FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1570393711> ?p ?o ?g. }

• W1570393711 endingPage "18462" @default.
• W1570393711 startingPage "18453" @default.
• W1570393711 abstract "The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed of the AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated two partial cDNA clones that encode factors which bind the TH-dyad. One is rITF2 with a basic helix-loop-helix motif and the other is CDP2 with a homeodomain. rITF2 is a rat homolog of human ITF2 (or E2-2), and CDP2 is a member of a new family of homeoproteins defined by histidine as the 9th residue of the recognition helix and by unique 64 amino acid repeats related to those of the Drosophila cut gene. The binding affinity of CDP2 alone is relatively weak, but it enhances the binding of rITF2 to the TH-dyad. In transfected F9 cells, activation of a TH-driven reporter requires both rITF2 and CDP2, suggesting that the proteins may functionally interact. However, rITF2 and CDP2 are not restricted to TH-expressing tissues; hence they may not be involved in the tissue-specific expression of TH. In addition, CDP2 is phosphorylated in vitro and in vivo." @default.
• W1570393711 created "2016-06-24" @default.
• W1570393711 creator A5030585108 @default.
• W1570393711 creator A5084269931 @default.
• W1570393711 date "1994-07-01" @default.
• W1570393711 modified "2023-10-03" @default.
• W1570393711 title "Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer" @default.
• W1570393711 cites W1214455787 @default.
• W1570393711 cites W1579422699 @default.
• W1570393711 cites W1602266368 @default.
• W1570393711 cites W1615014246 @default.
• W1570393711 cites W1977259984 @default.
• W1570393711 cites W1989297216 @default.
• W1570393711 cites W1994393699 @default.
• W1570393711 cites W1994975139 @default.
• W1570393711 cites W1997936885 @default.
• W1570393711 cites W2010798177 @default.
• W1570393711 cites W2011509827 @default.
• W1570393711 cites W2015828720 @default.
• W1570393711 cites W2034454625 @default.
• W1570393711 cites W2037330840 @default.
• W1570393711 cites W2039589177 @default.
• W1570393711 cites W2044368082 @default.
• W1570393711 cites W2046184823 @default.
• W1570393711 cites W2046278558 @default.
• W1570393711 cites W2047483221 @default.
• W1570393711 cites W2047791752 @default.
• W1570393711 cites W2051254858 @default.
• W1570393711 cites W2053595471 @default.
• W1570393711 cites W2061183445 @default.
• W1570393711 cites W2074855068 @default.
• W1570393711 cites W2076849893 @default.
• W1570393711 cites W2079544213 @default.
• W1570393711 cites W2082670705 @default.
• W1570393711 cites W2082797919 @default.
• W1570393711 cites W2083181195 @default.
• W1570393711 cites W2083758347 @default.
• W1570393711 cites W2087126781 @default.
• W1570393711 cites W2088956217 @default.
• W1570393711 cites W2093339251 @default.
• W1570393711 cites W2128940002 @default.
• W1570393711 cites W2141329399 @default.
• W1570393711 cites W2149436483 @default.
• W1570393711 cites W2152134406 @default.
• W1570393711 cites W2186225047 @default.
• W1570393711 cites W99394036 @default.
• W1570393711 doi "https://doi.org/10.1016/s0021-9258(17)32330-x" @default.
• W1570393711 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7913462" @default.
• W1570393711 hasPublicationYear "1994" @default.
• W1570393711 type Work @default.
• W1570393711 sameAs 1570393711 @default.
• W1570393711 citedByCount "92" @default.
• W1570393711 countsByYear W15703937112012 @default.
• W1570393711 countsByYear W15703937112013 @default.
• W1570393711 countsByYear W15703937112014 @default.
• W1570393711 countsByYear W15703937112016 @default.
• W1570393711 countsByYear W15703937112021 @default.
• W1570393711 countsByYear W15703937112022 @default.
• W1570393711 countsByYear W15703937112023 @default.
• W1570393711 crossrefType "journal-article" @default.
• W1570393711 hasAuthorship W1570393711A5030585108 @default.
• W1570393711 hasAuthorship W1570393711A5084269931 @default.
• W1570393711 hasBestOaLocation W15703937111 @default.
• W1570393711 hasConcept C104317684 @default.
• W1570393711 hasConcept C111936080 @default.
• W1570393711 hasConcept C159167319 @default.
• W1570393711 hasConcept C181199279 @default.
• W1570393711 hasConcept C185592680 @default.
• W1570393711 hasConcept C2775941552 @default.
• W1570393711 hasConcept C2776165026 @default.
• W1570393711 hasConcept C2909129545 @default.
• W1570393711 hasConcept C55493867 @default.
• W1570393711 hasConcept C60644358 @default.
• W1570393711 hasConcept C86339819 @default.
• W1570393711 hasConcept C86803240 @default.
• W1570393711 hasConcept C95444343 @default.
• W1570393711 hasConceptScore W1570393711C104317684 @default.
• W1570393711 hasConceptScore W1570393711C111936080 @default.
• W1570393711 hasConceptScore W1570393711C159167319 @default.
• W1570393711 hasConceptScore W1570393711C181199279 @default.
• W1570393711 hasConceptScore W1570393711C185592680 @default.
• W1570393711 hasConceptScore W1570393711C2775941552 @default.
• W1570393711 hasConceptScore W1570393711C2776165026 @default.
• W1570393711 hasConceptScore W1570393711C2909129545 @default.
• W1570393711 hasConceptScore W1570393711C55493867 @default.
• W1570393711 hasConceptScore W1570393711C60644358 @default.
• W1570393711 hasConceptScore W1570393711C86339819 @default.
• W1570393711 hasConceptScore W1570393711C86803240 @default.
• W1570393711 hasConceptScore W1570393711C95444343 @default.
• W1570393711 hasIssue "28" @default.
• W1570393711 hasLocation W15703937111 @default.
• W1570393711 hasOpenAccess W1570393711 @default.
• W1570393711 hasPrimaryLocation W15703937111 @default.
• W1570393711 hasRelatedWork W1990121017 @default.
• W1570393711 hasRelatedWork W2008355091 @default.
• W1570393711 hasRelatedWork W2008660829 @default.
• W1570393711 hasRelatedWork W2026245843 @default.
• W1570393711 hasRelatedWork W2028528712 @default.

• next