @default.
• W1569055773 hasConceptScore W1569055773C86803240 @default.
• W1569055773 hasConceptScore W1569055773C99611785 @default.
• W1569055773 hasIssue "4" @default.
• W1569055773 hasLocation W15690557731 @default.
• W1569055773 hasLocation W15690557732 @default.
• W1569055773 hasOpenAccess W1569055773 @default.

• next