FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1577279230> ?p ?o ?g. }

• W1577279230 endingPage "13684" @default.
• W1577279230 startingPage "13675" @default.
• W1577279230 abstract "Plasminogen activator inhibitor type 2 (PAI-2) is a serine protease inhibitor that inhibits urokinase. Constitutive and regulated PAI-2 gene expression involves post-transcriptional events, and an AU-rich mRNA instability motif within the 3′-untranslated region of PAI-2 mRNA is required for this process (Maurer, F., Tierney, M., and Medcalf, R. L. (1999)Nucleic Acids Res. 27, 1664–1673). Here we show that instability determinants are present within various exons of the PAI-2 coding region, most notably within exon 4. Deletion of exon 4 from the full-length PAI-2 cDNA results in a doubling in the half-life of PAI-2 mRNA, whereas a 28-nucleotide region within exon 4 contains binding sites for cytoplasmic proteins. Inducible stabilization of PAI-2 mRNA in HT-1080 cells treated with phorbol ester and tumor necrosis factor does not alter the binding of proteins to the exon 4 instability determinant, but resulted in a transient increase in the binding of factors to the AU-rich RNA instability element. Hence, PAI-2 mRNA stability is influenced by elements located within both the coding region and the 3′-untranslated region and that cytoplasmic mRNA binding factors may influence steady state and inducible PAI-2 mRNA expression. Finally a 10-nucleotide region flanking the exon 4 protein-binding site is homologous to instability elements within five other transcripts, suggesting that a common coding region determinant may exist. Plasminogen activator inhibitor type 2 (PAI-2) is a serine protease inhibitor that inhibits urokinase. Constitutive and regulated PAI-2 gene expression involves post-transcriptional events, and an AU-rich mRNA instability motif within the 3′-untranslated region of PAI-2 mRNA is required for this process (Maurer, F., Tierney, M., and Medcalf, R. L. (1999)Nucleic Acids Res. 27, 1664–1673). Here we show that instability determinants are present within various exons of the PAI-2 coding region, most notably within exon 4. Deletion of exon 4 from the full-length PAI-2 cDNA results in a doubling in the half-life of PAI-2 mRNA, whereas a 28-nucleotide region within exon 4 contains binding sites for cytoplasmic proteins. Inducible stabilization of PAI-2 mRNA in HT-1080 cells treated with phorbol ester and tumor necrosis factor does not alter the binding of proteins to the exon 4 instability determinant, but resulted in a transient increase in the binding of factors to the AU-rich RNA instability element. Hence, PAI-2 mRNA stability is influenced by elements located within both the coding region and the 3′-untranslated region and that cytoplasmic mRNA binding factors may influence steady state and inducible PAI-2 mRNA expression. Finally a 10-nucleotide region flanking the exon 4 protein-binding site is homologous to instability elements within five other transcripts, suggesting that a common coding region determinant may exist. The plasminogen activator system is an important proteolytic cascade that plays a role in the removal of blood clots from the circulation and the turnover of a variety of extracellular matrix proteins (2Collen D. Lijnen H.R. Thromb. Haemostasis. 1995; 74: 167-171Crossref PubMed Scopus (93) Google Scholar). The effector enzyme of this system is the powerful protease plasmin, generated from its inactive precursor plasminogen by the plasminogen activators, namely urokinase- or tissue type plasminogen activator (u-PA1and t-PA). These proteases are themselves regulated by the plasminogen activator inhibitors (PAIs), PAI-1 and PAI-2. PAI-1 effectively inhibits both t-PA and u-PA; however, PAI-2 is widely considered to modulate u-PA activity in the extracellular compartments and plays a less important role in regulating t-PA. Although PAI-2 is found as a secreted glycosylated protein, a more abundant form exists within the cytosolic compartment (3Genton C. Kruithof E.K. Schleuning W.D. J. Cell Biol. 1987; 104: 705-712Crossref PubMed Scopus (113) Google Scholar). The predominant intracellular location of PAI-2 has fueled much speculation about additional functions for this inhibitor. Indeed, growing evidence has indicated a role for PAI-2 in the intracellular events associated with differentiation (4Jensen P.J. Wu Q. Janowitz P. Ando Y. Schechter N.M. Exp. Cell Res. 1995; 217: 65-71Crossref PubMed Scopus (77) Google Scholar), proliferation (5Hibino T. Matsuda Y. Takahashi T. Goetinck P.F. J. Invest. Dermatol. 