FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1570371361> ?p ?o ?g. }

• W1570371361 endingPage "3717" @default.
• W1570371361 startingPage "3701" @default.
• W1570371361 abstract "Neuropeptide S (NPS) and its cognate receptor represent a recently discovered transmitter system in the brain modulating anxiety- and stress-related behaviour. Using a transgenic NPS-EGFP-expressing mouse line, the present study shows that NPS-expressing neurons are situated in close proximity to corticotropin-releasing factor (CRF)-containing fibres at the locus coeruleus in the brain stem and express the CRF receptor 1 (CRF1). CRF depolarizes NPS neurons via activation of the CRF1 receptor through two different ionic mechanisms (a decrease in potassium and an increase in cation conductance) involving the cAMP signalling pathway. After acute immobilization stress, NPS neurons display an increased expression of c-fos. This study identifies a mechanism by which stress-related CRF release might activate NPS neurons in the brain stem, thereby triggering NPS release in target areas such as the amygdala, and functioning as a negative feedback control to buffer stress responsiveness. Abstract A recently discovered neurotransmitter system, consisting of neuropeptide S (NPS), NPS receptor, and NPS-expressing neurons in the brain stem, has received considerable interest due to its modulating influence on arousal, anxiety and stress responsiveness. Comparatively little is known about the properties of NPS-expressing neurons. Therefore in the present study, a transgenic mouse line expressing enhanced green fluorescent protein (EGFP) in NPS neurons was used to characterize the cellular and functional properties of NPS-expressing neurons located close to the locus coeruleus. Particular emphasis was on the influence of corticotropin-releasing factor (CRF), given previous evidence of stress-related activation of the NPS system. Upon acute immobilization stress, an increase in c-fos expression was detected immunocytochemically in brain stem NPS-EGFP neurons that also expressed the CRF receptor 1 (CRF1). NPS-EGFP neurons were readily identified in acute slice preparations and responded to CRF application with a membrane depolarization capable of triggering action potentials. CRF-induced responses displayed pharmacological properties indicative of CRF1 that were mediated by both a reduction in membrane potassium conductance and an increase in a non-specific cation conductance different from the hyperpolarization-activated cation conductance Ih, and involved protein kinase A signalling. In conclusion, stress exposure results in activation of brain stem NPS-expressing neurons, involving a CRF1-mediated membrane depolarization via at least two ionic mechanisms. These data provide evidence for a direct interaction between the CRF and the NPS system and thereby extend previous observations of NPS-modulated stress responsiveness towards a mechanistic level. The neuropeptide S system consists of the 20-amino-acid neuropeptide S (NPS) and its G protein-coupled receptor, NPSR. Experimental NPSR activation by central NPS injection affects food intake (Smith et al. 2006), the sleep–wake cycle, states of arousal (Xu et al. 2004), general anxiety (Xu et al. 2004; Jüngling et al. 2008; Meis et al. 2008; Rizzi et al. 2008), extinction of conditioned fear responses (Jüngling et al. 2008), and consolidation of aversive and neutral memories (Okamura et al. 2011). In rats, central administration of NPS enhances dopamine release in the medial prefrontal cortex, but leaves serotonergic transmission unaffected (Si et al. 2010). Furthermore, recent human studies show that polymorphisms of NPSR are linked to personal fear reactions and to panic disorders (Okamura et al. 2007; Donner et al. 2010; Raczka et al. 2010; Domschke et al. 2011). Adding to this evidence on the involvement of the NPS system in anxiety-related behaviour, recent studies have demonstrated that forced swimming stress in rodents results in an increase in extracellular levels of NPS in the basolateral amygdala (Ebner et al. 2011), implying activation of the NPS system upon stress exposure. In the mouse, NPS-expressing neurons are located in two areas in the brain stem. One is positioned between the locus coeruleus (LC) and Barrington's nucleus, close to the 4th ventricle, and the second is located between the lateral