FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1965475055> ?p ?o ?g. }

• W1965475055 endingPage "38078" @default.
• W1965475055 startingPage "38072" @default.
• W1965475055 abstract "PDE3A cyclic nucleotide phosphodiesterases regulate cAMP- and cGMP-mediated intracellular signaling in cardiac myocytes. We used antibodies to different regions of PDE3A to demonstrate the presence of three PDE3A isoforms in these cells. These isoforms, whose apparent molecular weights are 136,000, 118,000, and 94,000 (“PDE3A-136,” “PDE3A-118,” and “PDE3A-94”), are identical save for the deletion of different lengths of N-terminal sequence containing two membrane-association domains and sites for phosphorylation/activation by protein kinase B (“PK-B”) and protein kinase A (“PK-A”). PDE3A-136 contains both membrane-association domains and the PK-B and PK-A sites. PDE3A-118 contains only the downstream membrane-association domain and the PK-A sites. PDE3A-94 lacks both membrane localization domains and the PK-B and PK-A sites. The three isoforms are translated from two mRNAs derived from thePDE3A1 gene: PDE3A-136 is translated from PDE3A1 mRNA, whereas PDE3A-118 and PDE3A-94 are translated from PDE3A2 mRNA. Experiments involving in vitro transcription/translation indicate that PDE3A-118 and PDE3A-94 may be translated from different AUGs in PDE3A2 mRNA. These findings suggest that alternative transcriptional and post-transcriptional processing of thePDE3A gene results in the generation of two mRNAs and three protein isoforms in cardiac myocytes that differ with respect to intracellular localization and may be regulated through different signaling pathways. PDE3A cyclic nucleotide phosphodiesterases regulate cAMP- and cGMP-mediated intracellular signaling in cardiac myocytes. We used antibodies to different regions of PDE3A to demonstrate the presence of three PDE3A isoforms in these cells. These isoforms, whose apparent molecular weights are 136,000, 118,000, and 94,000 (“PDE3A-136,” “PDE3A-118,” and “PDE3A-94”), are identical save for the deletion of different lengths of N-terminal sequence containing two membrane-association domains and sites for phosphorylation/activation by protein kinase B (“PK-B”) and protein kinase A (“PK-A”). PDE3A-136 contains both membrane-association domains and the PK-B and PK-A sites. PDE3A-118 contains only the downstream membrane-association domain and the PK-A sites. PDE3A-94 lacks both membrane localization domains and the PK-B and PK-A sites. The three isoforms are translated from two mRNAs derived from thePDE3A1 gene: PDE3A-136 is translated from PDE3A1 mRNA, whereas PDE3A-118 and PDE3A-94 are translated from PDE3A2 mRNA. Experiments involving in vitro transcription/translation indicate that PDE3A-118 and PDE3A-94 may be translated from different AUGs in PDE3A2 mRNA. These findings suggest that alternative transcriptional and post-transcriptional processing of thePDE3A gene results in the generation of two mRNAs and three protein isoforms in cardiac myocytes that differ with respect to intracellular localization and may be regulated through different signaling pathways. open reading frame amino acid(s) nucleotide(s) 5′ rapid amplification of cDNA ends PDE3 cyclic nucleotide phosphodiesterases bind cAMP and cGMP with high affinity and hydrolyze both substrates in a mutually competitive manner (1Shakur Y. Holst L.S. Landstrom T.R. Movsesian M.A. Degerman E. Manganiello V. Prog. Nucleic Acids Res. Mol. Biol. 2000; 66: 241-277Crossref Google Scholar). Two PDE3 genes have been discovered: PDE3A is expressed primarily in cardiac and vascular myocytes and platelets, whereas PDE3B is expressed primarily in adipocytes, hepatocytes, and pancreatic cells (2Reinhardt R.R. Chin E. Zhou J. Taira M. Murata T. Manganiello V.C. Bondy C.A. J. Clin. Invest. 