FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1570806479> ?p ?o ?g. }

• W1570806479 endingPage "69" @default.
• W1570806479 startingPage "62" @default.
• W1570806479 abstract "SummaryBackground: Human fibrinogen γ chain variants, termed γ′ chains, contain a unique 20‐residue sequence after γ chain residue 407 that ends at γ′427, and is designated γ′427L. Full‐length (FL) γ′427L chains are constituents of a fibrin‐dependent thrombin inhibitory system known as antithrombin I, whereas a γ′ chain processed in vivo, termed γ′423P, lacks the C‐terminal tetrapeptide EDDL, and does not bind thrombin. Together, the γ′423P and γ′427L chains comprise the total plasma fibrinogen γ′ chain content. Objectives: Lowered plasma γ′ chain content (i.e. γ′ chain‐containing fibrinogen/total fibrinogen ratio) has been shown to correlate with susceptibility to venous thrombosis, thus prompting this study on the total and FL γ′ chain content in 45 subjects with thrombotic microangiopathy (TMA), a disorder characterized by microvascular thrombosis. Methods: We measured by enzyme‐linked immunosorbent assay the total γ′ chain‐containing fibrinogen/total fibrinogen (Total γ′‐fgn/Total fgn) ratio and the FL γ′ chain‐containing fibrinogen/total fibrinogen (FL γ′‐fgn/Total fgn) ratio in these plasmas and in healthy subjects (n = 87). Results: In healthy subjects, the mean Total γ′‐fgn/Total fgn ratio was 0.127, whereas the FL γ′‐fgn/Total fgn ratio was somewhat lower at 0.099 (P < 0.0001), a difference reflecting the presence of γ′423P chains. In TMA plasmas, both the Total γ′‐fgn and FL γ′‐fgn/Total fgn ratios (0.099 and 0.084, respectively) were lower than those of their healthy subject counterparts (P < 0.0001). Conclusions: These findings in TMA suggest that reductions in the γ′ chain content indicate reduced antithrombin I activity that may contribute to microvascular thrombosis in TMA. Background: Human fibrinogen γ chain variants, termed γ′ chains, contain a unique 20‐residue sequence after γ chain residue 407 that ends at γ′427, and is designated γ′427L. Full‐length (FL) γ′427L chains are constituents of a fibrin‐dependent thrombin inhibitory system known as antithrombin I, whereas a γ′ chain processed in vivo, termed γ′423P, lacks the C‐terminal tetrapeptide EDDL, and does not bind thrombin. Together, the γ′423P and γ′427L chains comprise the total plasma fibrinogen γ′ chain content. Objectives: Lowered plasma γ′ chain content (i.e. γ′ chain‐containing fibrinogen/total fibrinogen ratio) has been shown to correlate with susceptibility to venous thrombosis, thus prompting this study on the total and FL γ′ chain content in 45 subjects with thrombotic microangiopathy (TMA), a disorder characterized by microvascular thrombosis. Methods: We measured by enzyme‐linked immunosorbent assay the total γ′ chain‐containing fibrinogen/total fibrinogen (Total γ′‐fgn/Total fgn) ratio and the FL γ′ chain‐containing fibrinogen/total fibrinogen (FL γ′‐fgn/Total fgn) ratio in these plasmas and in healthy subjects (n = 87). Results: In healthy subjects, the mean Total γ′‐fgn/Total fgn ratio was 0.127, whereas the FL γ′‐fgn/Total fgn ratio was somewhat lower at 0.099 (P < 0.0001), a difference reflecting the presence of γ′423P chains. In TMA plasmas, both the Total γ′‐fgn and FL γ′‐fgn/Total fgn ratios (0.099 and 0.084, respectively) were lower than those of their healthy subject counterparts (P < 0.0001). Conclusions: These findings in TMA suggest that reductions in the γ′ chain content indicate reduced antithrombin I activity that may contribute to microvascular thrombosis in TMA. Human fibrinogen is separable by ion exchange chromatography into two major peaks, which amount to ∼85% (peak 1) and ∼15% (peak 2) of the total fibrinogen, respectively [1Mosesson M.W. Finlayson J.S. Subfractions of human fibrinogen: preparation and analysis.J Lab Clin Med. 1963; 62: 663-74PubMed Google Scholar, 2Siebenlist K.R. Meh D.A. Mosesson M.W. Plasma factor XIII binds specifically to fibrinogen molecules containing γ′ chains.Biochemistry. 