parabrachial nucleus (LPB) and the Kölliker fuse nucleus (Clark et al. 2011). Recent immunohistochemical and in situ hybridization studies revealed dense projections of NPS-positive fibres and NPSR mRNA expression in a number of brain areas involved in fear and anxiety (e.g. amygdala), learning and memory (e.g. amygdala and subiculum), arousal and stress responses (e.g. anterior paraventricular thalamic nucleus), which together are considered adequate for mediating the modulatory effects of NPS (Clark et al. 2011). In keeping with this, short-term swim stress and prolonged restraint stress in mice have been shown to activate immediate early genes in NPS-expressing neurons in the brain stem (Liu et al. 2011). While the NPS system thus seems to be in an important position for modulating anxiety, arousal and stress responses, there are no data yet on the physiological properties of NPS-expressing neurons in the brain stem and their modulation by transmitter systems relating to stress responsiveness. Therefore the present study has been undertaken to characterize the basic physiological and morphological properties of NPS-expressing neurons in the brain stem, and to identify cellular mechanisms contributing to their stress-related activation. The experimental strategy was (i) to use a transgenic mouse line expressing EGFP under the control of the natural NPS-promotor sequence (Liu et al. 2011), allowing reliable identification of NPS-expressing neurons in the brain stem; (ii) to assess stress-induced activation of NPS neurons through monitoring immediate early gene activation and corticotropin-releasing factor receptor 1 (CRF1) expression upon acute immobilization stress (AIS); and (iii) to identify mechanisms of CRF1 stimulation in NPS-expressing neurons using single cell RT-PCR combined with electrophysiological and pharmacological techniques in acute slice preparations in vitro. Heterozygous NPS-EGFP mice (transgenic line E16) were bred with C57BL/6 mice and offspring were genotyped by PCR as described previously (Liu et al. 2011). Mice were kept in a temperature- (21°C) and humidity-controlled (50–60% relative humidity) animal facility with access to food and water ad libitum and a 12 h:12 h light–dark cycle with lights on at 06.00 h. All animal experiments were carried out in accordance with national regulations on animal experimentation (European Committees Council Directive 86/609/EEC; National Research Council of the National Academies) and protocols were approved by the local authorities (Bezirksregierung Münster, AZ 50.0835.1.0, G 53/2005; Institutional Animal Care and Use Committee, University of California Irvine). Five- to eight-week-old transgenic NPS-EGFP mice (transgenic NPS-EGFP mouse line E16; Liu et al. 2011) of either sex were anaesthetized with Forene (isoflurane; 1-chloro-2,2,2-trifluoroethyl-difluoromethylether; 2.5%) and killed by decapitation. Horizontal slices (300 μm thick) containing the LC were prepared. Whole-cell patch-clamp recordings (in voltage- or current-clamp mode) were performed as described previously (Jüngling et al. 2008). Briefly, we used patch pipettes made of borosilicate glass (GC150T-10, Harvard Apparatus, Edenbridge, UK), pulled on a vertical puller (PA-10, E.S.F. Electronic, Göttingen, Germany). The intracellular solution used to analyse the intrinsic properties of NPS-EGFP neurons contained (in mm): NaCl 10, potassium gluconate 105, potassium citrate 20, Hepes 10, BAPTA 3, MgCl2 1, MgATP 3, and NaGTP 0.5. The pH was adjusted to 7.25. Artificial cerebrospinal fluid (ACSF) was used as extracellular solution and contained (in mm): NaCl 120, KCl 2.5, NaH2PO4 1.25, MgSO4 2, CaCl2 2, and glucose 20. The pH was adjusted to 7.3 by gassing with carbogen (95% O2, 5% CO2). The liquid junction potential was corrected for (10 mV). All experiments were performed at 30–32°C. Gabazine (25 μm), CGP55845 (10 μm), d-(–)-2-amino- 5-phosphonopentanoic acid (AP5, 50 μm), and 6,7-dinitroquinoxaline-2,3-dione (DNQX, 10 μm) were added to the bathing solution as required to block glutamatergic and GABAergic postsynaptic currents. In some experiments, tetrodotoxin (TTX, 1 μm) was added to decrease network activity (toxins were purchased from Biozol Diagnostica Vertrieb GmbH, Germany). Electrophysiological data were acquired with an EPC10 double amplifier (HEKA, Germany) at a sampling rate of 10 kHz and analysed