1999; 112: 85-90Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar), apoptosis (6Dickinson J.L. Norris B.J. Jensen P.H. Antalis T.M. Cell Death Differ. 1998; 5: 163-171Crossref PubMed Scopus (64) Google Scholar), and signal transduction (7Shafren D.R. Gardner J. Mann V.H. Antalis T.M. Suhrbier A. J. Virol. 1999; 73: 7193-7198Crossref PubMed Google Scholar). The gene encoding PAI-2 has generated particular interest, not only for its extracellular and presumed intracellular roles but also because of its impressive regulatory profile. PAI-2 gene transcription rates are markedly increased in response to the tumor promoter phorbol 12-myristate 13-acetate (PMA) (8Schleuning W.D. Medcalf R.L. Hession C. Rothenbuhler R. Shaw A. Kruithof E.K. Mol. Cell. Biol. 1987; 7: 4564-4567Crossref PubMed Scopus (98) Google Scholar) and the phosphatase inhibitor, okadaic acid (9Medcalf R.L. J. Biol. Chem. 1992; 267: 12220-12226Abstract Full Text PDF PubMed Google Scholar). The PAI-2 gene is also one of the most tumor necrosis factor- (TNF) (10Medcalf R.L. Kruithof E.K. Schleuning W.D. J. Exp. Med. 1988; 168: 751-759Crossref PubMed Scopus (82) Google Scholar) and lipopolysaccaride (LPS) (11Schwartz B.S. Monroe M.C. Levin E.G. Blood. 1988; 71: 734-741Crossref PubMed Google Scholar)-responsive genes described. For the latter, this has been further confirmed by serial analysis of gene expression analysis of primary human monocytes, whereby PAI-2 mRNA levels were shown to be increased 105-fold by LPS (12Suzuki T. Hashimoto S. Toyoda N. Nagai S. Yamazaki N. Dong H.Y. Sakai J. Yamashita T. Nukiwa T. Matsushima K. Blood. 2000; 96: 2584-2591Crossref PubMed Google Scholar), being the third most LPS-induced transcript produced in these cells. Notwithstanding the important contribution of transcriptional control of PAI-2 expression (13Dear A.E. Shen Y. Ruegg M. Medcalf R.L. Eur. J. Biochem. 1996; 241: 93-100Crossref PubMed Scopus (24) Google Scholar, 14Antalis T.M. Costelloe E. Muddiman J. Ogbourne S. Donnan K. Blood. 1996; 88: 3686-3697Crossref PubMed Google Scholar), the role of post-transcriptional regulation of the PAI-2 gene has recently been highlighted (1Maurer F. Tierney M. Medcalf R.L. Nucleic Acids Res. 1999; 27: 1664-1673Crossref PubMed Scopus (62) Google Scholar, 15Maurer F. Medcalf R.L. J. Biol. Chem. 1996; 271: 26074-26080Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). These investigations stemmed from earlier results whereby treatment of HT-1080 fibrosarcoma cells with a combination of PMA and TNF produced a 50–100-fold increase in PAI-2 gene transcription but a 1500-fold increase in PAI-2 mRNA over a 24-h period (9Medcalf R.L. J. Biol. Chem. 1992; 267: 12220-12226Abstract Full Text PDF PubMed Google Scholar). The discrepancy in the degree of mRNA production was suggestive of inducible stabilization of PAI-2 mRNA under these conditions. Subsequent studies have shown that the rate of PAI-2 mRNA decay can indeed be reduced by phorbol ester (15Maurer F. Medcalf R.L. J. Biol. Chem. 1996; 271: 26074-26080Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar) and dioxin (16Yang J.H. Biochem. Biophys. Res. Commun. 1999; 257: 259-263Crossref PubMed Scopus (28) Google Scholar) or increased by dexamethasone (17Pytel B.A. Peppel K. Baglioni C. J. Cell. Physiol. 1990; 144: 416-422Crossref PubMed Scopus (34) Google Scholar). Functional studies on the 3′-UTR of PAI-2 mRNA led to the identification of an AU-rich mRNA destabilizing determinant (15Maurer F. Medcalf R.L. J. Biol. Chem. 1996; 271: 26074-26080Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). This element provides a binding site for a number of cytoplasmic and nuclear proteins including HuR (1Maurer F. Tierney M. Medcalf R.L. Nucleic Acids Res. 1999; 27: 1664-1673Crossref PubMed Scopus (62) Google Scholar), an mRNA-stabilizing protein that can shuttle between the nucleus and the cytoplasm (18Peng S.S. Chen C.Y. Xu N. Shyu A.B. EMBO J. 1998; 17: 3461-3470Crossref PubMed Scopus (648) Google Scholar, 19Fan X.C. Steitz J.A. EMBO J. 1998; 17: 3448-3460Crossref PubMed Scopus (739) Google