FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1685469069> ?p ?o ?g. }

• W1685469069 endingPage "1704" @default.
• W1685469069 startingPage "1704" @default.
• W1685469069 abstract "To the Editor: We have been genotyping blood group systems in Brazilian population[12] and most of the techniques used by us have been the restriction fragment length polymorphism-polymerase chain reaction (PCR), which were previously reported by Reid et al.[3] Based on the manuscript written by Liu et al.,[4] published in Chinese Medical Journal (Genotyping for Kidd, Kell, Duffy, Scianna, and RHCE blood group antigens polymorphisms in Jiangsu Chinese Han, Chin Med J 2012;125:1076-1081), we intended to change some genotyping procedures for allele specific-PCR technique. However, we detected an exchange in the identification of primers RHCE*E and RHCE*e shown in Table 1, line 18–20 (specifics primers) by Liu et al.[4] These primers were previously reported by Gassner et al.[5] and the correct sequences for RHCE oligonucleotides were: E-reverse gatgttctggccaagtgtcaactctc; e-reverse atgttctggccaagtgtcaactctg; and forward to both E and e-ctgctcaccatgctgatcttcct. After using the correct primers, the genotype for the RHCE*CE as well as the genotype for Kell, Duffy and Kidd blood group systems were specific and reproducible. Authors’ Reply First of all, thanks to the editors for giving us the opportunity to answer questions concerning our publication in Chinese Medical Journal entitled “Genotyping for Kidd, Kell, Duffy, Scianna, and RHCE blood group antigens polymorphisms in Jiangsu Chinese Han”.[4] The authors of the letter to the editor stated that they detected an exchange in the identification of primers by RHCE*E and RHCE*e shown in the Table 1, line 18–20 (specifics primers). We double checked the data and found that the nucleotide sequences of the specific primers for genotyping RHEe in the Table 1 from the line 18–19 were correct, however, there were typos that line 18 “reverse” should be “forward,” and line 19 “forward” should be “reverse.” Although we tried to be careful in our proof reading, we did not notice this error. Sorry for the mistake, however, we had cited in this article that these primers were previously reported by Gassner et al.[5] (Prof. Qing Chen, Jiangsu Province Blood Center, Nanjing, Jiangsu 210042, China. E-mail: [email protected])" @default.
• W1685469069 created "2016-06-24" @default.
• W1685469069 creator A5009561535 @default.
• W1685469069 creator A5017132597 @default.
• W1685469069 creator A5073758424 @default.
• W1685469069 creator A5076108723 @default.
• W1685469069 date "2015-06-20" @default.
• W1685469069 modified "2023-09-30" @default.
• W1685469069 title "Letter Concerning" @default.
• W1685469069 cites W1970824459 @default.
• W1685469069 cites W2016515903 @default.
• W1685469069 cites W2072132817 @default.
• W1685469069 cites W2143218130 @default.
• W1685469069 cites W25930811 @default.
• W1685469069 doi "https://doi.org/10.4103/0366-6999.158386" @default.
• W1685469069 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4733754" @default.
• W1685469069 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/26261858" @default.
• W1685469069 hasPublicationYear "2015" @default.
• W1685469069 type Work @default.
• W1685469069 sameAs 1685469069 @default.
• W1685469069 citedByCount "0" @default.
• W1685469069 crossrefType "journal-article" @default.
• W1685469069 hasAuthorship W1685469069A5009561535 @default.
• W1685469069 hasAuthorship W1685469069A5017132597 @default.
• W1685469069 hasAuthorship W1685469069A5073758424 @default.
• W1685469069 hasAuthorship W1685469069A5076108723 @default.
• W1685469069 hasBestOaLocation W16854690691 @default.
• W1685469069 hasConcept C104317684 @default.
• W1685469069 hasConcept C135763542 @default.
• W1685469069 hasConcept C149737253 @default.
• W1685469069 hasConcept C153911025 @default.
• W1685469069 hasConcept C180754005 @default.
• W1685469069 hasConcept C31467283 @default.
• W1685469069 hasConcept C49105822 @default.
• W1685469069 hasConcept C54355233 @default.
• W1685469069 hasConcept C86803240 @default.
• W1685469069 hasConceptScore W1685469069C104317684 @default.
• W1685469069 hasConceptScore W1685469069C135763542 @default.
• W1685469069 hasConceptScore W1685469069C149737253 @default.
• W1685469069 hasConceptScore W1685469069C153911025 @default.
• W1685469069 hasConceptScore W1685469069C180754005 @default.
• W1685469069 hasConceptScore W1685469069C31467283 @default.
• W1685469069 hasConceptScore W1685469069C49105822 @default.
• W1685469069 hasConceptScore W1685469069C54355233 @default.
• W1685469069 hasConceptScore W1685469069C86803240 @default.
• W1685469069 hasIssue "12" @default.
• W1685469069 hasLocation W16854690691 @default.
• W1685469069 hasLocation W16854690692 @default.
• W1685469069 hasLocation W16854690693 @default.
• W1685469069 hasLocation W16854690694 @default.
• W1685469069 hasLocation W16854690695 @default.
• W1685469069 hasLocation W16854690696 @default.
• W1685469069 hasOpenAccess W1685469069 @default.
• W1685469069 hasPrimaryLocation W16854690691 @default.
• W1685469069 hasRelatedWork W165951312 @default.
• W1685469069 hasRelatedWork W1970265735 @default.
• W1685469069 hasRelatedWork W2008843816 @default.
• W1685469069 hasRelatedWork W2081566352 @default.
• W1685469069 hasRelatedWork W2356852849 @default.
• W1685469069 hasRelatedWork W2360200346 @default.
• W1685469069 hasRelatedWork W2883538728 @default.
• W1685469069 hasRelatedWork W3112749984 @default.
• W1685469069 hasRelatedWork W3203513527 @default.
• W1685469069 hasRelatedWork W4285213618 @default.
• W1685469069 hasVolume "128" @default.
• W1685469069 isParatext "false" @default.
• W1685469069 isRetracted "false" @default.
• W1685469069 magId "1685469069" @default.
• W1685469069 workType "article" @default.