offline with Clampfit10 software (Molecular Devices Corporation, Sunnyvale, CA, USA). The active and passive membrane properties were assessed during whole-cell current-clamp recordings at a membrane potential of −60 mV. Hyper- and depolarizing currents were injected for 500 ms (injected currents from −50 pA to +140 pA; ΔI: +10 pA). Active membrane properties were analysed during depolarizing current injections of +80 pA to +120 pA. The input resistance of the recorded neurons was calculated by: Rinput=ΔV/I. ΔV was measured under steady-state conditions at the end of an injected hyperpolarizing current pulse (I=−50 pA) with a duration of 500 ms. The capacitance was calculated by: C=τ/R, whereby the membrane time constant τ was obtained by a monoexponential fit of the membrane potential shift induced by a current injection of −50 pA and a duration of 500 ms. The resting membrane potential was measured immediately after establishing the whole-cell configuration. The after-hyperpolarizing potential (AHP) was measured after the first action potential (AP). The frequency adaptation index (FAI) was calculated by: FAI = frequency of the last two APs/frequency of the first two APs. The amplitude adaptation (AA) was calculated by: AA = amplitude of last AP/amplitude of first AP. The AP half-width was measured from the first AP. Spontaneous action potential generation was recorded in the cell-attached configuration with a patch-pipette filled with extracellular solution (see Perkins, 2006). A subset of NPS-EGFP-expressing neurons (n= 16) was filled with 1 mg ml−1 neurobiotin (Sigma) for at least 45 min. Slices were fixed with 4% paraformaldehyde over night and then permeabilized with 0.5% Triton X-100 in PBS. Unspecific binding sites were blocked by 5% bovine serum albumin (BSA) in PBS. The cells were stained with streptavidin-DyLight549 conjugate (1:500; Vector Laboratories, Burlingame, CA, USA). NPS-EGFP neurons were recorded in the current-clamp mode at a membrane potential of ∼−70 mV. Data acquisition started after a minimal equilibration time of about 5 min. CRF (250 nm) and the CRF1-specific agonist Stressin I (250 nm, Sigma) were bath-applied for 5–7 min. The substance-induced shift of the membrane potential was analysed at the end of the substance application. To analyse changes in input resistance, the membrane potential was manually set to baseline values by adjusting a DC offset to exclude changes of the input resistance induced by voltage-dependent conductances. The CRF1-specific antagonist NBI27914 (10 μm, Sigma) was bath-applied 5 min prior to CRF application. 2-Aminoethoxydiphenyl borate (2-APB; 100 μm; Tocris) and ZD 7288 (30 μm; Tocris) were bath-applied at least 5 min prior to CRF to block transient receptor potential (TRP) channels or hyperpolarization-activated cation conductances (Ih), respectively. The protein kinase A (PKA) antagonist H89 (10 μm; Sigma) was used in the intracellular recording solution. 8-Br-cAMP (100 μm; Sigma) was included in the internal pipette solution during current-clamp recordings. The adenylyl cyclase activator forskolin (20 μm; Sigma) was bath-applied. All recordings were done in the presence of DNQX, gabazine, CGP55845, AP5 and phentolamine hydrochloride (20 μm; Sigma). In some experiments, 1 μm TTX was added to the extracellular solution to minimize network activity. For voltage-clamp ramp experiments, NPS-EGFP neurons were recorded in the voltage-clamp mode at a holding potential of −60 mV. Depolarizing voltage-clamp ramps (from −120 mV to −20 mV; 40 mV s−1) were repeated at least three times during baseline conditions (interstimulus interval: 75 s) and in the presence of 250 nm CRF or 20 μm forskolin. The injected holding current was monitored constantly during baseline recordings and CRF application. As an intracellular solution we used either the potassium gluconate-based (K-gluc) solution (described above) or a caesium methanesulfonate-based solution (Cs-meth), containing (in mm): 4-AP 5, CsMeSO4 120, EGTA 1, Hepes 10, TEA-Cl 20, MgCl2 2, CaCl2 0.5, Na-ATP 2, Na-GTP 0.5, to block potassium conductances. The extracellular solution contained TTX (1 μm), DNQX (10 μm), AP5 (50 μm), gabazine (25 μm), CGP55845 (10 μm), and phentolamine hydrochloride (20 μm) to reduce network activity. Additionally, 50 μm CdCl2 was added to the extracellular solution to minimize Ca2+ inward currents during