FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1964805211> ?p ?o ?g. }

• W1964805211 endingPage "887.e5" @default.
• W1964805211 startingPage "886" @default.
• W1964805211 abstract "To the Editor:As the immunologically active interface between the mother and the fetus, the placenta has enormous potential to influence fetal immune development. Complex immunologic mechanisms have evolved to allow the fetal and maternal immune systems to coexist during pregnancy. In addition to well-recognized subtle adaptations of humoral and cellular immunity, there is an emerging role of CD4+CD25+ regulatory T cells (Treg)1Aluvihare V.R. Kallikourdis M. Betz A.G. Regulatory T cells mediate maternal tolerance to the fetus.Nat Immunol. 2004; 5: 266-271Crossref PubMed Scopus (1282) Google Scholar in suppressing alloimmune responses between the mother and the fetus. During pregnancy, human chorionic gonadotrophin attracts Treg cells to the maternal-fetal interface2Schumacher A. Brachwitz N. Sohr S. Engeland K. Langwisch S. Dolaptchieva M. et al.Human chorionic gonadotropin attracts regulatory T cells into the fetal-maternal interface during early human pregnancy.J Immunol. 2009; 182: 5488-5497Crossref PubMed Scopus (249) Google Scholar and collectively these forkhead box P3 (FOXP3)+ cells are important in maintaining the tolerogenic cytokine milieu critical for successful pregnancy.As the fetus is sensitive to events in the placenta, we explored whether variations in placental FOXP3 gene expression are associated with subsequent infant susceptibility to allergy disease. While maternal FOXP3+ Treg cells have been identified in the maternal placenta tissues (decidua), this is the first study to identify FOXP3+ cells in the fetal placenta tissues and to relate FOXP3 expression to subsequent allergic outcomes.We measured the FOXP3 mRNA expression in placental samples of nonsmoking mothers (n = 63) collected from a previously described birth cohort3Prescott S.L. Noakes P. Chow B.W. Breckler L. Thornton C.A. Hollams E.M. et al.Presymptomatic differences in Toll-like receptor function in infants who have allergy.J Allergy Clin Immunol. 2008; 122 (399.e1-5): 391-399Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar and compared levels in infants with allergic disease at 1 year (n = 32) with levels in infants without allergic disease (n = 31). Placental RNA was extracted from homogenized frozen placenta (collected from the fetal portion below the amniotic membrane) as described previously.4Scott N.M. Hodyl N.A. Murphy V.E. Osei-Kumah A. Wyper H. Hodgson D.M. et al.Placental cytokine expression co-varies with maternal asthma severity and fetal sex.J Immunol. 2009; 182: 1411-1412Crossref PubMed Scopus (90) Google Scholar Quantitative real-time RT-PCR was used to determine placental FOXP3 mRNA levels normalized against β-actin housekeeping gene.4Scott N.M. Hodyl N.A. Murphy V.E. Osei-Kumah A. Wyper H. Hodgson D.M. et al.Placental cytokine expression co-varies with maternal asthma severity and fetal sex.J Immunol. 2009; 182: 1411-1412Crossref PubMed Scopus (90) Google Scholar Locus-specific methylation analysis (FOXP3 promoter and enhancer) was carried out by using Sequenom MassARRAY EpiTYPING as previously described.5Wong N.C. Novakovic B. Weinrich B. Dewi C. Andronikos R. Sibson M. et al.Methylation of the adenomatous polyposis coli (APC) gene in human placenta and hypermethylation in choriocarcinoma cells.Cancer Lett. 2008; 268: 56-62Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar We confirmed FOXP3 protein in placental tissue by immunohistochemistry (as described in this article’s Online Repository at www.jacionline.org).Infant allergic disease was defined by doctor-diagnosed eczema and/or IgE-mediated food allergy with sensitization to that food (skin prick test ≥3 mm) as previously described.3Prescott S.L. Noakes P. Chow B.W. Breckler L. Thornton C.A. Hollams E.M. et al.Presymptomatic differences in Toll-like receptor function in infants who have allergy.J Allergy Clin Immunol. 