FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1939874319> ?p ?o ?g. }

• W1939874319 endingPage "420" @default.
• W1939874319 startingPage "415" @default.
• W1939874319 abstract "Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported.We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing.Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype.Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised." @default.
• W1939874319 created "2016-06-24" @default.
• W1939874319 creator A5015396034 @default.
• W1939874319 creator A5016700968 @default.
• W1939874319 creator A5028804707 @default.
• W1939874319 creator A5031363846 @default.
• W1939874319 creator A5037704671 @default.
• W1939874319 creator A5053005967 @default.
• W1939874319 creator A5071662056 @default.
• W1939874319 creator A5071788064 @default.
• W1939874319 creator A5077729766 @default.
• W1939874319 date "2011-09-29" @default.
• W1939874319 modified "2023-10-18" @default.
• W1939874319 title "Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation" @default.
• W1939874319 cites W1559742681 @default.
• W1939874319 cites W1966494539 @default.
• W1939874319 cites W1968382716 @default.
• W1939874319 cites W1985389254 @default.
• W1939874319 cites W1990798746 @default.
• W1939874319 cites W2015619933 @default.
• W1939874319 cites W2032474463 @default.
• W1939874319 cites W2035078318 @default.
• W1939874319 cites W2055463089 @default.
• W1939874319 cites W2055684815 @default.
• W1939874319 cites W2062138338 @default.
• W1939874319 cites W2072506631 @default.
• W1939874319 cites W2089629933 @default.
• W1939874319 cites W2093912088 @default.
• W1939874319 cites W2106247777 @default.
• W1939874319 cites W2110425172 @default.
• W1939874319 cites W2113595463 @default.
• W1939874319 cites W2132165212 @default.
• W1939874319 cites W2135126450 @default.
• W1939874319 cites W2154057943 @default.
• W1939874319 cites W2156985095 @default.
• W1939874319 doi "https://doi.org/10.1111/j.1365-2788.2011.01479.x" @default.
• W1939874319 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21954873" @default.
• W1939874319 hasPublicationYear "2011" @default.
• W1939874319 type Work @default.
• W1939874319 sameAs 1939874319 @default.
• W1939874319 citedByCount "5" @default.
• W1939874319 countsByYear W19398743192013 @default.
• W1939874319 countsByYear W19398743192014 @default.
• W1939874319 countsByYear W19398743192015 @default.
• W1939874319 countsByYear W19398743192018 @default.
• W1939874319 countsByYear W19398743192021 @default.
• W1939874319 crossrefType "journal-article" @default.
• W1939874319 hasAuthorship W1939874319A5015396034 @default.
• W1939874319 hasAuthorship W1939874319A5016700968 @default.
• W1939874319 hasAuthorship W1939874319A5028804707 @default.
• W1939874319 hasAuthorship W1939874319A5031363846 @default.
• W1939874319 hasAuthorship W1939874319A5037704671 @default.
• W1939874319 hasAuthorship W1939874319A5053005967 @default.
• W1939874319 hasAuthorship W1939874319A5071662056 @default.
• W1939874319 hasAuthorship W1939874319A5071788064 @default.
• W1939874319 hasAuthorship W1939874319A5077729766 @default.
• W1939874319 hasConcept C104317684 @default.
• W1939874319 hasConcept C119054055 @default.
• W1939874319 hasConcept C127716648 @default.
• W1939874319 hasConcept C135763542 @default.
• W1939874319 hasConcept C153209595 @default.
• W1939874319 hasConcept C2776395126 @default.
• W1939874319 hasConcept C2777543196 @default.
• W1939874319 hasConcept C2778863441 @default.
• W1939874319 hasConcept C2779388368 @default.
• W1939874319 hasConcept C36823959 @default.
• W1939874319 hasConcept C501734568 @default.
• W1939874319 hasConcept C54355233 @default.
• W1939874319 hasConcept C71924100 @default.
• W1939874319 hasConcept C86803240 @default.
• W1939874319 hasConceptScore W1939874319C104317684 @default.
• W1939874319 hasConceptScore W1939874319C119054055 @default.
• W1939874319 hasConceptScore W1939874319C127716648 @default.
• W1939874319 hasConceptScore W1939874319C135763542 @default.
• W1939874319 hasConceptScore W1939874319C153209595 @default.
• W1939874319 hasConceptScore W1939874319C2776395126 @default.
• W1939874319 hasConceptScore W1939874319C2777543196 @default.
• W1939874319 hasConceptScore W1939874319C2778863441 @default.
• W1939874319 hasConceptScore W1939874319C2779388368 @default.
• W1939874319 hasConceptScore W1939874319C36823959 @default.
• W1939874319 hasConceptScore W1939874319C501734568 @default.
• W1939874319 hasConceptScore W1939874319C54355233 @default.
• W1939874319 hasConceptScore W1939874319C71924100 @default.
• W1939874319 hasConceptScore W1939874319C86803240 @default.
• W1939874319 hasIssue "4" @default.
• W1939874319 hasLocation W19398743191 @default.
• W1939874319 hasLocation W19398743192 @default.
• W1939874319 hasOpenAccess W1939874319 @default.
• W1939874319 hasPrimaryLocation W19398743191 @default.
• W1939874319 hasRelatedWork W1971952955 @default.
• W1939874319 hasRelatedWork W1988764617 @default.
• W1939874319 hasRelatedWork W1998297242 @default.
• W1939874319 hasRelatedWork W2025271964 @default.
• W1939874319 hasRelatedWork W2084941669 @default.
• W1939874319 hasRelatedWork W2089942758 @default.
• W1939874319 hasRelatedWork W2102378473 @default.
• W1939874319 hasRelatedWork W2173655891 @default.
• W1939874319 hasRelatedWork W2999071818 @default.

• next