ramp experiments. The CRF-induced current was calculated by subtracting the ramp during baseline recordings from ramps recorded in the presence of CRF (5 min after CRF application). Reversal potentials of the CRF-induced currents were analysed by plotting the injected current against the respective membrane potential. Cell harvesting and single-strand cDNA synthesis was performed as previously reported (Sosulina et al. 2008). A multiplex two-round single-cell PCR was carried out for simultaneous detection of hypoxanthine-guanine phosphoribosyltransferase (HPRT, which was considered to be a housekeeping gene), CRF1 and CRF2. The primers for the amplification of CRF1 were identical to those used in Jasoni et al. 2005. For the amplification of HPRT and CRF2 the following primers were used. HPRT (GenBank accession number NM-013556.2), sense: GCAGTCCCAGCGTCGTGA (position 157), antisense: CAAGGGCATATCCAACAACAAACT (position 726); CRF2 (NM-009953.3), sense: AGTGGCTTTTCCT CTTCATTG (position 859), antisense: CGCGCACCTCT CCATTG (position 1290). For multiplex amplification 45 cycles were performed as described previously (Sosulina et al. 2010). An aliquot (3 μl) of PCR product was used as a template for the second PCR (35 cycles; annealing at 60°C). The nested primers for the amplification of CRF1 and HPRT were identical to those used in Jasoni et al. 2005, and Jüngling et al. 2008, respectively. The following nested primers for amplification of CRF2 were used. Sense: CATTCCCTGCCCTATCATCAT (position 887), antisense: GTAGAAAACGGACACAAAGAAACC (position 1265). The predicted sizes (in base pairs) of the PCR-generated fragments were: 353 (HPRT), 162 (CRF1), 379 (CRF2). The presence of the amplified fragments was identified by electrophoresis in an agarose gel (1.6%) and visualized by ethidium bromide staining, using a molecular weight marker (pUC19, Carl Roth, Karlsruhe, Germany). Negative controls, omission of the reverse transcriptase in the RT step or using a bath solution instead of the collected neurons, did not render any PCR-generated products. Male mice (8–10 weeks, n= 3–4 per group) were subjected to 20 min restraint stress, as described previously (Liu et al. 2011). Unstressed transgenic mice served as controls. Two hours after the end of the stress protocol mice were anaesthetized and perfused as described below. Brains were removed and processed for immunohistochemical analysis of EGFP, CRF1, and c-fos staining (as a marker of neuronal activation). In each brain stem section, the total number of EGFP-positive neurons was counted. Numbers of cells double stained for EGFP and CRF1, or triple stained for EGFP, CRF1 and c-fos were determined using appropriate laser illumination and percentages of multi-stained neurons were calculated. Immunohistochemical detection of the EGFP transgene and the intrinsic NPS expressed by NPS neurons in the LC region was carried out as described previously (Liu et al. 2011). Briefly, mice were deeply anaesthetized by intraperitoneal injection of a mixture of ketamine (100 mg ml−1 in isotonic saline) and xylazine (20 mg ml−1), then perfused transcardially with saline (0.9% NaCl), followed by 4% paraformaldehyde in 0.1 m phosphate buffer, pH 7.4. Brains were removed and postfixed in the same fixative overnight at 4°C. Brains were cryoprotected in 20% sucrose in 0.1 m phosphate buffer, pH 7.4, at 4°C overnight and then stored at −80°C. Cryostat sections (40 μm) were prepared for free-floating slices. Brain slices were processed as described (Liu et al. 2011). Slices were incubated with primary antisera at optimized dilutions (chicken anti-GFP, 1:1000, ab13970, Abcam; goat anti-CRF1, 1:1000, EB08035, Everest Biotech; rabbit anti-c-fos, 1:500, sc-52, Santa Cruz Biotechnology) in blocking buffer (PBS, 0.3% Triton X-100, 5% normal donkey serum) at 4°C for 48 h. Afterwards, brain slices were washed 3 times with PBS for 5 min before incubation with appropriate fluophore-conjugated secondary antibodies (purchased from Jackson ImmunoResearch Lab, West Grove, PA, USA) in blocking buffer for 1.5 h at optimized dilutions (DyLight 488 AffiniPure donkey anti-chicken IgY (IgG) (H+L), 1:400; Alexa Fluor 568 donkey anti-goat IgG (H+L), 1:500; DyLight 649 AffiniPure donkey anti-rabbit IgG (H+L), 1:400) at room temperature. Slices were washed again 3 × 5 min with PBS before mounting on glass slides with Citifluor mounting media (Ted Pella, Redding, CA, USA) containing 4′,6-diamidino-2-phenylindole (DAPI) to stain cell nuclei. Triple-immunostained brain slices were analysed under a confocal laser-scanning microscope (Zeiss LSM 710 Meta, Zeiss, Thornwood, NY, USA) with single-photon excitation at 488, 543 and 633 nm. Raw image files were adjusted for colour balance, evenness of illumination and contrast using Adobe Photoshop. For immunohistochemical stainings of corticotropin-releasing factor (CRF) peptide, 50 μm-thick horizontal slices containing the LC were cut. After permeabilization in 0.25% Triton X-100 for 20 min, unspecific binding sites were blocked with 5% BSA and 5% normal goat serum (NGS; in PBS) for 1 h at room temperature. The primary antibody (rabbit anti-CRF, 1 mg ml−1, C-5348, Sigma) was applied at a dilution of 1:500 in PBS containing 0.01% Triton X-100, 2% BSA, and 2% NGS for 24 h at 4°C. The secondary antibody (goat anti-rabbit-Cy3 conjugated; Dianova; cat. no. 111-165-003) was applied at a dilution of 1:400 in PBS for 90 min at room temperature. To control the specificity of the primary antibody against CRF, in some experiments the antibody solution was preabsorbed with 2.5 μm CRF for 40 min. Stained slices were analysed with a laser scanning confocal microscope (Nikon eC1 plus) using an Achro LWD ×16/0.8w objective (Nikon). To detect fluorescence, lasers of 488 nm and 543 nm have been used with adequate emission filters (515/30 and 605/75 nm). All data sets were tested for statistically significant outliers using the Grubbs’ test (significance level P < 0.05). Prior to statistical comparison, the data were tested for normal distribution using the Shapiro–Wilk test. Within-group comparisons were done using Student's t test (significance level *P < 0.05; **P < 0.01). To analyse differences between different groups, a one-way ANOVA followed by a Bonferroni post hoc test was used (significance level *P < 0.05; **P < 0.01). Fractions of double- or triple-stained neurons in the LC area were normalized to the total number of EGFP-positive neurons per section. Percentages per mouse brain were averaged and analysed by two-way ANOVA comparing staining data from stressed and unstressed animals with treatment and gene expression as variables, followed by Bonferroni's post hoc test wherever appropriate. In acute horizontal slice preparations from transgenic NPS-EGFP mice, EGFP-expressing neurons located between the locus coeruleus (LC) and Barrington's nucleus (BN) were readily visualized by their green fluorescence (Fig. 1A–C). A major population of EGFP-expressing neurons appeared as a thin band of cells on the rostro-caudal axis between LC and BN (Fig. 1A). Immunocytochemical studies verified that EGFP-labelled neurons are also NPS-immunopositive (Fig. 1B). Therefore we refer to them as ‘NPS-EGFP neurons’ in the present study. A subset of these NPS-EGFP neurons (n= 16) was intracellularly filled with neurobiotin and counterstained with streptavidin DyLight549 (Fig. 1C and D). NPS-EGFP neurons possessed cell bodies of various shapes, including spindle-like and multipolar forms, and sparse spine-like protrusions on their dendrites (Fig. 1D). NPS-EGFP-expressing neurons in the LC region A, scheme of a horizontal slice containing NPS-EGFP neurons close to the LC and the LPB (left; modified from mbl.org). Representative horizontal slice preparation (right). Clusters of NPS-EGFP neurons (green) are marked. B, co-expression of endogenous NPS (red) and the EGFP transgene (green) in neurons of the LC region verified by immunohistochemical staining. C, confocal-microscopy image of an NPS-EGFP-expressing neuron (upper left) in the LC region near the 4th ventricle during a whole-cell patch-clamp recording. Note the diffusion of EGFP into the pipette solution during the whole-cell configuration. NPS-EGFP neuron (green; upper right) filled with neurobiotin and stained with streptavidin-DyLight594 (red; lower panel). D, neurites of neurobiotin-filled NPS-EGFP neurons show only sparse spine-like protrusions. Immunocytochemical stainings revealed CRF-positive fibres co-localized with NPS-EGFP neurons in the LC area (Fig. 2A and B). At higher magnification, fibres apparently containing synaptic bouton-like structures were visible (Fig. 2B). CRF-positive structures seemed to be localized at the soma and/or proximal dendritic components of the NPS-EGFP neurons. To