FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1934055890> ?p ?o ?g. }

• W1934055890 abstract "Infection of breeding horses with equine arteritis virus (EAV) can result in abortion in up to 50% of mares (Del Piero F 2000 Vet. Pathol. 37, 287–296). Viral transmission occurs in body fluids, including semen (Golnik W et al. 1986 Zentralblatt für Veterinarmedizin 33, 413–417), with infected males potentially shedding virus indefinitely. Previously, the only means of preventing EAV transmission via semen was to remove identified shedders from the breeding pool. Recent medical studies have shown that viral infectivity can be removed from the semen of HIV or hepatitis C patients by a sequential method of sperm preparation: i.e. centrifugation on a discontinuous density gradient, followed by swim-up, (e.g. Bujan et al. 2002 Fertil. Steril. 78, 1321–1323; Levy et al. 2002 Hum. Rep. 17, 2650–2653). Human sperm prepared by this method have been used in over 1000 assisted reproduction attempts without sero-conversion of mothers or children (Lyerly A et al. 2001 Fertil. Steril. 75, 843–858). The current study investigates whether a sequential preparation technique of centrifugation on an EquiPure density gradient followed by a swim-up into a sperm maintenance medium can remove EAV from stallion ejaculates. Aliquots (1mL) of stallion semen, extended in Kenny’s medium, were spiked with known quantities of EAV at three levels corresponding to 1.0, 10 and 100 TCID50/mL−1. The latter was considered to be representative of levels seen in natural infection (Timoney PJ et al. 1987 J. Reprod. Fertil. (Suppl. 35), 95–102). Aliquots of spiked semen were prepared by centrifugation on EquiPure gradients. After centrifuging the resulting sperm pellets in EquiSperm Wash, the sperm were subjected to a swim-up treatment (all sperm preparation material from NidaCon, Gothenburg, Sweden). Aliquots of the sperm preparations, the unspiked extended semen, and spiked extended semen were stored at −70°C for viral assay by nested PCR (Belak S et al. 1994 Proc. 7th Int. Conf. Equine Inf. Dis. pp 33–38). The sensitivity of this assay is less than 1 PFU mL−1 of virus in seminal plasma, as validated by Belak et al. Using the PCR technique, a region from the nucleocapsid gene of EAV is amplified, resulting in a 170-base-pair product. Details of the primer sequences used are as follows: first TCGATGGCGTCAAGACGATCAC and GGTTCCTGGGTGGCTAATAACTACTTCAAC; second CGCAACCCACTCAGGCTATTATTG and GGTAGGAACCCAACTGACGGTG. The untreated spiked samples were all positive for EAV, whereas the sperm preparations from the spiked semen, after density gradient and swim-up, were negative for EAV. A negative control (water) and the unspiked extended ejaculate were also negative. These preliminary results indicate that the sequential technique of centrifugation on an EquiPure density gradient followed by a swim-up is potentially a useful and simple tool for the removal of EAV from the semen of shedding stallions. Further experiments will investigate whether the virus can be removed from naturally infected ejaculates. We are grateful to Prof. Twink Allen and Miss Clare Tiplady of the Equine Fertility Unit, Newmarket, UK, for providing samples of stallion semen. This study is partially funded by Eureka (E-2967)." @default.
• W1934055890 created "2016-06-24" @default.
• W1934055890 creator A5035590997 @default.
• W1934055890 creator A5048865459 @default.
• W1934055890 creator A5060714419 @default.
• W1934055890 creator A5078205004 @default.
• W1934055890 date "2004-01-01" @default.
• W1934055890 modified "2023-09-24" @default.
• W1934055890 title "195REMOVAL OF EQUINE ARTERITIS VIRUS FROM STALLION SEMEN" @default.
• W1934055890 doi "https://doi.org/10.1071/rdv16n1ab195" @default.
• W1934055890 hasPublicationYear "2004" @default.
• W1934055890 type Work @default.
• W1934055890 sameAs 1934055890 @default.
• W1934055890 citedByCount "0" @default.
• W1934055890 crossrefType "journal-article" @default.
• W1934055890 hasAuthorship W1934055890A5035590997 @default.
• W1934055890 hasAuthorship W1934055890A5048865459 @default.
• W1934055890 hasAuthorship W1934055890A5060714419 @default.
• W1934055890 hasAuthorship W1934055890A5078205004 @default.
• W1934055890 hasBestOaLocation W19340558901 @default.
• W1934055890 hasConcept C105702510 @default.
• W1934055890 hasConcept C106358424 @default.
• W1934055890 hasConcept C159047783 @default.
• W1934055890 hasConcept C16685009 @default.
• W1934055890 hasConcept C2522874641 @default.
• W1934055890 hasConcept C2778093475 @default.
• W1934055890 hasConcept C2778499950 @default.
• W1934055890 hasConcept C2778610407 @default.
• W1934055890 hasConcept C2779234561 @default.
• W1934055890 hasConcept C2781087480 @default.
• W1934055890 hasConcept C54355233 @default.
• W1934055890 hasConcept C71924100 @default.
• W1934055890 hasConcept C86803240 @default.
• W1934055890 hasConceptScore W1934055890C105702510 @default.
• W1934055890 hasConceptScore W1934055890C106358424 @default.
• W1934055890 hasConceptScore W1934055890C159047783 @default.
• W1934055890 hasConceptScore W1934055890C16685009 @default.
• W1934055890 hasConceptScore W1934055890C2522874641 @default.
• W1934055890 hasConceptScore W1934055890C2778093475 @default.
• W1934055890 hasConceptScore W1934055890C2778499950 @default.
• W1934055890 hasConceptScore W1934055890C2778610407 @default.
• W1934055890 hasConceptScore W1934055890C2779234561 @default.
• W1934055890 hasConceptScore W1934055890C2781087480 @default.
• W1934055890 hasConceptScore W1934055890C54355233 @default.
• W1934055890 hasConceptScore W1934055890C71924100 @default.
• W1934055890 hasConceptScore W1934055890C86803240 @default.
• W1934055890 hasLocation W19340558901 @default.
• W1934055890 hasOpenAccess W1934055890 @default.
• W1934055890 hasPrimaryLocation W19340558901 @default.
• W1934055890 hasRelatedWork W1511025776 @default.
• W1934055890 hasRelatedWork W1965693865 @default.
• W1934055890 hasRelatedWork W1984647519 @default.
• W1934055890 hasRelatedWork W2034728682 @default.
• W1934055890 hasRelatedWork W2069633844 @default.
• W1934055890 hasRelatedWork W2138928908 @default.
• W1934055890 hasRelatedWork W2287118858 @default.
• W1934055890 hasRelatedWork W2321683785 @default.
• W1934055890 hasRelatedWork W2561214774 @default.
• W1934055890 hasRelatedWork W2991125900 @default.
• W1934055890 isParatext "false" @default.
• W1934055890 isRetracted "false" @default.
• W1934055890 magId "1934055890" @default.
• W1934055890 workType "article" @default.