2008; 122 (399.e1-5): 391-399Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar In the group with allergic disease, 72% of infants had eczema (all with allergen sensitization) and 37% had food allergy (most commonly to egg). The infants without allergic disease had no evidence of sensitization or allergy symptoms. Maternal allergic disease (asthma or allergic rhinitis) was more common in the infants with allergic disease (100%) than in the infants without allergic disease (42%; P < .001).FOXP3 was expressed in all placentas tested, with reduced expression in infants who developed allergic disease as compared with infants who did not develop allergic disease (P = .013) (Fig 1, A). Placenta TGF-β expression, a key regulatory cytokine inducing FOXP3 gene expression, showed parallel trends (as FOXP3 mRNA) for lower levels in infants with allergic disease, but this was not statistically significant (see Fig E1 in this article’s Online Repository at www.jacionline.org). FOXP3 mRNA was lower in placentas of female infants (P = .029), both with and without allergic disease (Fig 1, B; see Fig E2 in this article’s Online Repository at www.jacionline.org), supporting previously observed sex-specific differences in placental gene regulation.4Scott N.M. Hodyl N.A. Murphy V.E. Osei-Kumah A. Wyper H. Hodgson D.M. et al.Placental cytokine expression co-varies with maternal asthma severity and fetal sex.J Immunol. 2009; 182: 1411-1412Crossref PubMed Scopus (90) Google Scholar The strong association between maternal and infant allergy in this population makes it difficult to dissect the relative influence of the maternal phenotype, which has been previously associated with reduced neonatal Treg cell function.6Schaub B. Liu J. Hoppler S. Haug S. Sattler C. Lluis A. et al.Impairment of T-regulatory cells in cord blood of atopic mothers.J Allergy Clin Immunol. 2008; 121 (1499.e1-13): 1491-1499Abstract Full Text Full Text PDF PubMed Scopus (130) Google ScholarAlthough FOXP3 is expressed by maternal Treg cells recruited to the maternal-fetal interface, these are found largely in decidual (maternal) tissue.7Tilburgs T. Roelen D.L. van der Mast B.J. de Groot-Swings G.M. Kleijburg C. Scherjon S.A. et al.Evidence for a selective migration of fetus-specific CD4+CD25 bright regulatory T cells from the peripheral blood to the decidua in human pregnancy.J Immunol. 2008; 180: 5737-5745PubMed Google Scholar For the first time, we now demonstrate, by using immunohistochemistry, the presence of FOXP3 protein in fetal placental tissue (see Fig E3 in this article’s Online Repository at www.jacionline.org). Furthermore, we found significant demethylation of the FOXP3 promoter (particularly cytosine phosphoguanine [CpG]8; 40% methylated) and the FOXP3 enhancer (particularly CpG1; 40% methylated) in the placenta (Fig 2) and purified cytotrophoblast (cytokeratin-7 positive) cells. Placental methylation levels were significantly lower than those in cord blood CD4+ T cells, which were generally more than 90% methylated (P < .05). Previous studies have demonstrated that neonatal FOXP3 gene expression is epigenetically modified by environmental exposures in pregnancy.8Schaub B. Liu J. Hoppler S. Schleich I. Huehn J. Olek S. et al.Maternal farm exposure modulates neonatal immune mechanisms through regulatory T cells.J Allergy Clin Immunol. 2009; 123 (e5): 774-782Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar Specifically, the allergy-protective effect of microbial exposure in pregnancy has been associated with increased neonatal Treg cell activity through demethylation of the FOXP3 gene.8Schaub B. Liu J. Hoppler S. Schleich I. Huehn J. Olek S. et al.Maternal farm exposure modulates neonatal immune mechanisms through regulatory T cells.J Allergy Clin Immunol. 2009; 123 (e5): 774-782Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar Given the demonstrated regulation of FOXP3 expression in the Treg cell lineage through decreasing methylation of these regions, we conclude that the placental expression of this gene is similarly regulated by DNA methylation.Fig 2Comparison of FOXP3 gene methylation patterns in cord blood and placenta. Methylation of CpG sites in the FOXP3 promoter (A) and FOXP3 enhancer (B) for placental samples (n = 11) and matched cord blood samples (n = 11) as means and 95% CIs (∗P < .05; ∗∗P < .01).View Large Image Figure ViewerDownload Hi-res image Download (PPT)In combination, these findings suggest that FOXP3 is expressed by resident cells of the placenta derived from fetal tissues, not from contaminating cells of the fetal circulation or the maternal compartment. Ongoing studies will also examine individual epigenetic variations of specific cell types in relation to environmental exposures in pregnancy.Our findings also provide further support for a role of FOXP3+ regulatory populations in early immune programming.6Schaub B. Liu J. Hoppler S. Haug S. Sattler C. Lluis A. et al.Impairment of T-regulatory cells in cord blood of atopic mothers.J Allergy Clin Immunol. 