prove the specificity of the used antibody against CRF, some slices were treated with a CRF antibody that was preabsorbed with 2.5 μm CRF. In these control slices, no fibre-like structures were visible and the overall fluorescent signal was largely reduced to autofluorescence of the preparation (Fig. 2C). Furthermore, the CRF antibody detected CRF-expressing neurons located in the paraventricular nucleus of the hypothalamus (PVN) close to the third ventricle (Fig. 2D). Co-localization of NPS-EGFP neurons and CRF/CRF1 in the LC region A, immunohistochemical staining for CRF (red) in horizontal brain slices. Fibre-like CRF-positive structures can be detected in the vicinity of NPS-EGFP neurons (green). B, inset of A in higher magnification. Note the presence of fibre-like structures positive for CRF (arrows), which co-localize with NPS-EGFP neurons. C, negative control staining with preabsorbed (2.5 μm CRF for 40 min) anti-CRF antibody. D, staining of CRF-expressing neurons in the PVN prove antiserum specificity. E, single-cell RT-PCR for CRF1, CRF2 and the house-keeping gene HPRT. Five of ten collected samples of individual NPS-EGFP neurons were positive for CRF1 mRNA (*). In contrast, all samples were negative for CRF2 mRNA. (M, marker; +, whole-brain lysate as positive control; –, ACSF from the recording chamber as negative control). F, triple-immunohistochemical stainings in coronal slices for NPS-GFP (green), CRF1 (yellow), and c-fos (red) in control mice that were not subjected to AIS. Arrows denote CRF1 co-expression in NPS-positive neurons. G, triple-immunohistochemical stainings for NPS-EGFP (green), CRF1 (yellow), and c-fos (red) in mice that were exposed to 20 min AIS. Note the presence of c-fos expression in NPS-EGFP neurons, which is absent in controls. Arrows denote cells showing positive staining for NPS, CRF1 and c-fos. Quantification of LC area EGFP-positive neurons co-staining for CRF1 and c-fos in mice subjected to immobilization stress or unstressed control animals. n= 3 mice per group. Total number of EGFP-positive neurons analysed: 60 in control mice, 63 in stressed animals. ***P < 0.001 stress vs. no stress controls after positive two-way ANOVA and Bonferroni's post hoc test. Next, cytoplasm was collected from individual NPS-EGFP neurons (n= 10) near the LC in acute slice preparations, and single-cell RT-PCR was performed to detect CRF1 and CRF2 mRNA (Fig. 2E). HPRT was used as housekeeping gene, and whole-brain lysate and ACSF collected from the recording chamber were taken as positive (+) and negative (–) controls, respectively. In five of the ten collected cytoplasms, CRF1 transcripts could be detected (*; Fig. 2E). In two of the samples, amplification products of different molecular weight were detected and, thus, considered negative. No collected samples contained CRF2 transcripts (Fig. 2E). These data indicate that at least a subpopulation of NPS-synthesizing neurons expresses the CRF1. In order to assess stress-related activation of CRF1-expressing NPS-EGFP neurons, transgenic mice were exposed to AIS and triple immunohistochemical stainings were performed to visualize NPS-EGFP, CRF1 and c-fos. In non-stressed control mice, about 80% of NPS-EGFP neurons co-expressed CRF1, and no detectable up-regulation of c-fos was observed in NPS-EGFP neurons or neurons expressing both EGFP and CRF1 (Fig. 2F). In mice that were exposed to 20 min AIS, CRF1 was similarly detected in about 75% NPS-expressing neurons, and more than half of the EGFP/CRF1-positive neurons demonstrated c-fos expression, indicating stress-induced activation of these neurons (Fig. 2G). Two-way ANOVA revealed significant interaction of stress treatment × marker protein expression (F(2,12)= 27.03, P < 0.0001), with main effects of treatment (F(1,12)= 64.30, P < 0.0001) and expression of marker proteins (F(2,12)= 84.73, P < 0.0001). The co-localization of NPS-EGFP and CRF1 suggested that NPS-EGFP neurons might be activated by CRF via the CRF1. In order to test this hypothesis, cell-attached recordings of NPS-EGFP neurons were performed, and spontaneous spike firing before and after application of CRF (250 nm) was monitored (Fig. 3A). In a majority of neurons (11/19), CRF significantly increased the frequency of spike firing (Fig. 3B). The mean frequency was 0.21 ± 0.09 Hz at baseline and 0.62 ± 0.14 Hz in the presence of CRF (n= 10; P < 