Scholar). Although the degree of PAI-2 mRNA instability is influenced by the AU-rich motif in the 3′-UTR, elements within the coding region and possibly the 5′-UTR are also likely to contribute to the control of PAI-2 mRNA stability since the PAI-2 transcripts lacking the 3′-UTR are still relatively unstable (1Maurer F. Tierney M. Medcalf R.L. Nucleic Acids Res. 1999; 27: 1664-1673Crossref PubMed Scopus (62) Google Scholar). Indeed, functional mRNA stability determinants have been detected within the coding region of a growing list of mRNAs including the mRNAs of c-Myc (20Wisdom R. Lee W. Genes Dev. 1991; 5: 232-243Crossref PubMed Scopus (220) Google Scholar, 21Yeilding N.M. Rehman M.T. Lee W.M. Mol. Cell. Biol. 1996; 16: 3511-3522Crossref PubMed Scopus (45) Google Scholar, 22Yeilding N.M. Lee W.M. Mol. Cell. Biol. 1997; 17: 2698-2707Crossref PubMed Scopus (44) Google Scholar), yeast Mat α1 (23Parker R. Jacobson A. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 2780-2784Crossref PubMed Scopus (88) Google Scholar, 24Caponigro G. Muhlrad D. Parker R. Mol. Cell. Biol. 1993; 13: 5141-5148Crossref PubMed Scopus (150) Google Scholar, 25Hennigan A.N. Jacobson A. Mol. Cell. Biol. 1996; 16: 3833-3843Crossref PubMed Google Scholar), vascular endothelial growth factor (VEGF) (26Dibbens J.A. Miller D.L. Damert A. Risau W. Vadas M.A. Goodall G.J. Mol. Biol. Cell. 1999; 10: 907-919Crossref PubMed Scopus (159) Google Scholar), u-PAR (27Shetty S. Kumar A. Idell S. Mol. Cell. Biol. 1997; 17: 1075-1083Crossref PubMed Scopus (106) Google Scholar) and c-Fos (28Kabnick K.S. Housman D.E. Mol. Cell. Biol. 1988; 8: 3244-3250Crossref PubMed Scopus (116) Google Scholar, 29Shyu A.B. Greenberg M.E. Belasco J.G. Genes Dev. 1989; 3: 60-72Crossref PubMed Scopus (445) Google Scholar). Here, we have analyzed exons within the PAI-2 coding region for functional mRNA instability elements. Our findings indicate that the control of PAI-2 mRNA stability is controlled bycis-elements located throughout the coding region, most notably within exon 4, whereas a 28-nt region within this exon provides a specific binding site for cytoplasmic factors. Hence PAI-2 mRNA decay is influenced by both coding region instability elements as well as the AU-rich instability element in the 3′-UTR. Of further interest is that the region immediately adjacent to the 5′ end of the exon 4-binding site bears homology to mRNA instability elements located within the coding region of five other mRNAs. This suggests that a common coding region instability motif may be involved in mRNA turnover. Mouse NIH3T3 cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Life Technologies, Inc.), supplemented with 10% (v/v) heat-inactivated fetal calf serum (HI-FCS), 2 mm glutamine, 50 μg/ml streptomycin, and 50 units/ml penicillin, in a humidified atmosphere at 37 °C with 5% CO2. For mRNA decay experiments, 4 × 105 NIH3T3 cells were plated onto 10-cm2 dishes and grown for 24 h in 10% HI-FCS DMEM, washed twice in phosphate-buffered saline solution, serum-starved in 0.5% HI-FCS DMEM for 48 h prior to stimulation with 15% HI-FCS DMEM. Cells were then harvested at selected intervals up to 24 h (30Lagnado C.A. Brown C.Y. Goodall G.J. Mol. Cell. Biol. 1994; 14: 7984-7995Crossref PubMed Scopus (310) Google Scholar). Plasmid pfos-HGH (30Lagnado C.A. Brown C.Y. Goodall G.J. Mol. Cell. Biol. 1994; 14: 7984-7995Crossref PubMed Scopus (310) Google Scholar) was kindly provided by Dr. Gregory Goodall (Hanson Center, Adelaide, Australia). This vector harbors the human growth hormone gene (HGH) placed under the control of the serum-responsive chicken c-fos promoter as well as the neomycin resistance gene (see Fig. 1, panel A). Plasmid pfos was generated by removing the HGH insert from pfos-HGH using the restriction enzymes HindIII and SacI (1Maurer F. Tierney M. Medcalf R.L. Nucleic Acids Res. 1999; 27: 1664-1673Crossref PubMed Scopus (62) Google Scholar). Individual or groups of PAI-2 exons were amplified by PCR using the pJ7 PAI-2 cDNA (8Schleuning W.D. Medcalf R.L. Hession C. Rothenbuhler R. Shaw A. Kruithof E.K. Mol. Cell. Biol. 1987; 7: 4564-4567Crossref PubMed Scopus (98) Google Scholar) as a template. KpnI and SacI sites were engineered into the 5′ and 3′ sites of the PCR products, respectively, to facilitate the ligation into the c-fos HGH vector. The sizes of the