2008; 121 (1499.e1-13): 1491-1499Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 8Schaub B. Liu J. Hoppler S. Schleich I. Huehn J. Olek S. et al.Maternal farm exposure modulates neonatal immune mechanisms through regulatory T cells.J Allergy Clin Immunol. 2009; 123 (e5): 774-782Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar We speculate that the differences in placental FOXP3 gene expression associated with allergy observed in this study reflect combined effects of maternal phenotype, fetal genotype, and environmental exposures in utero. Further studies are needed to examine the functional significance of FOXP3 expression in the placenta.In summary, this is the first study to identify FOXP3 expression in placental tissue and to demonstrate reduced FOXP3 expression in placentas of infants who subsequently develop allergic disease. This supports our hypothesis that variations in the placental activity of this key regulatory gene influence fetal immune development and disease susceptibility. To the Editor: As the immunologically active interface between the mother and the fetus, the placenta has enormous potential to influence fetal immune development. Complex immunologic mechanisms have evolved to allow the fetal and maternal immune systems to coexist during pregnancy. In addition to well-recognized subtle adaptations of humoral and cellular immunity, there is an emerging role of CD4+CD25+ regulatory T cells (Treg)1Aluvihare V.R. Kallikourdis M. Betz A.G. Regulatory T cells mediate maternal tolerance to the fetus.Nat Immunol. 2004; 5: 266-271Crossref PubMed Scopus (1282) Google Scholar in suppressing alloimmune responses between the mother and the fetus. During pregnancy, human chorionic gonadotrophin attracts Treg cells to the maternal-fetal interface2Schumacher A. Brachwitz N. Sohr S. Engeland K. Langwisch S. Dolaptchieva M. et al.Human chorionic gonadotropin attracts regulatory T cells into the fetal-maternal interface during early human pregnancy.J Immunol. 2009; 182: 5488-5497Crossref PubMed Scopus (249) Google Scholar and collectively these forkhead box P3 (FOXP3)+ cells are important in maintaining the tolerogenic cytokine milieu critical for successful pregnancy. As the fetus is sensitive to events in the placenta, we explored whether variations in placental FOXP3 gene expression are associated with subsequent infant susceptibility to allergy disease. While maternal FOXP3+ Treg cells have been identified in the maternal placenta tissues (decidua), this is the first study to identify FOXP3+ cells in the fetal placenta tissues and to relate FOXP3 expression to subsequent allergic outcomes. We measured the FOXP3 mRNA expression in placental samples of nonsmoking mothers (n = 63) collected from a previously described birth cohort3Prescott S.L. Noakes P. Chow B.W. Breckler L. Thornton C.A. Hollams E.M. et al.Presymptomatic differences in Toll-like receptor function in infants who have allergy.J Allergy Clin Immunol. 2008; 122 (399.e1-5): 391-399Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar and compared levels in infants with allergic disease at 1 year (n = 32) with levels in infants without allergic disease (n = 31). Placental RNA was extracted from homogenized frozen placenta (collected from the fetal portion below the amniotic membrane) as described previously.4Scott N.M. Hodyl N.A. Murphy V.E. Osei-Kumah A. Wyper H. Hodgson D.M. et al.Placental cytokine expression co-varies with maternal asthma severity and fetal sex.J Immunol. 2009; 182: 1411-1412Crossref PubMed Scopus (90) Google Scholar Quantitative real-time RT-PCR was used to determine placental FOXP3 mRNA levels normalized against β-actin housekeeping gene.4Scott N.M. Hodyl N.A. Murphy V.E. Osei-Kumah A. Wyper H. Hodgson D.M. et al.Placental cytokine expression co-varies with maternal asthma severity and fetal sex.J Immunol. 