1996; 35: 10448-53Crossref PubMed Scopus (136) Google Scholar]. Peak 1 (fibrinogen 1) is homodimeric with respect to its γ chain population (γA/γA), whereas peak 2 fibrinogen molecules (fibrinogen 2) are heterodimeric (γA/γ′) [3Mosesson M.W. Finlayson J.S. Umfleet R.A. Human fibrinogen heterogeneities. III. Identification of γ chain variants.J Biol Chem. 1972; 247: 5223-7Abstract Full Text PDF PubMed Google Scholar, 4Wolfenstein‐Todel C. Mosesson M.W. Human plasma fibrinogen heterogeneity: evidence for an extended carboxyl‐terminal sequence in a normal gamma chain variant (γ′).Proc Natl Acad Sci USA. 1980; 77: 5069-73Crossref PubMed Scopus (105) Google Scholar]. The γ′ chain variant arises through alternative processing and polyadenylation of the γ chain mRNA transcript [5Chung D.W. Davie E.W. γ and γ′ chains of human fibrinogen are produced by alternative mRNA processing.Biochemistry. 1984; 23: 4232-6Crossref PubMed Scopus (132) Google Scholar] (Fig. 1). Its C‐terminal sequence resides in intron 9, which codes for a unique 20‐residue C‐terminal sequence [6Wolfenstein‐Todel C. Mosesson M.W. Carboxy‐terminal amino acid sequence of a human fibrinogen γ chain variant (γ′).Biochemistry. 1981; 20: 6146-9Crossref PubMed Scopus (82) Google Scholar] that binds to thrombin [7Meh D.A. Siebenlist K.R. Mosesson M.W. Identification and characterization of the thrombin binding sites on fibrin.J Biol Chem. 1996; 271: 23121-5Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 8Meh D.A. Mosesson M.W. Siebenlist K.R. Simpson‐Haidaris P.J. Brennan S.O. Di Orio J.P. Thompson K. Di Minno G. Fibrinogen Naples I (Bβ A68T) non‐substrate thrombin binding capacities.Thromb Res. 2001; 103: 63-73Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar] and to factor XIII B subunits [2Siebenlist K.R. Meh D.A. Mosesson M.W. Plasma factor XIII binds specifically to fibrinogen molecules containing γ′ chains.Biochemistry. 1996; 35: 10448-53Crossref PubMed Scopus (136) Google Scholar]. The alternatively processed exon 10 message codes for the C‐terminal γA chain AGDV411 sequence that completes the platelet integrin‐binding motif [9Kloczewiak M. Timmons S. Lukas T.J. Hawiger J. Platelet receptor recognition site on human fibrinogen. Synthesis and structure–function relationship of peptides corresponding to the C‐terminal segment of the γ chain.Biochemistry. 1984; 23: 1767-74Crossref PubMed Scopus (350) Google Scholar]; γ′ chains do not bind to platelets [10Kirschbaum N.E. Mosesson M.W. Amrani D.L. Characterization of the γ chain platelet binding site on fibrinogen fragment D.Blood. 1992; 79: 2643-8Crossref PubMed Google Scholar]. Thrombin‐binding γ′ chains are major constituents of a thrombin inhibitory system in blood, known as antithrombin I, which downregulates thrombin generation in clotting blood by binding and sequestering thrombin in the forming fibrin matrix, and by inducing allosteric changes at the thrombin catalytic site that reduce its catalytic potential [11Mosesson M.W. Antithrombin I. Inhibition of thrombin generation in plasma by fibrin formation.Thromb Haemost. 2003; 89: 9-12Crossref PubMed Scopus (87) Google Scholar, 12Siebenlist K.R. Mosesson M.W. Hernandez I. Bush L.A. Di Cera E. Shainoff J.R. Di Orio J.P. Stojanovich L. Studies on the basis for the properties of fibrin produced from fibrinogen containing γ′ chains.Blood. 2005; 106: 2730-6Crossref PubMed Scopus (60) Google Scholar]. Thrombin exosite 2 binds to full‐length (FL) γ′ chains [13Pospisil C.H. Stafford A.R. Fredenburgh J.C. Weitz J.I. Evidence that both exosites on thrombin participate in its high affinity interaction with fibrin.J Biol Chem. 2003; 278: 21584-91Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 14Lovely R.S. Moaddel M. Farrell D.H. Fibrinogen γ′ chain binds thrombin exosite II.J Thromb Haemost. 2003; 1: 124-31Crossref PubMed Scopus (76) Google Scholar], which are designated γ′427L, and the exosite 2 binding site includes residues γ′424 and γ′427 [15Meh D.A. Siebenlist K.R. Brennan S.O. Holyst T. Mosesson M.W. The amino acid sequences in fibrin responsible for high affinity thrombin binding.Thromb Haemost. 