1995; 95: 1528-1538Crossref PubMed Scopus (153) Google Scholar). The functional topographies of the proteins corresponding to the longest ORFs1 of PDE3A and PDE3B cDNAs are similar and include a C-terminal catalytic region (“CCR”) of ≈280 amino acids and two N-terminal hydrophobic regions (“NHRs”) that are involved in intracellular targeting (Fig.1). NHR1 (aa ≈60–255) contains transmembrane helices, whereas NHR2 (aa ≈340–400) appears to be involved in the binding of PDE3 to as yet unidentified membrane proteins. rtPDE3As containing NHR1 localize exclusively to intracellular membranes in transfected cells, whereas rtPDE3As containing NHR2 but not NHR1 are found in both the cytosol and intracellular membranes of transfected cells (3Kenan Y. Murata T. Shakur Y. Degerman E. Manganiello V.C. J. Biol. Chem. 2000; 275: 12331-12338Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 4Shakur Y. Takeda K. Kenan Y., Yu, Z.X. Rena G. Brandt D. Houslay M.D. Degerman E. Ferrans V.J. Manganiello V.C. J. Biol. Chem. 2000; 49: 38749-38761Abstract Full Text Full Text PDF Scopus (97) Google Scholar). Between NHR1 and NHR2 are sites for phosphorylation and activation by PK-B (site “P1,” Ser292 in PDE3A ORF) and PK-A (site “P2,” Ser312) (5Rahn T. Rönnstrand L. Leroy M.J. Wernstedt C. Tornqvist H. Manganiello V.C. Belfrage P. Degerman E. J. Biol. Chem. 1996; 271: 11575-11580Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 6Rondinone C.M. Carvalho E. Rahn T. Manganiello V.C. Degerman E. Smith U.P. J. Biol. Chem. 2000; 275: 10093-10098Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 7Kitamura T. Kitamura Y. Kuroda S. Hino Y. Ando M. Kotani K. Konishi H. Matsuzaki H. Kikkawa U. Ogawa W. Kasuga M. Mol. Cell. Biol. 1999; 19: 6286-6296Crossref PubMed Scopus (311) Google Scholar). A second PK-A site whose function is unclear (site “P3,” Ser438) lies between NHR2 and CCR (8Rascón A. Degerman E. Taira M. Meacci E. Smith C.J. Manganiello V. Belfrage P. Tornqvist H. J. Biol. Chem. 1994; 269: 11962-11966Abstract Full Text PDF PubMed Google Scholar). Phosphorylation of PDE3 by PK-B and PK-A and the accompanying stimulation of catalytic activity are important in the physiologic responses of adipocytes, oocytes, promyeloid cells, and platelets to a variety of extracellular signals (9Zhao A.Z. Bornfeldt K.E. Beavo J.A. J. Clin. Invest. 1998; 102: 869-873Crossref PubMed Scopus (215) Google Scholar, 10Smith C.J. Vasta V. Degerman E. Belfrage P. Manganiello V.C. J. Biol. Chem. 1991; 266: 13385-13390Abstract Full Text PDF PubMed Google Scholar, 11Ahmad F. Cong L.I. Holst L.S. Wang L.M. Landstrom T.R. Pierce J.H. Quon M.J. Degerman E. Manganiello V.C. J. Immunol. 2000; 164: 4678-4688Crossref PubMed Scopus (57) Google Scholar, 12Grant P.G. Mannarino A.F. Colman R.W. Proc. Natl. Acad. Sci. U. S. A. 1998; 85: 9071-9075Crossref Scopus (61) Google Scholar, 13Lopez-Aparicio P. Belfrage P. Manganiello V.C. Kono T. Degerman E. Biochem. Biophys. Res. Commun. 1993; 193: 1137-1144Crossref PubMed Scopus (30) Google Scholar). PDE3 is particularly important in the cardiovascular system. PDE3 inhibitors (e.g. milrinone and enoximone) have inotropic effects attributable to the elevation of cAMP content in cardiac myocytes and vasodilatory effects attributable to the elevation of cAMP and/or cGMP content in vascular myocytes, and have been used to augment contractility and reduce afterload in patients with dilated cardiomyopathy (14Movsesian M.A. J. Am. Coll. Cardiol. 1999; 34: 318-324Crossref PubMed Scopus (58) Google Scholar). Whereas the use of these drugs results in hemodynamic benefits in the short term, long-term use increases mortality. These biphasic actions probably reflect the broad range of proteins phosphorylated by PK-A in cardiac myocytes and the diverse cellular responses that are elicited. Our previous studies indicated that multiple isoforms of PDE3A are present in cardiac and vascular myocytes and are localized to different intracellular compartments. One protein, with an apparent molecular weight (“M r”) of ≈136,000, was recovered exclusively in microsomal fractions; the other two, with lower molecular weights, were present in both cytosolic and microsomal fractions (15Smith C.J. Krall J. Manganiello V.C. Movsesian M.A. Biochem. Biophys. Res. Commun. 