2009; 182: 1411-1412Crossref PubMed Scopus (90) Google Scholar Locus-specific methylation analysis (FOXP3 promoter and enhancer) was carried out by using Sequenom MassARRAY EpiTYPING as previously described.5Wong N.C. Novakovic B. Weinrich B. Dewi C. Andronikos R. Sibson M. et al.Methylation of the adenomatous polyposis coli (APC) gene in human placenta and hypermethylation in choriocarcinoma cells.Cancer Lett. 2008; 268: 56-62Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar We confirmed FOXP3 protein in placental tissue by immunohistochemistry (as described in this article’s Online Repository at www.jacionline.org). Infant allergic disease was defined by doctor-diagnosed eczema and/or IgE-mediated food allergy with sensitization to that food (skin prick test ≥3 mm) as previously described.3Prescott S.L. Noakes P. Chow B.W. Breckler L. Thornton C.A. Hollams E.M. et al.Presymptomatic differences in Toll-like receptor function in infants who have allergy.J Allergy Clin Immunol. 2008; 122 (399.e1-5): 391-399Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar In the group with allergic disease, 72% of infants had eczema (all with allergen sensitization) and 37% had food allergy (most commonly to egg). The infants without allergic disease had no evidence of sensitization or allergy symptoms. Maternal allergic disease (asthma or allergic rhinitis) was more common in the infants with allergic disease (100%) than in the infants without allergic disease (42%; P < .001). FOXP3 was expressed in all placentas tested, with reduced expression in infants who developed allergic disease as compared with infants who did not develop allergic disease (P = .013) (Fig 1, A). Placenta TGF-β expression, a key regulatory cytokine inducing FOXP3 gene expression, showed parallel trends (as FOXP3 mRNA) for lower levels in infants with allergic disease, but this was not statistically significant (see Fig E1 in this article’s Online Repository at www.jacionline.org). FOXP3 mRNA was lower in placentas of female infants (P = .029), both with and without allergic disease (Fig 1, B; see Fig E2 in this article’s Online Repository at www.jacionline.org), supporting previously observed sex-specific differences in placental gene regulation.4Scott N.M. Hodyl N.A. Murphy V.E. Osei-Kumah A. Wyper H. Hodgson D.M. et al.Placental cytokine expression co-varies with maternal asthma severity and fetal sex.J Immunol. 2009; 182: 1411-1412Crossref PubMed Scopus (90) Google Scholar The strong association between maternal and infant allergy in this population makes it difficult to dissect the relative influence of the maternal phenotype, which has been previously associated with reduced neonatal Treg cell function.6Schaub B. Liu J. Hoppler S. Haug S. Sattler C. Lluis A. et al.Impairment of T-regulatory cells in cord blood of atopic mothers.J Allergy Clin Immunol. 2008; 121 (1499.e1-13): 1491-1499Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar Although FOXP3 is expressed by maternal Treg cells recruited to the maternal-fetal interface, these are found largely in decidual (maternal) tissue.7Tilburgs T. Roelen D.L. van der Mast B.J. de Groot-Swings G.M. Kleijburg C. Scherjon S.A. et al.Evidence for a selective migration of fetus-specific CD4+CD25 bright regulatory T cells from the peripheral blood to the decidua in human pregnancy.J Immunol. 2008; 180: 5737-5745PubMed Google Scholar For the first time, we now demonstrate, by using immunohistochemistry, the presence of FOXP3 protein in fetal placental tissue (see Fig E3 in this article’s Online Repository at www.jacionline.org). Furthermore, we found significant demethylation of the FOXP3 promoter (particularly cytosine phosphoguanine [CpG]8; 40% methylated) and the FOXP3 enhancer (particularly CpG1; 40% methylated) in the placenta (Fig 2) and purified cytotrophoblast (cytokeratin-7 positive) cells. Placental methylation levels were significantly lower than those in cord blood CD4+ T cells, which were generally more than 90% methylated (P < .05). Previous studies have demonstrated that neonatal FOXP3 gene expression is epigenetically modified by environmental exposures in pregnancy.8Schaub B. Liu J. Hoppler S. Schleich I. Huehn J. Olek S. et al.Maternal farm exposure modulates neonatal immune mechanisms through regulatory T cells.J Allergy Clin Immunol. 