FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1937769059> ?p ?o ?g. }

• W1937769059 endingPage "724" @default.
• W1937769059 startingPage "719" @default.
• W1937769059 abstract "Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients.The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP.A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively.Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested." @default.
• W1937769059 created "2016-06-24" @default.
• W1937769059 creator A5010916649 @default.
• W1937769059 creator A5041800929 @default.
• W1937769059 creator A5042580405 @default.
• W1937769059 creator A5043682120 @default.
• W1937769059 creator A5067232796 @default.
• W1937769059 date "2012-04-05" @default.
• W1937769059 modified "2023-10-17" @default.
• W1937769059 title "Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine neoplasia type 1 syndrome in Spain" @default.
• W1937769059 cites W1503490387 @default.
• W1937769059 cites W1877420217 @default.
• W1937769059 cites W1897600324 @default.
• W1937769059 cites W1975619716 @default.
• W1937769059 cites W1976870937 @default.
• W1937769059 cites W1980932638 @default.
• W1937769059 cites W1988517195 @default.
• W1937769059 cites W1989688835 @default.
• W1937769059 cites W1993721679 @default.
• W1937769059 cites W1994557413 @default.
• W1937769059 cites W2002633572 @default.
• W1937769059 cites W2009819971 @default.
• W1937769059 cites W2014386433 @default.
• W1937769059 cites W2016672967 @default.
• W1937769059 cites W2023367466 @default.
• W1937769059 cites W2025478082 @default.
• W1937769059 cites W2027702745 @default.
• W1937769059 cites W2027871096 @default.
• W1937769059 cites W2032916856 @default.
• W1937769059 cites W2035592808 @default.
• W1937769059 cites W2041877033 @default.
• W1937769059 cites W2053659717 @default.
• W1937769059 cites W2055996155 @default.
• W1937769059 cites W2058907425 @default.
• W1937769059 cites W2063821942 @default.
• W1937769059 cites W2079232196 @default.
• W1937769059 cites W2085331766 @default.
• W1937769059 cites W2094859123 @default.
• W1937769059 cites W2107406357 @default.
• W1937769059 cites W2107607858 @default.
• W1937769059 cites W2111645552 @default.
• W1937769059 cites W2112225148 @default.
• W1937769059 cites W2116702160 @default.
• W1937769059 cites W2124570033 @default.
• W1937769059 cites W2129412179 @default.
• W1937769059 cites W2133348390 @default.
• W1937769059 cites W2144761225 @default.
• W1937769059 cites W2146338762 @default.
• W1937769059 cites W2150444870 @default.
• W1937769059 cites W2157212789 @default.
• W1937769059 cites W2162942974 @default.
• W1937769059 cites W2171395146 @default.
• W1937769059 cites W4237956739 @default.
• W1937769059 cites W4248234203 @default.
• W1937769059 cites W4250836775 @default.
• W1937769059 doi "https://doi.org/10.1111/j.1365-2265.2011.04269.x" @default.
• W1937769059 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/22026581" @default.
• W1937769059 hasPublicationYear "2012" @default.
• W1937769059 type Work @default.
• W1937769059 sameAs 1937769059 @default.
• W1937769059 citedByCount "59" @default.
• W1937769059 countsByYear W19377690592012 @default.
• W1937769059 countsByYear W19377690592013 @default.
• W1937769059 countsByYear W19377690592014 @default.
• W1937769059 countsByYear W19377690592015 @default.
• W1937769059 countsByYear W19377690592016 @default.
• W1937769059 countsByYear W19377690592017 @default.
• W1937769059 countsByYear W19377690592018 @default.
• W1937769059 countsByYear W19377690592019 @default.
• W1937769059 countsByYear W19377690592020 @default.
• W1937769059 countsByYear W19377690592021 @default.
• W1937769059 countsByYear W19377690592022 @default.
• W1937769059 countsByYear W19377690592023 @default.
• W1937769059 crossrefType "journal-article" @default.
• W1937769059 hasAuthorship W1937769059A5010916649 @default.
• W1937769059 hasAuthorship W1937769059A5041800929 @default.
• W1937769059 hasAuthorship W1937769059A5042580405 @default.
• W1937769059 hasAuthorship W1937769059A5043682120 @default.
• W1937769059 hasAuthorship W1937769059A5067232796 @default.
• W1937769059 hasConcept C104317684 @default.
• W1937769059 hasConcept C2779469564 @default.
• W1937769059 hasConcept C2780103800 @default.
• W1937769059 hasConcept C29906990 @default.
• W1937769059 hasConcept C2994225774 @default.
• W1937769059 hasConcept C501734568 @default.
• W1937769059 hasConcept C502942594 @default.
• W1937769059 hasConcept C54355233 @default.
• W1937769059 hasConcept C75563809 @default.
• W1937769059 hasConcept C86803240 @default.
• W1937769059 hasConceptScore W1937769059C104317684 @default.
• W1937769059 hasConceptScore W1937769059C2779469564 @default.
• W1937769059 hasConceptScore W1937769059C2780103800 @default.
• W1937769059 hasConceptScore W1937769059C29906990 @default.
• W1937769059 hasConceptScore W1937769059C2994225774 @default.
• W1937769059 hasConceptScore W1937769059C501734568 @default.
• W1937769059 hasConceptScore W1937769059C502942594 @default.
• W1937769059 hasConceptScore W1937769059C54355233 @default.
• W1937769059 hasConceptScore W1937769059C75563809 @default.

• next