2001; 85: 470-4Crossref PubMed Scopus (72) Google Scholar]. In addition to γ′427L chains, there exists a minor population of post‐translationally processed γ′ chains lacking the C‐terminal EDDL sequence [16Francis C.W. Kraus D.H. Marder V.J. Structural and chromatographic heterogeneity of normal plasma fibrinogen associated with the presence of three gamma‐chain types with distinct molecular weights.Biochim Biophys Acta. 1983; 744: 155-64Crossref PubMed Scopus (14) Google Scholar, 17Francis C.W. Keele E.M. Marder V.J. Purification of three gamma‐chains with different molecular weights from normal human plasma fibrinogen.Biochim Biophys Acta. 1984; 797: 328-35Crossref PubMed Scopus (8) Google Scholar, 18Francis C.W. Muller E. Henschen A. Simpson P.J. Marder V.J. Carboxy‐terminal amino acid sequences of two large variant forms of the human plasma fibrinogen γ chain.Proc Natl Acad Sci USA. 1988; 85: 3358-62Crossref PubMed Scopus (12) Google Scholar], and these are designated γ′423P. These shortened γ′ chains do not bind thrombin [7Meh D.A. Siebenlist K.R. Mosesson M.W. Identification and characterization of the thrombin binding sites on fibrin.J Biol Chem. 1996; 271: 23121-5Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 8Meh D.A. Mosesson M.W. Siebenlist K.R. Simpson‐Haidaris P.J. Brennan S.O. Di Orio J.P. Thompson K. Di Minno G. Fibrinogen Naples I (Bβ A68T) non‐substrate thrombin binding capacities.Thromb Res. 2001; 103: 63-73Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar], although they retain their constitutive ability to bind to FXIII [2Siebenlist K.R. Meh D.A. Mosesson M.W. Plasma factor XIII binds specifically to fibrinogen molecules containing γ′ chains.Biochemistry. 1996; 35: 10448-53Crossref PubMed Scopus (136) Google Scholar]. There have been several reports on the plasma content of γ′‐containing fibrinogen (γ′‐fgn) and its relationship to thrombotic disease [19Drouet L. Paolucci F. Pasqualini N. Laprade M. Ripoll L. Mazoyer E. Bal dit S.C. Vanhove N. Plasma gamma′/gamma fibrinogen ratio, a marker of arterial thrombotic activity: a new potential cardiovascular risk factor.Blood Coagul Fibrinolysis. 1999; 10: S35-9PubMed Google Scholar, 20Lovely R.S. Falls L.A. Al Mondhiry H.A. Chambers C.E. Sexton G.J. Ni H. Farrell D.H. Association of γA/γ′ fibrinogen levels and coronary artery disease.Thromb Haemost. 2002; 88: 26-31Crossref PubMed Scopus (95) Google Scholar, 21Uitte de Willige S. de Visser M.C. Houwing‐Duistermaat J.J. Rosendaal F.R. Vos H.L. Bertina R.M. Genetic variation in the fibrinogen gamma gene increases the risk of deep venous thrombosis by reducing plasma fibrinogen γ′ levels.Blood. 2005; 106: 4176-83Crossref PubMed Scopus (205) Google Scholar]. In a recent report on this subject, Uitte de Willige et al. [21Uitte de Willige S. de Visser M.C. Houwing‐Duistermaat J.J. Rosendaal F.R. Vos H.L. Bertina R.M. Genetic variation in the fibrinogen gamma gene increases the risk of deep venous thrombosis by reducing plasma fibrinogen γ′ levels.Blood. 2005; 106: 4176-83Crossref PubMed Scopus (205) Google Scholar] investigated the effect of γ′‐fgn/fibrinogen containing both γ chain variants (Total fgn) ratios on the risk of venous thrombosis in the Leiden Thrombophilia Study [22van der Meer F.J. Koster T. Vandenbroucke J.P. Briet E. Rosendaal F.R. The Leiden Thrombophilia Study (LETS).Thromb Haemost. 1997; 78: 631-5Crossref PubMed Scopus (261) Google Scholar]. They demonstrated that reduced γ′‐fgn/Total fgn ratios were associated with an increased thrombosis risk and were correlated with a particular γ chain gene haplotype termed FGG‐H2. The potentially relevant single‐nucleotide polymorphisms of that haplotype are located in intron 9 (9615C/T) and just downstream from the polyadenylation site of exon 10 (10034C/T). These may individually or collectively result in reduced production of γ′ chain transcripts, although there may be other explanations. Thrombotic microangiopathy (TMA), a life‐threatening syndrome with major forms that include thrombotic thrombocytopenic purpura (TTP) and hemolytic uremic syndrome, is characterized by microangiopathic hemolytic anemia, thrombocytopenia, and microvascular thrombosis accompanied by varying degrees of tissue ischemia and infarction. TTP is commonly associated with severe deficiency of a plasma metalloproteinase known as ADAMTS‐13 [23Moake J.L. Thrombotic microangiopathies.N Engl J Med. 2002; 347: 589-600Crossref PubMed Scopus (1138) Google Scholar, 24Raife T. Atkinson B. Montgomery R. Vesely S. Friedman K. Severe deficiency of VWF‐cleaving protease (ADAMTS13) activity defines a distinct population of thrombotic microangiopathy patients.Transfusion. 2004; 44: 146-50Crossref PubMed Scopus (73) Google Scholar, 25Veyradier A. Meyer D. Thrombotic thrombocytopenic purpura and its diagnosis.J Thromb Haemost. 