exons are indicated in Fig. 1, panel A. The primers used for the amplification are provided in TableI.Table IOligonucleotides synthesised to amplify individual or groups of exons of the PAI-2 cDNAOligonucleotide nameSequencePosition within PAI-2 cDNAExon 2 sense5′ ctatgaCTCGAGATTGAAACAATGGAGGATC 3′Position 23–41Exon 2 antisense5′ ctatgaGAGCTCCTTGGCCATCTGGTCTTC 3′Position 182–199Exon 3 antisense5′ ctatgaGAGCTCCTGCAAAATCGCATCAGG 3′Position 302–319Exon 4 sense5′ ctatgaGGTACCGCACAAGCTGCAGATAAAATC 3′Position 320–340Exon 4 antisense5′ ctatgaGAGCTCTTCCCGGAAGCTCGCAG 3′Position 432–448Exon 5 antisense5′ ctatgaGAGCTCCTTTGGTTTGAGTGTTGAC 3′Position 548–566Exon 6 antisense5′ ctatgaGAGCTCCGAGTTTACACGGAAAGG 3′Position 692–709Exon 7 sense5′ ctatgaCTCGAGGCTCAGCGCACACCTG 3′Position 710–725Exon 8 antisense5′ ctatgaCTCGAGTTAGGGTGAGCAAAATCTG 3′Position 1261–1279Bold type in uppercase represents restriction sites for KpnI and SacI. Lowercase extensions represent nucleotides added to facilitate improved digestion with restriction enzymes. Open table in a new tab Bold type in uppercase represents restriction sites for KpnI and SacI. Lowercase extensions represent nucleotides added to facilitate improved digestion with restriction enzymes. DNA templates for the in vitro transcription of labeled RNAs for the RNA electrophoretic mobility shift assays (REMSAs, see below) were prepared. The full-length exon 4 was amplified by PCR from the pJ7 PAI-2 cDNA template and inserted into the KpnI andHindIII sites of pBluescript (Stratagene). The sequence of the exon 4 sense primer used for this is provided in Table I. The antisense exon 4 primer is also indicated in Table I but hadHindIII restriction site added at the 5′ end, rather thanSacI. The generation of the shorter RNA probes containing the overlapping exon 4 sequences was prepared by annealing 5′-phosphorylated oligonucleotides encompassing the sense and antisense sequences of exon 4, regions 4A, 4B, and 4C, and then directly inserted into the KpnI and HindIII sites of pBluescript II KS+ (Stratagene). The orientation of these inserts was assessed by DNA sequencing. The sequence of the oligonucleotides used for this are provided in Table II.Table IIOligonucleotides synthesized to prepare overlapping exon 4 RNA probesOligonucleotide nameSequenceExon 4 part A sense5′CGCACAAGCTGCAGATAAAATCCATTCATCCTTCCGCTCTCTCAGCTCTGCA3′Exon 4 part A antisense5′AGCTTGCAGAGCTGAGAGAGCGGAAGGATGAATGGATTTTATCTGCAGCTTGTGCGGTAC3′Exon 4 part B sense5′ CTCAGCTCTGCAATCAATGCATCCACAGGGGATTATTTACTGGAAAGTGTCA 3′Exon 4 part B antisense5′AGCTTGACACTTTCCAGTAAATAATTCCCTGTGGATGCATTGATTGCAGAGCTGAGGTAC3′Exon 4 part C sense5′ CGGAAAGTGTCAATAAGCTGTTTGGTGAGAAGTCTGCGAGCTTCCGGGAAA 3′Exon 4 part C antisense5′AGCTTTTCCCGGAAGCTCGCAGACTTCTCACCAAACAGCTTATTGACACTTTCCGGTAC3′Bold type in uppercase represents restriction sites for KpnI and HindIII. Open table in a new tab Bold type in uppercase represents restriction sites for KpnI and HindIII. The plasmid containing the full-length PAI-2 cDNA driven by the fos promoter (pfos-PAI-2) has been described previously (1Maurer F. Tierney M. Medcalf R.L. Nucleic Acids Res. 1999; 27: 1664-1673Crossref PubMed Scopus (62) Google Scholar). Removal of exon 4 from the PAI-2 cDNA using pfos-PAI-2 as a template was performed by site-directed mutagenesis using the Transformer DNA kit (CLONTECH). The mutagenic primer designed to delete exon 4 had the following sequence: PAI-2 exon 4 deletion primer, 5′-CCTGATGCGATTTTGCAGGAATATATTCGACTCTGTC-3′. The selection primer used to prepare pfos-PAI-2 exon 4 mutant was designed to replace theBamHI site in pfos-PAI-2 with an EcoRI site (underlined) as follows: selection primer (pfos-HGH), 5′-CATGTCTGAATTCCGTCGACCTCG-3′. The pfos vector harboring the PAI-2 mutant cDNA was confirmed by sequencing. Stable transfection of plasmids into NIH3T3 cells was performed by calcium phosphate precipitation procedure (31Sambrook J. Fritsch C.T. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989: 16.30-16.65Google Scholar) using 5 μg of DNA. Transfected clones were selected in medium supplemented with 600 μg/μl of G-418 (Life Technologies, Inc.), and resistant colonies (>200) were pooled by trypsinization. Total RNA was purified from selected cells as described by Chomczynski and Sacchi (32Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (62891) Google Scholar). Aliquots of 5 μg of RNA were electrophoresed through 1% agarose gels containing 20% formaldehyde and subsequently transferred to Hybond-N+ membranes (Amersham Pharmacia Biotech). The filters were hybridized with the 32P-labeled DNA probes as described (33Medcalf R.L. Richards R.I. Crawford R.J. Hamilton J.A. EMBO J. 1986; 5: 2217-2222Crossref PubMed Scopus (63) Google Scholar). Membranes were processed by standard techniques and exposed to Kodak BioMax film (Eastman Kodak Co.) at −80 °C with two intensifying screens. Signals were quantitated using a Fujix BAS 1000 PhosphorImager or by densitometry using a Linotype-Hell scanner. The labeled inserts used for hybridization were obtained as follows: the 1.8-kilobase pair EcoRI cDNA fragment of plasmid pJ7 containing the full-length PAI-2 cDNA (8Schleuning W.D. Medcalf R.L. Hession C. Rothenbuhler R. Shaw A. Kruithof E.K. Mol. Cell. Biol. 1987; 7: 4564-4567Crossref PubMed Scopus (98) Google Scholar); the various labeled PAI-2 exons were prepared by PCR amplifying using plasmid pJ7 as a template; the 679-bp BamHI/HindIII HGH cDNA fragment of pfos-HGH containing the human growth hormone cDNA (30Lagnado C.A. Brown C.Y. Goodall G.J. Mol. Cell. Biol. 1994; 14: 7984-7995Crossref PubMed Scopus (310) Google Scholar); the 1.2-kilobase pair PstI cDNA fragment of mouse β-actin (34Minty A.J. Alonso S. Guenet J.L. Buckingham M.E. J. Mol. Biol. 1983; 167: 77-101Crossref PubMed Scopus (190) Google Scholar); the 972-bp BamHI/HindIII cDNA fragment of neomycin from pCI-neo. The pBluescript DNA templates used to transcribe the PAI-2 exon 4 RNA probes were first linearized withEcoRI. For in vitro transcription, 500 ng of template was incubated for 2 h at 37 °C in the presence of 50 μCi of [α-32P]UTP (DuPont), 10 μm UTP, 0.5 mm ATP, 0.5 mm GTP, 0.5 mm CTP, 20 units RNase inhibitor (Promega), and 50 units of T3 RNA polymerase. Templates harboring the 29-nt AU-rich element in the 3′-UTR were linearized with XbaI, and labeled RNA was transcribedin vitro as described above, but using 50 units of T7 polymerase. RNA probes were purified on a 6% polyacrylamide-urea denaturing gel, eluted in 500 mmNH4CH3COO, 1 mm EDTA solution overnight at room temperature, ethanol-precipitated at −80 °C, and resuspended in water (500 cps/μl). Unlabeled RNA competitors were also prepared by in vitrotranscription, but using 3 μg of template. The relative concentrations of the cold RNAs were estimated by ethidium bromide staining on agarose gels. When used in the binding assays, cold competitors were preincubated with the protein extracts for 15 min at room temperature prior to adding the labeled probe. It was estimated that the cold competitor was used at a minimum of 50–1200-fold molar excess over the labeled probe in the competition experiments (see figure legends). However, it is difficult to calculate precisely the fold excess of the cold RNA over the labeled counterpart because of the different methodologies used during the in vitrotranscription reactions. To prepare protein extracts for the REMSAs, confluent cells were collected by trypsinization, washed three times with phosphate-buffered saline, and then lysed for 5 min on ice in 100 μl/106cells of cytoplasmic extraction buffer (CEB: 10 mm HEPES, pH 7.1, 3 mm MgCl2, 14 mm KCl, 0.2% Nonidet P-40, 1 mm dithiothreitol, 2 μg/ml aprotinin, 0.5 mm phenylmethylsulfonyl fluoride, and 10 μg/ml leupeptin). The nuclei were pelleted for 1 min at 1,000 ×g at 4 °C, and the supernatant containing the cytosolic fraction was aliquoted, snap-frozen in liquid nitrogen, and stored at −80 °C. Nuclear protein extracts were prepared from nuclei as described previously (35Costa M. Medcalf R.L. Eur. J. Biochem. 