2009; 123 (e5): 774-782Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar Specifically, the allergy-protective effect of microbial exposure in pregnancy has been associated with increased neonatal Treg cell activity through demethylation of the FOXP3 gene.8Schaub B. Liu J. Hoppler S. Schleich I. Huehn J. Olek S. et al.Maternal farm exposure modulates neonatal immune mechanisms through regulatory T cells.J Allergy Clin Immunol. 2009; 123 (e5): 774-782Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar Given the demonstrated regulation of FOXP3 expression in the Treg cell lineage through decreasing methylation of these regions, we conclude that the placental expression of this gene is similarly regulated by DNA methylation. In combination, these findings suggest that FOXP3 is expressed by resident cells of the placenta derived from fetal tissues, not from contaminating cells of the fetal circulation or the maternal compartment. Ongoing studies will also examine individual epigenetic variations of specific cell types in relation to environmental exposures in pregnancy. Our findings also provide further support for a role of FOXP3+ regulatory populations in early immune programming.6Schaub B. Liu J. Hoppler S. Haug S. Sattler C. Lluis A. et al.Impairment of T-regulatory cells in cord blood of atopic mothers.J Allergy Clin Immunol. 2008; 121 (1499.e1-13): 1491-1499Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 8Schaub B. Liu J. Hoppler S. Schleich I. Huehn J. Olek S. et al.Maternal farm exposure modulates neonatal immune mechanisms through regulatory T cells.J Allergy Clin Immunol. 2009; 123 (e5): 774-782Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar We speculate that the differences in placental FOXP3 gene expression associated with allergy observed in this study reflect combined effects of maternal phenotype, fetal genotype, and environmental exposures in utero. Further studies are needed to examine the functional significance of FOXP3 expression in the placenta. In summary, this is the first study to identify FOXP3 expression in placental tissue and to demonstrate reduced FOXP3 expression in placentas of infants who subsequently develop allergic disease. This supports our hypothesis that variations in the placental activity of this key regulatory gene influence fetal immune development and disease susceptibility. We acknowledge the families who participated in this research, Dr Jeff Keelan who assisted in the interpretation of the immunohistochemistry, and the Department of Pathology at Princess Margaret Hospital. MethodsStudy populationThis study used samples collected as part of previously describedE1Prescott S.L. Noakes P. Chow B.W. Breckler L. Thornton C.A. Hollams E.M. et al.Presymptomatic differences in Toll-like receptor function in infants who have allergy.J Allergy Clin Immunol. 2008; 122 (e1-5): 391-399Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar longitudinal cohort studies, as approved by the Princess Margaret Hospital Ethics Committee. Briefly, healthy pregnant women aged ≥18 and ≤44 years were recruited from the private clinics of obstetricians in the Perth metropolitan area, Western Australia. Only healthy term pregnancies were included, and all women were nonsmokers. The women were recruited from 20 weeks’ gestation and reviewed regularly through their pregnancy and the postpartum period. Their infants were seen for allergy assessments and skin prick testing at 1 year of age (see below).Definitions of allergyMaternal allergy was defined as a doctor-diagnosed clinical history of asthma, eczema, or allergic rhinitis plus a positive skin prick test (SPT) result to one or more common allergens. Mothers without allergic disease had no history of allergic disease and negative SPT result to all tested allergens.Infants were clinically evaluated at 12 months of age with a detailed history and examination by the same pediatric allergist (Prof Susan Prescott). The main allergic outcomes were eczema, IgE-mediated food allergy, and sensitization. A diagnosis of eczema was based on typical skin lesions responsive to topical steroids. IgE-mediated food allergy was defined as a history of immediate (within 60 minutes) symptoms following contact with and/or ingestion of food (such as egg, dairy products, and nuts) and a positive SPT result to the implicated