0.05; Fig. 3C). Of note, 8 out of 19 neurons did not show spike firing, and application of CRF had no effect. CRF increases spontaneous spike firing in NPS-EGFP neurons A, example recording of spontaneously generated spikes in a cell-attached configuration (top) during baseline conditions and in the presence of 250 nm CRF. The histogram (recorded events per 10 s bin vs. bin) shows a CRF-induced increase of activity of the recorded NPS-EGFP neuron. B, mean frequencies of generated spikes vs. 10 s bins. The grey boxes indicate the time-points for analysing the frequencies during baseline conditions and in the presence of CRF. Mean frequencies of individual recordings (n= 10) are plotted in C. In another line of experiments, cellular properties of NPS-EGFP neurons were analysed using whole-cell patch-clamp recordings. Under current-clamp conditions, the membrane potential was set to −60 mV by direct current injection. Hyper- and depolarizing current steps (−50 to +150 pA; +10 pA increments) were applied to investigate electrotonic and electrogenic membrane properties (Fig. 4A). The passive and active membrane properties obtained are summarized in Table 1. CRF-induced responses in NPS-EGFP neurons A, example recording of an individual NPS-EGFP neuron in current-clamp mode at a membrane potential of −60 mV. Hyper- and depolarizing currents (depicted are injections of −50, 0, +20 and +70 pA) were injected to analyse passive and active membrane properties. B, example recording of a single NPS-EGFP neuron at a membrane potential of −65 mV. In the presence of 250 nm CRF the neuron depolarized and generated spontaneous action potentials. C, example trace of an NPS-EGFP neuron recorded in current-clamp mode at a membrane potential of −70 mV. The bar indicates the application of 250 nm CRF for 5 min. Hyperpolarizing current injections (−60 pA; 500 ms duration) were done to control the input resistance. Depolarizing currents (+70 pA; 500 ms duration) were injected to elicit action potentials. Magnified examples are shown from the recording at time-points indicated by the arrows. During the CRF-induced depolarization, the membrane potential was re-adjusted to −70 mV to minimize the effects of voltage-dependent conductances on the input resistance. D, time course of the CRF-induced depolarization in NPS-EGFP neurons. Dashed boxes indicate the time intervals taken for quantification. E, quantification of the CRF-induced shift of the membrane potential (−TTX, recording in absence of TTX; +TTX, recording in presence of TTX; +/−TTX, pooled data; Str I, application of 250 nm Stressin I; nonR, non-responsive NPS-EGFP neurons, showing neither a significant de- nor hyperpolarization). F, quantification of the number of elicited action potentials (% of baseline) in response to the depolarizing current injection during baseline recordings and in presence of CRF. G, quantification of the input resistance Rin (CRF, neurons depolarized by CRF; Str I, neurons depolarized by Stressin I; nonR, neurons not affected by CRF). Input resistances are presented for baseline conditions (baseline), during maximal substance effect (substance), and as difference (substance – baseline). The effects of CRF (250 nm) were assessed under current-clamp conditions, while membrane input resistance and action potential activity were monitored by repetitive application of hyper- and depolarizing current steps (500 ms duration; −60 pA and +70 to +100 pA), respectively. One subgroup of neurons was tested at membrane resting potential and another subgroup was held at −65 mV through direct current injection. Of these NPS-EGFP neurons, a majori" @default.
• W1570371361 created "2016-06-24" @default.
• W1570371361 creator A5035402165 @default.
• W1570371361 creator A5036928003 @default.
• W1570371361 creator A5054204934 @default.
• W1570371361 creator A5059137863 @default.
• W1570371361 creator A5079620447 @default.
• W1570371361 creator A5081417229 @default.
• W1570371361 creator A5089185725 @default.
• W1570371361 date "2012-08-01" @default.
• W1570371361 modified "2023-10-18" @default.
• W1570371361 title "Activation of neuropeptide S-expressing neurons in the locus coeruleus by corticotropin-releasing factor" @default.
• W1570371361 cites W1554259536 @default.
• W1570371361 cites W1786092055 @default.
• W1570371361 cites W1938551146 @default.
• W1570371361 cites W1974156538 @default.