1996; 237: 532-538Crossref PubMed Scopus (30) Google Scholar). Protein concentrations were determined by using the Bio-Rad protein dye reagent. For the binding assays, 2–4 μg (see figure legends) of protein extracts were preincubated with 5 μg/μl of heparin (Sigma) in a total volume of 20 μl, for 10 min at room temperature before addition of the RNA probe (500 cps). The probe was heated to 65 °C for 5 min and then cooled on ice before adding to the sample. After a 30-min incubation at room temperature, samples were treated with 1 unit of RNase T1 (Roche Molecular Biochemicals) for 10 min at room temperature and then subjected to electrophoresis through a 5% native polyacrylamide gel, and protein-RNA complexes were visualized by autoradiography. REMSA supershift experiments were performed as described (1Maurer F. Tierney M. Medcalf R.L. Nucleic Acids Res. 1999; 27: 1664-1673Crossref PubMed Scopus (62) Google Scholar). Antibodies (1 μl of 1:2 diluted material) were added to the samples immediately following the 30-min incubation of the extract with the labeled RNA and left for 1 h on ice. For supershift experiments, the RNase T1 step was omitted. This procedure was performed as described by Coulis et al. (36Coulis C.M. Lee C. Nardone V. Prokipcak R.D. Mol. Pharmacol. 2000; 57: 485-494Crossref PubMed Scopus (23) Google Scholar). Four overlapping antisense DNA oligonucleotides were prepared and annealed to the exon 4A RNA probe that includes the first 50 bp of PAI-2 exon 4 (see Table II). Oligonucleotides 1–3 are 15 nt in length, and oligonucleotide 4 is 16 nt in length (see Fig. 6, panel A). The sequence of these oligomers is as follows: oligo 1, 5′-GAATGGATTTTATCT-3′; oligo 2, 5′-GAGCGGAAGGATGAA-3′; oligo 3, 5′-TGCAGAGCTGAGAGAG-3′; and oligo 4, 5′-GTCATCACAGGGTCCTGA-3′. An unrelated DNA oligonucleotide 5′-GTCATCACAGGGTCCTGA-3′ was used as a negative control. The DNA oligonucleotides were added to give a final concentration of either 0.1, 1.0, or 10 pmol. Following annealing of the oligomers to the RNA template, cytoplasmic extracts and heparin were added as described in the REMSA protocol. UV-cross-linking of RNA cellular proteins to RNA probes followed by SDS-PAGE was performed as described (1Maurer F. Tierney M. Medcalf R.L. Nucleic Acids Res. 1999; 27: 1664-1673Crossref PubMed Scopus (62) Google Scholar) with slight modifications. Briefly, following the binding reaction (REMSA protocol) using 15–20 μg of cytoplasmic extract, samples were digested with 1.0 units of RNase T1 for 10 min at room temperature and then transferred to microtiter plate wells and placed on ice. Samples were placed 7 cm from a UV source (Ultra LUM modeUVB-20) and cross-linked for 15 min. RNase A (Roche Molecular Biochemicals) was added directly to the wells (final concentration of 100 μg/ml) and left at 37 °C for 15 min. Samples were transferred to Eppendorf tubes and denatured at 100 °C for 5 min in the presence of 6× SDS-PAGE loading buffer containing dithiothreitol before being resolved on 10% SDS-PAGE gels under reducing conditions. Gels were dried and labeled RNA-protein complexes detected by autoradiography. For competition experiments, higher concentrations of unlabeled RNA were included in these experiments compared with the REMSAs due to the higher concentration of protein extract. Western blot analysis for PAI-2 antigen was performed as described previously (15Maurer F. Medcalf R.L. J. Biol. Chem. 1996; 271: 26074-26080Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). 50 μg of cytoplasmic extract was subjected to 10% SDS-polyacrylamide gel electrophoresis under reducing conditions and blotted onto a polyvinylidene difluoride membrane. Membranes were initially blocked with TBS-T buffer (10 mm Tris-HCl, pH 8.0, 150 mm NaCl, 0.05% Tween 20) containing 5% nonfat dry milk for 2 h at room temperature. Membranes were then washed and incubated with a primary anti-PAI-2 antibody (American Diagnostica) at a final dilution of 1:4000 and incubated overnight at 4 °C. Finally, membranes were washed in TBS-T and incubated with the appropriate horseradish peroxidase-conjugated secondary antibody (1:10,000 dilution) for 1 h at room temperature. Immunoreactive proteins were detected by the enhanced chemiluminescence system (ECL reagents, PerkinElmer Life Sciences). The pfos-HGH mRNA decay system was used to identify mRNA instability determinants within the PAI-2 coding region. To this end, a series of individual exons or groups of consecutive exons of the PAI-2 coding region were amplified by PCR and introduced into the 3′-UTR of the HGH gene (see Fig. 1, panel A). NIH3T3 cells stably transfected with these constructs were subjected to serum treatment, and the decay rate of HGH containing transcripts was determined by Northern blotting and quantitated by densitometric analyses. As shown in Fig. 1, panel B, serum treatment of cells transfected with the parent pfos-HGH plasmid produced a stable HGH transcript that displayed a