2005; 3: 2420-7Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar]. In this study, we investigated a group of TMA patients to determine whether there might be an association between TMA and the plasma γ′ chain content. We used enzyme‐linked immunosorbent assays (ELISAs) that had been developed in our fibrinogen Naples I study [8Meh D.A. Mosesson M.W. Siebenlist K.R. Simpson‐Haidaris P.J. Brennan S.O. Di Orio J.P. Thompson K. Di Minno G. Fibrinogen Naples I (Bβ A68T) non‐substrate thrombin binding capacities.Thromb Res. 2001; 103: 63-73Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar] for measuring γ′‐fgn/Total fgn ratios. We employed two monoclonal antibodies (mAbs): (i) L2B, whose epitope is situated between γ′409 and γ′412 [26Haidaris P.J. Peerschke E.I. Marder V.J. Francis C.W. The C‐terminal sequences of the gamma 57.5 chain of human fibrinogen constitute a plasmin sensitive epitope that is exposed in crosslinked fibrin.Blood. 1989; 74: 2437-44Crossref PubMed Google Scholar, 27Haidaris P.J. Francis C.W. Sporn L.A. Arvan D.S. Collichio F.A. Marder V.J. Megakaryocyte and hepatocyte origins of human fibrinogen biosynthesis exhibit hepatocyte‐specific expression of gamma chain‐variant polypeptides.Blood. 1989; 74: 743-50Crossref PubMed Google Scholar], and thus detects all γ′ chains (γ′427L plus γ′423P); and (ii) IF10, whose epitope encompasses γ′424–427, and therefore detects only FL γ′427L chains (Fig. 1). Our findings suggest that in TMA there is an association between reduced γ′‐fgn/Total fgn ratios and the occurrence of the TMA syndrome. Single donor citrated plasmas from healthy subjects (n = 87) were obtained from volunteer blood donors at the BloodCenter of Wisconsin. The mean age was 50.1 years (range: 20–99 years) and 52% were males. Fourteen of the healthy subjects were of African‐American descent. We also analyzed 55 citrated plasmas that had been obtained from 45 individual TMA subjects who displayed laboratory and clinically well‐defined TMA at the time of sampling with either severely deficient or non‐severely deficient von Willebrand factor (VWF)‐cleaving protease (ADAMTS‐13) activity, 31 of whom had been reported by Raife et al. [24Raife T. Atkinson B. Montgomery R. Vesely S. Friedman K. Severe deficiency of VWF‐cleaving protease (ADAMTS13) activity defines a distinct population of thrombotic microangiopathy patients.Transfusion. 2004; 44: 146-50Crossref PubMed Scopus (73) Google Scholar]. TMA blood samples were collected by venipuncture prior to the first plasma exchange or from the first 100 mL of ‘waste’ plasma, which contains quantities of citrate anticoagulant comparable to that in a venipuncture specimen. In six TMA subjects, two or more blood samples had been collected during different episodes of clinical relapse. In charting and computing the γ′‐fgn/Total fgn ratios, we used the average value for each multiple‐sample subject plasma in order to avoid skewing results against single‐sample TMA subjects. We nevertheless evaluated all 55 individual values and found no meaningful differences in any of our calculated results (not shown). The mean subject age was 50.5 years (range: 20–88 years), and 33% were males. Nineteen of the 45 TMA subjects (42%) were African‐American, there was one of unreported race, and the remaining subjects were Caucasian. This distribution is consistent with the reported high incidence of TTP in subjects of Afro‐Caribbean origin [28Sadler J.E. Moake J.L. Miyata T. George J.N. Recent advances in thrombotic thrombocytopenic purpura.Hematology (Am Soc Hematol Educ Program). 2004; : 407-23Crossref PubMed Scopus (283) Google Scholar, 29Terrell D.R. Williams L.A. Vesely S.K. Lammle B. Hovinga J.A. George J.N. The incidence of thrombotic thrombocytopenic purpura–hemolytic uremic syndrome: all patients, idiopathic patients, and patients with severe ADAMTS‐13 deficiency.J Thromb Haemost. 2005; 3: 1432-6Abstract Full Text Full Text PDF PubMed Scopus (271) Google Scholar]. Comparisons of mean values were carried out using a paired or unpaired, two‐tailed t‐test. Normality testing of data in any given sample was performed using the Kolmogorov–Smirnov test. Intraday and interday precision was expressed as the 95% CI of the mean (95% CI) or as the SEM of replicate determinations. The Hardy–Weinberg equilibrium was tested by χ2 analysis. Comparison of 10034T allele frequencies was performed using Fisher's exact test. Patient ADAMTS‐13 activity was determined as previously described [24Raife T. Atkinson B. Montgomery R. Vesely S. Friedman K. Severe deficiency of VWF‐cleaving protease (ADAMTS13) activity defines a distinct population of thrombotic microangiopathy patients.Transfusion. 