food. Symptoms of acute food allergy included skin reactions (hives, rashes, or swelling), respiratory symptoms (cough, wheeze, stridor), gastrointestinal symptoms (abdominal pain, vomiting, loose stools), and/or cardiovascular symptoms (collapse). Sensitization was determined by the presence of a positive SPT result to allergen extracts (egg, milk, peanut, house dust mite, cat; Hollister-Stier Laboratories) and a histamine control. A wheal diameter of ≥3 mm was considered positive.Detection of FOXP3 protein in placental tissue by immunohistochemistryFormalin-fixed paraffin-embedded sections (4 μm) were dewaxed and taken to distilled water and then treated with microwave heat–mediated antigen retrieval with in-house EDTA buffer (pH 8.0). Sections were incubated with FOXP3 mouse monoclonal antibody (1 mg/mL used at 1:50) (clone 236A/E7) (Abcam, San Francisco, Calif) for 60 minutes at room temperature. Detection was performed by using Dako EnVision+ Dual Link System-HRP (K4061, 30 minutes) (Dako, Houston, Tex), and the reaction product was visualized with Dako Liquid DAB+ Substrate-Chromogen System (K3468, 5 minutes). Positive control tissue was run in parallel with the test sections, consisting of a 4-μm section of appendix with lymphoid patches. For negative controls, the primary FOXP3 antibody was replaced with concentration- and isotype-matched mouse IgG1 control antibody (code X 0931) (Dako). Positive cells appeared brown under bright field illumination.Placental RNA extractionTotal placental RNA was extracted from 0.1 g of crushed frozen placenta by using the TRIzol method (InVitrogen) and homogenization in a Precellys 24 Homogenizer, as described previously.E2Murphy V.E. Zakar T. Smith R. Giles W.B. Gibson P.G. Clifton V.L. Reduced 11β hydroxysteroid dehydrogenase type 2 activity is associated with decreased birth weight centile in pregnancies complicated by asthma.J Clin Endocrinol Metab. 2011; 87: 1660-1668Google Scholar Following extraction, the RNA was purified by using Qiagen RNeasy Mini Kit and DNase-treated by using Qiagen RNase-free DNase kit (Qiagen, Clifton Hill, Australia) according to the manufacturer’s directions. The quality of the purified placental RNA samples was verified by running samples on an Agilent 2100 Bioanalyzer, and visualization of the 18S and 28S rRNA bands verified that the extracted RNA was intact.Quantitative real-time RT-PCRQuantitative real-time RT-PCR was used to determine placental mRNA expression (FOXP3 and TGF-β) compared with levels of the housekeeping gene β-actin. Two micrograms of purified total RNA was reverse transcribed by using the Invitrogen SuperScript III Kit for RT-PCR with random hexamers as primers, according to the manufacturer’s instructions. All samples were diluted 1:5. Quantitect primer assays were used to detect both targets. Following optimization of primer concentration and volumes, real-time PCR was performed using an ABI Prism 7900HT Sequence Detector (Applied Biosystems, Foster City, Calif). Each mRNA sequence was amplified in duplicate in 20-μL reactions containing SYBR green PCR master mix (Applied Biosystems), cDNA corresponding to 40 ng of reverse-transcribed RNA, and forward and reverse primers at a concentration between 200 and 800 nM, depending on the optimal primer concentration. Both no-template and no-reverse transcriptase controls were included for each amplification reaction, and the homogeneity of the amplified products was confirmed routinely by melting curve analysis and agarose gel electrophoresis. Dissociation curve analysis was used to confirm the specificity of amplification, and relative copy numbers were determined from PCR product standard curves. Copy numbers were normalized against β-actin copy numbers for each cDNA sample.Methylation studiesLocus-specific methylation analysis was carried out by Sequenom MassARRAY EpiTYPING as previously describedE3Wong N. Morley R. Saffery R. Craig J. Archived Guthrie blood spots as a novel source for quantitative DNA methylation analysis.Biotechniques. 