• W1570371361 cites W1980450651 @default.
• W1570371361 cites W1981648395 @default.
• W1570371361 cites W1982958438 @default.
• W1570371361 cites W1989476825 @default.
• W1570371361 cites W1995211281 @default.
• W1570371361 cites W2020763825 @default.
• W1570371361 cites W2024922391 @default.
• W1570371361 cites W2025653825 @default.
• W1570371361 cites W2031554042 @default.
• W1570371361 cites W2032704291 @default.
• W1570371361 cites W2034667723 @default.
• W1570371361 cites W2035473397 @default.
• W1570371361 cites W2039016127 @default.
• W1570371361 cites W2043605840 @default.
• W1570371361 cites W2050980301 @default.
• W1570371361 cites W2054337977 @default.
• W1570371361 cites W2060478956 @default.
• W1570371361 cites W2089891490 @default.
• W1570371361 cites W2091105538 @default.
• W1570371361 cites W2091505787 @default.
• W1570371361 cites W2095073691 @default.
• W1570371361 cites W2095620291 @default.
• W1570371361 cites W2100149588 @default.
• W1570371361 cites W2103081445 @default.
• W1570371361 cites W2115608868 @default.
• W1570371361 cites W2116629441 @default.
• W1570371361 cites W2118238128 @default.
• W1570371361 cites W2120587186 @default.
• W1570371361 cites W2124894806 @default.
• W1570371361 cites W2127642531 @default.
• W1570371361 cites W2129643184 @default.
• W1570371361 cites W2131052408 @default.
• W1570371361 cites W2133753087 @default.
• W1570371361 cites W2141926683 @default.
• W1570371361 cites W2144269887 @default.
• W1570371361 cites W2146291241 @default.
• W1570371361 cites W2146748168 @default.
• W1570371361 cites W2148296969 @default.
• W1570371361 cites W2152420627 @default.
• W1570371361 cites W2156842294 @default.
• W1570371361 cites W2158197796 @default.
• W1570371361 cites W2168792587 @default.
• W1570371361 cites W2231571999 @default.
• W1570371361 cites W2334462456 @default.
• W1570371361 doi "https://doi.org/10.1113/jphysiol.2011.226423" @default.
• W1570371361 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3476629" @default.
• W1570371361 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/22570383" @default.
• W1570371361 hasPublicationYear "2012" @default.
• W1570371361 type Work @default.
• W1570371361 sameAs 1570371361 @default.
• W1570371361 citedByCount "36" @default.
• W1570371361 countsByYear W15703713612012 @default.
• W1570371361 countsByYear W15703713612013 @default.
• W1570371361 countsByYear W15703713612014 @default.
• W1570371361 countsByYear W15703713612015 @default.
• W1570371361 countsByYear W15703713612016 @default.
• W1570371361 countsByYear W15703713612017 @default.
• W1570371361 countsByYear W15703713612018 @default.
• W1570371361 countsByYear W15703713612019 @default.
• W1570371361 countsByYear W15703713612020 @default.
• W1570371361 countsByYear W15703713612021 @default.
• W1570371361 countsByYear W15703713612022 @default.
• W1570371361 countsByYear W15703713612023 @default.
• W1570371361 crossrefType "journal-article" @default.
• W1570371361 hasAuthorship W1570371361A5035402165 @default.
• W1570371361 hasAuthorship W1570371361A5036928003 @default.
• W1570371361 hasAuthorship W1570371361A5054204934 @default.
• W1570371361 hasAuthorship W1570371361A5059137863 @default.
• W1570371361 hasAuthorship W1570371361A5079620447 @default.
• W1570371361 hasAuthorship W1570371361A5081417229 @default.
• W1570371361 hasAuthorship W1570371361A5089185725 @default.
• W1570371361 hasBestOaLocation W15703713612 @default.
• W1570371361 hasConcept C118303440 @default.
• W1570371361 hasConcept C126322002 @default.
• W1570371361 hasConcept C134018914 @default.
• W1570371361 hasConcept C15744967 @default.
• W1570371361 hasConcept C169760540 @default.
• W1570371361 hasConcept C170493617 @default.
• W1570371361 hasConcept C2777003273 @default.
• W1570371361 hasConcept C2778458438 @default.
• W1570371361 hasConcept C2778468602 @default.
• W1570371361 hasConcept C2780723820 @default.

• next