2004; 44: 146-50Crossref PubMed Scopus (73) Google Scholar, 30Raife T.J. Lentz S.R. Atkinson B.S. Vesely S.K. Hessner M.J. Factor V Leiden: a genetic risk factor for thrombotic microangiopathy in patients with normal von Willebrand factor‐cleaving protease activity.Blood. 2002; 99: 437-42Crossref PubMed Scopus (49) Google Scholar] by comparing the substrate VWF remaining after digestion by patient plasma with that of undigested VWF. TMA subjects were divided into two groups: (i) non‐severely deficient ADAMTS‐13 activity (i.e. the electrophoretic pattern of the VWF substrate showed disappearance of more than 15% of the largest VWF multimers); and (ii) severely deficient ADAMTS‐13 activity (showing disappearance of less than 15% of the largest VWF multimers). Plasma fibrinogen levels from healthy subjects or TMA patients were analyzed by functional assay [31Clauss A. Rapid physiological coagulation method in determination of fibrinogen.Acta Haematol. 1957; 17: 237-46Crossref PubMed Scopus (2995) Google Scholar], or by the ELISA procedure described below. There was excellent agreement between ELISA and Clauss‐measured levels in both groups, with a mean variance (SEM) of approximately 6%. ELISA determinations were carried out using either a rabbit anti‐(human fragment E), protein A (Bio‐Rad, Irivine, CA, USA) purified IgG fraction (RAE), or a rabbit anti‐(human fibrinogen IgG) fraction (Dako, Carpinteria, CA, USA) (RAF), for antigen capture. For fibrinogen ELISAs, 100 μL of RAE (8 μg mL−1) or RAF (23 μg mL−1) in phosphate‐buffered saline (PBS) (0.15 m NaCl, 10 mm NaH2PO4, pH 7.3) was applied to an immunoplate, and then incubated overnight at 4 °C. Wells were blocked with 2% non‐fat dried milk in PBS and then rinsed with 200 μL of PBS–Tween‐20 (JT Baker, Phillipsburg, NJ, USA). Fibrinogen fraction I‐2 (> 97% coagulable) was used for calibration at concentrations of 0.50, 0.25, 0.125, 0.10, 0.075, 0.050, 0.025 and 0.0125 μg mL−1 (1.47–0.04 nm), and PBS containing 0.05% Tween‐20 (JT Baker) was used as a blank. Plasma samples were diluted 20 000–30 000‐fold and 100 μL was added to each well. Duplicate samples were incubated at 37 °C for 2 h, and rinsed; 100 μL of biotinylated RAE was then added at 0.19 μg mL−1, and the plate incubated at 37 °C for 1 h. After rinsing, 0.1 μg mL−1 of horseradish peroxidase‐labeled streptavidin (Vector Laboratories, Burlingame, CA, USA) was added at 100 μL per well and incubated at 37 °C for 1 h. After the final PBS–Tween rinse, 100 μL of o‐phenylenediamine (OPD) solution [0.03% H2O2, 0.42 mg mL−1 OPD (Zymed, Carlsbad, CA, USA)] in 0.22 m citric acid and 0.05 m sodium phosphate (pH 5.0) buffer was added. Color development was terminated with 50 μL of 1 m H2SO4, and the plate was read at 490 nm on a Versamax Plate Reader (Molecular Devices, Sunnyvale, CA, USA). Two mouse mAbs that had been purified from ascites fluid on a protein A column (Bio‐Rad) were used: (i) mAb L2B, an IgG1κ light‐chain antibody raised against a γ′ peptide immunogen γ′408–416, whose epitope is located at γ′409–412 [26Haidaris P.J. Peerschke E.I. Marder V.J. Francis C.W. The C‐terminal sequences of the gamma 57.5 chain of human fibrinogen constitute a plasmin sensitive epitope that is exposed in crosslinked fibrin.Blood. 1989; 74: 2437-44Crossref PubMed Google Scholar, 27Haidaris P.J. Francis C.W. Sporn L.A. Arvan D.S. Collichio F.A. Marder V.J. Megakaryocyte and hepatocyte origins of human fibrinogen biosynthesis exhibit hepatocyte‐specific expression of gamma chain‐variant polypeptides.Blood. 