2008; 45 (426, 428 passim): 423-424Crossref PubMed Scopus (39) Google Scholar, E4Wong N.C. Novakovic B. Weinrich B. Dewi C. Andronikos R. Sibson M. et al.Methylation of the adenomatous polyposis coli (APC) gene in human placenta and hypermethylation in choriocarcinoma cells.Cancer Lett. 2008; 268: 56-62Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, E5Ehrich M. Nelson M.R. Stanssens P. Zabeau M. Liloglou T. Xinarianos G. et al.Quantitative high-throughput analysis of DNA methylation patterns by base-specific cleavage and mass spectrometry.Proc Natl Acad Sci U S A. 2005; 102: 15785-15790Crossref PubMed Scopus (690) Google Scholar for quantitation of DNA methylation. In brief, 1 to 2 mg of genomic DNA was bisulfite treated by using the MethylEasy Xceed kit (Human Genetic Signatures, North Ryde, Australia), with converted DNA eluted to a final concentration of 20 ng/μL, of which 20 ng was used in each PCR amplification. Amplification primers were directed to sequences of interest following bisulfite conversion. Primers for FOXP3 were designed by using Epidesigner (http://epidesigner.com/) and MethprimerE6Li L.C. Dahiya R. MethPrimer: designing primers for methylation PCRs.Bioinformatics. 2002; 18: 1427-1431Crossref PubMed Scopus (1940) Google Scholar software packages. FOXP3 promoter primers were as follows: forward, TATTTTTTATTTTTGTGGTGAGGGG and reverse, AAATCAACCTAACTTATAAAAAACTATCA; and FOXP3 enhancers were as follows: forward, TTTTGATTGGGTTTTTTAGAAGTTG and reverse, ACCAAATAAACATCACCTACCACAT, with the addition of appropriate linkers as previously described.E7Novakovic B. Wong N.C. Sibson M. Ng H.K. Morley R. Manuelpillai U. et al.DNA methylation-mediated down-regulation of DNA methylatransferase-1 (DNMT1), is co-incident with, but not essential for, global hypomethylation in human placenta.J Biol Chem. 2010; 285: 9583-9593Crossref PubMed Scopus (78) Google Scholar The resulting amplicons were then subjected to the EpiTYPER chemistry and analyzed by MALDI-TOF-MS. Methylation ratios (approximating percent cytosine methylation) were obtained by using EpiTYPER v1.0.5 software (Sequenom). Study populationThis study used samples collected as part of previously describedE1Prescott S.L. Noakes P. Chow B.W. Breckler L. Thornton C.A. Hollams E.M. et al.Presymptomatic differences in Toll-like receptor function in infants who have allergy.J Allergy Clin Immunol. 2008; 122 (e1-5): 391-399Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar longitudinal cohort studies, as approved by the Princess Margaret Hospital Ethics Committee. Briefly, healthy pregnant women aged ≥18 and ≤44 years were recruited from the private clinics of obstetricians in the Perth metropolitan area, Western Australia. Only healthy term pregnancies were included, and all women were nonsmokers. The women were recruited from 20 weeks’ gestation and reviewed regularly through their pregnancy and the postpartum period. Their infants were seen for allergy assessments and skin prick testing at 1 year of age (see below). This study used samples collected as part of previously describedE1Prescott S.L. Noakes P. Chow B.W. Breckler L. Thornton C.A. Hollams E.M. et al.Presymptomatic differences in Toll-like receptor function in infants who have allergy.J Allergy Clin Immunol. 2008; 122 (e1-5): 391-399Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar longitudinal cohort studies, as approved by the Princess Margaret Hospital Ethics Committee. Briefly, healthy pregnant women aged ≥18 and ≤44 years were recruited from the private clinics of obstetricians in the Perth metropolitan area, Western Australia. Only healthy term pregnancies were included, and all women were nonsmokers. The women were recruited from 20 weeks’ gestation and reviewed regularly through their pregnancy and the postpartum period. Their infants were seen for allergy assessments and skin prick testing at 1 year of age (see below). Definitions of allergyMaternal allergy was defined as a doctor-diagnosed clinical history of asthma, eczema, o" @default.
• W1964805211 created "2016-06-24" @default.
• W1964805211 creator A5000586422 @default.
• W1964805211 creator A5012278169 @default.
• W1964805211 creator A5052607804 @default.
• W1964805211 creator A5066136808 @default.
• W1964805211 creator A5074757293 @default.
• W1964805211 creator A5077492180 @default.
• W1964805211 creator A5077815835 @default.
• W1964805211 creator A5082673477 @default.
• W1964805211 creator A5090518842 @default.
• W1964805211 creator A5091841727 @default.
• W1964805211 date "2011-10-01" @default.
• W1964805211 modified "2023-09-23" @default.