half-life in excess of 3 h. Insertion of exon 2 alone into the 3′-UTR of HGH mRNA slightly increased the decay rate of the HGH reporter transcript (half-life 2½ h). However, insertion of a fragment containing exon 2 + 3 together did not alter the decay rate of the chimeric HGH mRNA. These results suggest that exon 2 possesses instability determinants that are counteracted by sequences present within exon 3. Interestingly, HGH transcripts containing PAI-2 exons 2 + 3 + 4 were particularly unstable, with the half-life of the chimeric transcript reduced to less than 1 h. These data suggests that exon 4 possesses particularly powerful destabilizing elements. Curiously, longer chimeric transcripts containing exons 2–5 or exons 2–6, although promoting destabilization of the reporter transcript (mRNA half-lives: 1½ and 2½ h, respectively), were not as effective as exons 2–4 alone. This also suggests that sequences within exon 5 or 6 contained motifs that counteract the instability elements present in exon 4. Insertion of fragments containing exons 7 and 8 into the 3′-UTR of the pfos-HGH plasmid conferred a destabilizing effect upon the reporter transcript to an extent similar to that produced by exons 2–4 (data not shown). Taken together, these results suggest that instability and stability determinants are located throughout the PAI-2 coding region, with powerful instability elements associated with the presence of exon 4 and also within exons 7 and 8. In this study, we focused our efforts to assess the role of exon 4 in the control of PAI-2 mRNA stability. The instability elements within exons 7 and 8 will be investigated in a separate study. To assess the stability of exon 4 in isolation, the entire exon 4 sequence was introduced into the 3′-UTR of HGH and the mRNA half-life determined. As shown in the Northern blot experiment presented in Fig. 2 (panel A), HGH-exon 4 chimeric transcripts were induced after 1 h of serum treatment, but decayed very rapidly with the signal barely detectable after 2 h. Quantitation of the mRNA signals indicated that the half-life of the exon 4 containing transcript was ∼30 min (panel B). The observation that exon 4 in isolation produced greater instability to the reporter transcript than seen in the context of other exons further supports the notion that mRNA stability determinants exist within neighboring exons to counteract partially the effects of the destabilizing elements in exon 4. To provide more evidence that sequences within exon 4 play a role in PAI-2 mRNA stability, the 129-bp exon 4 was deleted in-frame from the full-length PAI-2 cDNA using plasmid pfos-PAI-2 as a template (Fig. 3,panel A). The resulting construct (pfos-PAI-2Δ4) as well as the construct containing the full-length wild-type PAI-2 cDNA were stably transfected into NIH3T3 cells. Two independent series of transfection experiments were performed. The collective results of two individual serum time courses and Northern blot experiments of both series of transfected cells indicated that the mRNA half-life of the wild-type PAI-2 transcript to be ∼1 h, which is in agreement with previous results (1Maurer F. Tierney M. Medcalf R.L. Nucleic Acids Res. 1999; 27: 1664-1673Crossref PubMed Scopus (62) Google Scholar). However, the half-life of the mutant PAI-2 transcript was extended to 2 h, double that of its wild-type counterpart. These data indicate that sequences within exon 4 promote PAI-2 mRNA instability. Experiments were conducted to determine whether regions within exon 4 provided binding sites for cellular factors. To this end, RNA probes containing the full-length (129 nt) exon 4 sequence were incubated with cytoplasmic extracts prepared from both NIH3T3 cells and HT-1080 fibrosarcoma cells, and binding activit" @default.
• W1577279230 created "2016-06-24" @default.
• W1577279230 creator A5038280310 @default.
• W1577279230 creator A5084027827 @default.
• W1577279230 date "2001-04-01" @default.
• W1577279230 modified "2023-09-27" @default.
• W1577279230 title "Plasminogen Activator Inhibitor Type 2 Contains mRNA Instability Elements within Exon 4 of the Coding Region" @default.
• W1577279230 cites W112607963 @default.
• W1577279230 cites W1589090830 @default.
• W1577279230 cites W1607686789 @default.
• W1577279230 cites W1673084462 @default.
• W1577279230 cites W1758946369 @default.