1989; 74: 743-50Crossref PubMed Google Scholar]; and (ii) mAb IF10, an IgG1κ light‐chain antibody raised against a γ′ peptide immunogen, γ′417–427. IF10 recognizes intact γ′427L chains but not γ′423P chains, and its epitope includes the γ′424–427 sequence [8Meh D.A. Mosesson M.W. Siebenlist K.R. Simpson‐Haidaris P.J. Brennan S.O. Di Orio J.P. Thompson K. Di Minno G. Fibrinogen Naples I (Bβ A68T) non‐substrate thrombin binding capacities.Thromb Res. 2001; 103: 63-73Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar]. Fibrinogen 1 (peak 1; γA/γA) and heterodimeric fibrinogen 2 (peak 2; γA/γ′) were prepared by ion exchange chromatography [1Mosesson M.W. Finlayson J.S. Subfractions of human fibrinogen: preparation and analysis.J Lab Clin Med. 1963; 62: 663-74PubMed Google Scholar, 2Siebenlist K.R. Meh D.A. Mosesson M.W. Plasma factor XIII binds specifically to fibrinogen molecules containing γ′ chains.Biochemistry. 1996; 35: 10448-53Crossref PubMed Scopus (136) Google Scholar]. ELISA measurements were carried out using RAE or RAF, described in the preceding section. Very similar results were obtained both either capture antibodies. Dilutions of duplicate standards at 1:500 (6 μg mL−1, 17.6 nm) or duplicate plasma samples at 1:250–1:400, with a final fibrinogen concentration above the saturating concentration for diluted standards (see below), were pipetted into the wells, incubated at 37 °C for 2 h, and rinsed with PBS–Tween‐20. One hundred microliters of IF10 (6.0 μg mL−1) or L2B (2.5 μg mL−1) was then added to the wells, which were then rinsed with PBS–Tween‐20. One hundred microliters of alkaline phosphatase‐labeled goat anti‐(mouse IgG) (Zymed Laboratories) at 1:500 dilution (3 μg mL−1, final) with PBS–Tween‐20 was added and incubated for 1 h at 37 °C. One hundred microliters of p‐nitrophenyl phosphate (Zymed Laboratories) that had been diluted to 1 mg mL−1 with 0.75 m 2‐amino‐2‐methyl‐propanediol (pH 10.3) was added, and the plate was incubated in the dark for 20 min or until distinct color development had occurred. The reaction was stopped with 50 μL of 2 m NaOH, and the plate was then read at 405 nm. At a fibrinogen concentration above 1 μg mL−1 (2.9 nm), a condition that was met for all the samples, capture antibody‐binding sites were saturated, and therefore readouts against L2B or IF10 mAbs were proportional to the respective ratios of Total γ′‐fgn or FL γ′‐fgn to the Total fgn concentration in the sample. Fibrinogen 1/fibrinogen 2 mixtures (containing 50%, 40%, 30%, 20%, 10% and 7.5% fibrinogen 2) at a net fibrinogen concentration of 3 mg mL−1 (8.8 μm) were used as standards, and a 100% solution of fibrinogen 1 was used as a blank. Interday variance (95% CI) was ∼10%, and intraday variance was ∼6%. The availability of mAbs IF10 (FL γ′‐fgn) and L2B (Total γ′‐fgn) made it straightforward to calculate the content of γ′ chains lacking the EDDL sequence (γ′423P) by subtracting FL γ′‐fgn values from those for Total γ′‐fgn. A recombinant γ′ module corresponding to human fibrinogen γ′ chain residues 148–427 was produced in Escherichia coli using a pET‐20b expression vector that had previously been utilized for expression of residues 148–411 of the γ module [32Medved L. Litvinovich S. Ugarova T. Matsuka Y. Ingham K. Domain structure and functional activity of the recombinant human fibrinogen gamma‐module (gamma148–411).Biochemistry. 1997; 36: 4685-93Crossref PubMed Scopus (48) Google Scholar, 33Yakovlev S. Zhang L. Ugarova T. Medved L. Interaction of fibrin(ogen) with leukocyte receptor alpha M beta 2 (Mac‐1): further characterization and identification of a novel binding region within the central domain of the fibrinogen gamma‐module.Biochemistry. 2005; 44: 617-26Crossref PubMed Scopus (45) Google Scholar]. To produce a cDNA encoding γ′148–427 (first PCR product), a template consisting of FL cDNA encoding the human fibrinogen γ′ chain and the following primers was used (generously provided by Dr Kevin R. Siebenlist): 5′‐TGGAAATCATATGATCACTGGGAAAGATTGTCAAG‐3′ (forward) and 5′‐TTTAAAAAGCTTTCACAAATCATCCTCAGGGTAAAGTG‐3′ (reverse). The underlined nucleotides are, respectively, NdeI and HindIII recognition sequences that were introduced into these primers. As cDNA encoding the γ′ module contains two internal NdeI restriction sites and one ApoI restriction site located before the NdeI sites, a second PCR product containing an ApoI restriction site was produced using the same forward primer and a 5′‐TGGGATGGCAGACTGTGTG‐3′ reverse primer. The first product was digested with ApoI and HindIII, and the second was digested with NdeI and ApoI. The resulting PCR fragments were subcloned simultaneously into the pET‐20b expression vector using NdeI and HindIII restriction sites. The resultant clone was sequenced to confirm the integrity of the coding sequences. For production of a protein fragment, the BL21/pLysS E. coli host cells were transformed with the resulting plasmid and the γ′ module was purified and refolded by procedures similar to those described in Medved et al. [32Medved L. Litvinovich S. Ugarova T. Matsuka Y. Ingham K. Domain structure and functional activity of the recombinant human fibrinogen gamma‐module (gamma148–411).Biochemistry. 