• W1964805211 title "Reduced placental FOXP3 associated with subsequent infant allergic disease" @default.
• W1964805211 cites W1609897609 @default.
• W1964805211 cites W1635103958 @default.
• W1964805211 cites W2018020394 @default.
• W1964805211 cites W2028514728 @default.
• W1964805211 cites W2039062116 @default.
• W1964805211 cites W2078602536 @default.
• W1964805211 cites W2098362718 @default.
• W1964805211 cites W2128224497 @default.
• W1964805211 cites W2139122477 @default.
• W1964805211 cites W2147108540 @default.
• W1964805211 cites W2152566369 @default.
• W1964805211 cites W2156725174 @default.
• W1964805211 cites W2167421410 @default.
• W1964805211 cites W4242814566 @default.
• W1964805211 doi "https://doi.org/10.1016/j.jaci.2011.05.017" @default.
• W1964805211 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21719077" @default.
• W1964805211 hasPublicationYear "2011" @default.
• W1964805211 type Work @default.
• W1964805211 sameAs 1964805211 @default.
• W1964805211 citedByCount "20" @default.
• W1964805211 countsByYear W19648052112012 @default.
• W1964805211 countsByYear W19648052112013 @default.
• W1964805211 countsByYear W19648052112014 @default.
• W1964805211 countsByYear W19648052112015 @default.
• W1964805211 countsByYear W19648052112016 @default.
• W1964805211 countsByYear W19648052112017 @default.
• W1964805211 countsByYear W19648052112018 @default.
• W1964805211 countsByYear W19648052112019 @default.
• W1964805211 countsByYear W19648052112021 @default.
• W1964805211 countsByYear W19648052112022 @default.
• W1964805211 crossrefType "journal-article" @default.
• W1964805211 hasAuthorship W1964805211A5000586422 @default.
• W1964805211 hasAuthorship W1964805211A5012278169 @default.
• W1964805211 hasAuthorship W1964805211A5052607804 @default.
• W1964805211 hasAuthorship W1964805211A5066136808 @default.
• W1964805211 hasAuthorship W1964805211A5074757293 @default.
• W1964805211 hasAuthorship W1964805211A5077492180 @default.
• W1964805211 hasAuthorship W1964805211A5077815835 @default.
• W1964805211 hasAuthorship W1964805211A5082673477 @default.
• W1964805211 hasAuthorship W1964805211A5090518842 @default.
• W1964805211 hasAuthorship W1964805211A5091841727 @default.
• W1964805211 hasBestOaLocation W19648052111 @default.
• W1964805211 hasConcept C126322002 @default.
• W1964805211 hasConcept C203014093 @default.
• W1964805211 hasConcept C2779134260 @default.
• W1964805211 hasConcept C71924100 @default.
• W1964805211 hasConceptScore W1964805211C126322002 @default.
• W1964805211 hasConceptScore W1964805211C203014093 @default.
• W1964805211 hasConceptScore W1964805211C2779134260 @default.
• W1964805211 hasConceptScore W1964805211C71924100 @default.
• W1964805211 hasIssue "4" @default.
• W1964805211 hasLocation W19648052111 @default.
• W1964805211 hasLocation W19648052112 @default.
• W1964805211 hasOpenAccess W1964805211 @default.
• W1964805211 hasPrimaryLocation W19648052111 @default.
• W1964805211 hasRelatedWork W1506200166 @default.
• W1964805211 hasRelatedWork W1972654344 @default.
• W1964805211 hasRelatedWork W1995515455 @default.
• W1964805211 hasRelatedWork W2080531066 @default.
• W1964805211 hasRelatedWork W2748952813 @default.
• W1964805211 hasRelatedWork W2899084033 @default.
• W1964805211 hasRelatedWork W3031052312 @default.
• W1964805211 hasRelatedWork W3032375762 @default.
• W1964805211 hasRelatedWork W3108674512 @default.
• W1964805211 hasRelatedWork W3205022660 @default.
• W1964805211 hasVolume "128" @default.
• W1964805211 isParatext "false" @default.
• W1964805211 isRetracted "false" @default.
• W1964805211 magId "1964805211" @default.
• W1964805211 workType "article" @default.