• W1577279230 cites W1822163158 @default.
• W1577279230 cites W1964465683 @default.
• W1577279230 cites W1967478221 @default.
• W1577279230 cites W1970766576 @default.
• W1577279230 cites W1972101833 @default.
• W1577279230 cites W1977970477 @default.
• W1577279230 cites W1982925662 @default.
• W1577279230 cites W2001748566 @default.
• W1577279230 cites W2004382481 @default.
• W1577279230 cites W2014726611 @default.
• W1577279230 cites W2020124431 @default.
• W1577279230 cites W2023176529 @default.
• W1577279230 cites W2033741891 @default.
• W1577279230 cites W2048154652 @default.
• W1577279230 cites W2051437195 @default.
• W1577279230 cites W2055883254 @default.
• W1577279230 cites W2066250328 @default.
• W1577279230 cites W2087025538 @default.
• W1577279230 cites W2087870057 @default.
• W1577279230 cites W2096259566 @default.
• W1577279230 cites W2096541411 @default.
• W1577279230 cites W2097233174 @default.
• W1577279230 cites W2130364578 @default.
• W1577279230 cites W2145701172 @default.
• W1577279230 cites W2152025158 @default.
• W1577279230 cites W2154823420 @default.
• W1577279230 cites W2158495220 @default.
• W1577279230 cites W2265807804 @default.
• W1577279230 cites W2284365973 @default.
• W1577279230 cites W2333639574 @default.
• W1577279230 cites W2410915340 @default.
• W1577279230 cites W2411304768 @default.
• W1577279230 cites W31432796 @default.
• W1577279230 cites W4294216491 @default.
• W1577279230 doi "https://doi.org/10.1074/jbc.m010627200" @default.
• W1577279230 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11278713" @default.
• W1577279230 hasPublicationYear "2001" @default.
• W1577279230 type Work @default.
• W1577279230 sameAs 1577279230 @default.
• W1577279230 citedByCount "62" @default.
• W1577279230 countsByYear W15772792302012 @default.
• W1577279230 countsByYear W15772792302013 @default.
• W1577279230 countsByYear W15772792302014 @default.
• W1577279230 countsByYear W15772792302015 @default.
• W1577279230 countsByYear W15772792302021 @default.
• W1577279230 countsByYear W15772792302023 @default.
• W1577279230 crossrefType "journal-article" @default.
• W1577279230 hasAuthorship W1577279230A5038280310 @default.
• W1577279230 hasAuthorship W1577279230A5084027827 @default.
• W1577279230 hasBestOaLocation W15772792301 @default.
• W1577279230 hasConcept C104317684 @default.
• W1577279230 hasConcept C153911025 @default.
• W1577279230 hasConcept C185592680 @default.
• W1577279230 hasConcept C2779679481 @default.
• W1577279230 hasConcept C2780675426 @default.
• W1577279230 hasConcept C36823959 @default.
• W1577279230 hasConcept C54355233 @default.
• W1577279230 hasConcept C55493867 @default.
• W1577279230 hasConcept C86803240 @default.
• W1577279230 hasConcept C91779695 @default.
• W1577279230 hasConceptScore W1577279230C104317684 @default.
• W1577279230 hasConceptScore W1577279230C153911025 @default.
• W1577279230 hasConceptScore W1577279230C185592680 @default.
• W1577279230 hasConceptScore W1577279230C2779679481 @default.
• W1577279230 hasConceptScore W1577279230C2780675426 @default.
• W1577279230 hasConceptScore W1577279230C36823959 @default.
• W1577279230 hasConceptScore W1577279230C54355233 @default.
• W1577279230 hasConceptScore W1577279230C55493867 @default.
• W1577279230 hasConceptScore W1577279230C86803240 @default.
• W1577279230 hasConceptScore W1577279230C91779695 @default.
• W1577279230 hasIssue "17" @default.
• W1577279230 hasLocation W15772792301 @default.
• W1577279230 hasOpenAccess W1577279230 @default.
• W1577279230 hasPrimaryLocation W15772792301 @default.
• W1577279230 hasRelatedWork W1594339177 @default.
• W1577279230 hasRelatedWork W2037817954 @default.
• W1577279230 hasRelatedWork W2075658895 @default.
• W1577279230 hasRelatedWork W2082941385 @default.
• W1577279230 hasRelatedWork W2089357296 @default.
• W1577279230 hasRelatedWork W2140227820 @default.
• W1577279230 hasRelatedWork W2140698435 @default.
• W1577279230 hasRelatedWork W2171731468 @default.
• W1577279230 hasRelatedWork W2358218629 @default.
• W1577279230 hasRelatedWork W4233690153 @default.
• W1577279230 hasVolume "276" @default.
• W1577279230 isParatext "false" @default.

• next