1997; 36: 4685-93Crossref PubMed Scopus (48) Google Scholar]. Purity and homogeneity of the γ′ module were verified by sodium dodecylsulfate polyacrylamide gel electrophoresis, mass spectrometry, and N‐terminal sequence analysis. The γ′ module at 1.17 mg mL−1 (A280.1% = 24.0) in 20 mm Tris buffer (pH 7.4), containing 150 mm NaCl, 1 mm CaCl2, 0.2 mm phenylmetholsulfonyl fluoride and 0.02% sodium azide, was used to estimate the content of intact γ′427L and γ′423P chains in a heterodimeric fibrinogen 2 standard. When calibrated against the intact γ′ module, this fibrinogen fraction was found to have 89% FL γ′ chains, and therefore an 11% correction factor was applied to all mAb IF10 ELISA readings. As fibrinogen 2 is heterodimeric with respect to its γ′ chains, the proportion of fibrinogen 2 to total fibrinogen in the mixtures is the same as the molar concentration of its γ′ chains, and these relationships are reflected in our terminology. To take into account the recently described determinant of fibrinogen γ′ levels, FGG‐H2 [21Uitte de Willige S. de Visser M.C. Houwing‐Duistermaat J.J. Rosendaal F.R. Vos H.L. Bertina R.M. Genetic variation in the fibrinogen gamma gene increases the risk of deep venous thrombosis by reducing plasma fibrinogen γ′ levels.Blood. 2005; 106: 4176-83Crossref PubMed Scopus (205) Google Scholar], all subjects were genotyped for the polymorphism 10034C/T (rs2066865), which specifically tags the FGG‐H2 haplotype in Caucasians (position numbering according to SeattleSNPs [34Nickerson D. NHLBI Program for Genomic Applications. UW‐FHCRC, 2003http://pga.gs.washington.eduGoogle Scholar], GenBank Accession number AF350254). In African‐Americans, this polymorphism identifies, in addition to the common FGG‐H2 (21%), three related, less common, (2–6%) haplotypes that have not been found in Caucasians [34Nickerson D. NHLBI Program for Genomic Applications. UW‐FHCRC, 2003http://pga.gs.washington.eduGoogle Scholar]. Genotyping was performed using the 5′ nuclease/TaqMan assay [34Nickerson D. NHLBI Program for Genomic Applications. UW‐FHCRC, 2003http://pga.gs.washington.eduGoogle Scholar]. The PCRs with fluorescent allele‐specific oligonucleotide probes (Assay‐by‐Design/Assay‐on‐Demand, Applied Biosystems, Foster City, CA, USA) were performed on a PTC‐225 thermal cycler (Biozym, Hessisch Oldendorf, Germany), and fluorescence endpoint reading for allelic discrimination was performed on an ABI 7900 HT (Applied Biosystems). In this study, the mean healthy subject plasma fibrinogen concentration, 7.12 ± 1.08 μm (range: 4.23–10.6 μm) was lower, and the range narrower, than the corresponding values for TMA plasma fibrinogens, 9.25 ± 3.18 μm (range: 2.73–16.9 μm) (P < 0.0001). The Total γ′‐fgn/Total fgn ratio in 87 healthy subject plasmas was 0.127 ± 0.029 (Table 1 and Fig. 2). This value for the Total γ′ fgn content approximates the previously reported 15% [3Mosesson M.W. Finlayson J.S. Umfleet R.A. Human fibrinogen heterogeneities. III. Identification of γ chain variants.J Biol Chem. 1972; 247: 5223-7Abstract Full Text PDF PubMed Google Scholar, 8Meh D.A. Mosesson M.W. Siebenlist K.R. Simpson‐Haidaris P.J. Brennan S.O. Di Orio J.P. Thompson K. Di Minno G. Fibrinogen Naples I (Bβ A68T) non‐substrate thrombin binding capacities.Thromb Res. 2001; 103: 63-73Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar]. The healthy subject FL γ′‐fgn/Total fgn ratio, 0.099 ± 0.033, was significantly lower than the Total γ" @default.
• W1570806479 created "2016-06-24" @default.
• W1570806479 creator A5010805647 @default.
• W1570806479 creator A5013816295 @default.
• W1570806479 creator A5043167641 @default.
• W1570806479 creator A5047904216 @default.
• W1570806479 creator A5057640616 @default.
• W1570806479 creator A5065703606 @default.
• W1570806479 creator A5066051839 @default.
• W1570806479 creator A5073314507 @default.
• W1570806479 date "2007-01-01" @default.
• W1570806479 modified "2023-09-30" @default.
• W1570806479 title "Plasma fibrinogen γ′ chain content in the thrombotic microangiopathy syndrome" @default.
• W1570806479 cites W1503079959 @default.
• W1570806479 cites W1556587647 @default.
• W1570806479 cites W1603365810 @default.
• W1570806479 cites W194268429 @default.
• W1570806479 cites W1969632860 @default.
• W1570806479 cites W1969661219 @default.
• W1570806479 cites W1975560613 @default.
• W1570806479 cites W1978039741 @default.
• W1570806479 cites W1979089312 @default.
• W1570806479 cites W1979615223 @default.
• W1570806479 cites W1983821197 @default.
• W1570806479 cites W1990535091 @default.
• W1570806479 cites W1993780126 @default.
• W1570806479 cites W2003843472 @default.
• W1570806479 cites W2014939465 @default.
• W1570806479 cites W2017199698 @default.
• W1570806479 cites W2018612827 @default.
• W1570806479 cites W2020077683 @default.
• W1570806479 cites W2025001402 @default.
• W1570806479 cites W2029313697 @default.
• W1570806479 cites W2030377408 @default.
• W1570806479 cites W2052418612 @default.
• W1570806479 cites W2053659427 @default.
• W1570806479 cites W2056593430 @default.
• W1570806479 cites W2058585755 @default.
• W1570806479 cites W2066305909 @default.
• W1570806479 cites W2068123793 @default.
• W1570806479 cites W2069439952 @default.
• W1570806479 cites W2084124265 @default.
• W1570806479 cites W2086763511 @default.
• W1570806479 cites W2092608701 @default.
• W1570806479 cites W2093477038 @default.
• W1570806479 cites W2101061562 @default.
• W1570806479 cites W2109793252 @default.
• W1570806479 cites W2118409138 @default.
• W1570806479 cites W2138296165 @default.
• W1570806479 cites W2147498528 @default.
• W1570806479 cites W2151368992 @default.
• W1570806479 cites W2154152690 @default.
• W1570806479 cites W2268516246 @default.
• W1570806479 cites W2429900271 @default.
• W1570806479 cites W243010701 @default.
• W1570806479 cites W4238378618 @default.
• W1570806479 cites W4252552511 @default.
• W1570806479 cites W4324262907 @default.
• W1570806479 doi "https://doi.org/10.1111/j.1538-7836.2006.02270.x" @default.
• W1570806479 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17038160" @default.
• W1570806479 hasPublicationYear "2007" @default.
• W1570806479 type Work @default.
• W1570806479 sameAs 1570806479 @default.
• W1570806479 citedByCount "30" @default.
• W1570806479 countsByYear W15708064792012 @default.
• W1570806479 countsByYear W15708064792013 @default.
• W1570806479 countsByYear W15708064792015 @default.
• W1570806479 countsByYear W15708064792016 @default.
• W1570806479 countsByYear W15708064792017 @default.
• W1570806479 countsByYear W15708064792018 @default.
• W1570806479 countsByYear W15708064792019 @default.
• W1570806479 countsByYear W15708064792020 @default.
• W1570806479 countsByYear W15708064792021 @default.
• W1570806479 crossrefType "journal-article" @default.
• W1570806479 hasAuthorship W1570806479A5010805647 @default.
• W1570806479 hasAuthorship W1570806479A5013816295 @default.
• W1570806479 hasAuthorship W1570806479A5043167641 @default.
• W1570806479 hasAuthorship W1570806479A5047904216 @default.
• W1570806479 hasAuthorship W1570806479A5057640616 @default.
• W1570806479 hasAuthorship W1570806479A5065703606 @default.
• W1570806479 hasAuthorship W1570806479A5066051839 @default.
• W1570806479 hasAuthorship W1570806479A5073314507 @default.
• W1570806479 hasBestOaLocation W15708064791 @default.
• W1570806479 hasConcept C126322002 @default.
• W1570806479 hasConcept C134018914 @default.
• W1570806479 hasConcept C2776513394 @default.
• W1570806479 hasConcept C2777878052 @default.
• W1570806479 hasConcept C2779036427 @default.
• W1570806479 hasConcept C2779134260 @default.
• W1570806479 hasConcept C555293320 @default.
• W1570806479 hasConcept C71924100 @default.
• W1570806479 hasConceptScore W1570806479C126322002 @default.
• W1570806479 hasConceptScore W1570806479C134018914 @default.
• W1570806479 hasConceptScore W1570806479C2776513394 @default.
• W1570806479 hasConceptScore W1570806479C2777878052 @default.
• W1570806479 hasConceptScore W1570806479C2779036427 @default.
• W1570806479 hasConceptScore W1570806479C2779134260 @default.
• W1570806479 hasConceptScore W1570806479C555293320 @default.

• next