1993; 190: 516-521Crossref PubMed Scopus (49) Google Scholar). We subsequently identified two PDE3A mRNAs in cardiac and vascular myocytes: PDE3A1, whose cDNA was cloned from myocardium, contains an ORF of 1141 nt. PDE3A2, whose cDNA was cloned from aortic myocytes, shares the sequence of PDE3A1 starting ≈300 nt downstream from the latter's start site but lacks the sequence upstream of this site (16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar). The PDE3A isoform translated from PDE3A2 in vascular myocytes had an apparent M rof only ≈118,000, comparable with one of the lower molecular weight bands identified in human myocardium. The 136,000-M r PDE3 band was not present in cultured aortic myocytes. The presence of different PDE3A isoforms in cytosolic and microsomal fractions of cardiac myocytes is especially interesting in view of the facts that cAMP metabolism in these compartments can be regulated with some independence in cardiac muscle and that changes in cAMP content in these compartments have different effects on intracellular Ca2+ homeostasis and contractility (17Hayes J.S. Brunton L.L. Mayer S.E. J. Biol. Chem. 1980; 255: 5113-5119Abstract Full Text PDF PubMed Google Scholar, 18Xiao R.P. Lakatta E.G. Circ. Res. 1993; 73: 286-300Crossref PubMed Scopus (209) Google Scholar, 19Xiao R.P. Hohl C. Altschuld R. Jones L. Livingston B. Ziman B. Tantini B. Lakatta E.G. J. Biol. Chem. 1994; 269: 19151-19156Abstract Full Text PDF PubMed Google Scholar). In the experiments described below, we have identified three PDE3A isoforms in subcellular fractions of cardiac myocytes whose N-terminal amino acid sequence differences suggest that they differ with respect to mechanisms of intracellular targeting and that their activities may be regulated via different signaling pathways. A human myocardial PDE3A construct was generated by inserting an 8-amino acid Flag epitope (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) immediately upstream from the stop codon of the PDE3A1. Using 50 ng of PDE3A1 cDNA (20Meacci E. Taira M. Moos Jr., M. Smith C.J. Movsesian M.A. Degerman E. Belfrage P. Manganiello V.C. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 3721-3725Crossref PubMed Scopus (146) Google Scholar) as template (GenBankTM accession number NM_000921), PCR amplification was performed in a GeneAmp PCR system (PerkinElmer Life Sciences, Wellesley, MA) with Pfu polymerase (Stratagene, La Jolla, CA) using 3 pmol each of sense primer, CTTCATCTCTCACATTGTGGGGCCTCTGTG, corresponding nt 3009–3027 of the PDE3A1 ORF, and antisense primer, TTTGCGGCCGCCTCGAGTTATTTATCATCATCATCTTTATAATCCTGGTCTGGCTTTTGGGTTGG, corresponding to nt 3423–3403 and the FLAG epitope. The resulting PCR product contained the unique PDE3 DraIII site at the 5′ end and a stop codon at the 3′ end; the stop codon is flanked upstream by a FLAG epitope-coding sequence and downstream by anXhoI site. The PCR products were subcloned into the pCRII vector (Invitrogen) and isolated from this vector asDraIII/XhoI fragments.XhoI/DraIII fragments containing the ORF sequence of PDE3A1 upstream from the unique DraIII site were restricted from pBluescript. In a three-way ligation, these 5′XhoI/DraIII fragments were ligated via theDraIII site to the 3′ DraIII/XhoI FLAG epitope-containing fragments and to XhoI-cut pZero vector (Invitrogen), to give PDE3A1 Flag-pZero. PDE3A1-Flag was then excised from pZero with XhoI, ligated into pAcSG2 vector, subcloned, and amplified. PDE3A1-Flag-pAcSG2 plasmid (2 μg) was co-transfected with linearized BaculoGold DNA into Sf21 cells (BaculoGold transfection kit; Pharmingen, San Diego, CA). After 5 days, fresh Sf21 cells, (10Smith C.J. Vasta V. Degerman E. Belfrage P. Manganiello V.C. J. Biol. Chem. 1991; 266: 13385-13390Abstract Full Text PDF PubMed Google Scholar, 11Ahmad F. Cong L.I. Holst L.S. Wang L.M. Landstrom T.R. Pierce J.H. Quon M.J. Degerman E. Manganiello V.C. J. Immunol. 2000; 164: 4678-4688Crossref PubMed Scopus (57) Google Scholar, 12Grant P.G. Mannarino A.F. Colman R.W. Proc. Natl. Acad. Sci. U. S. A. 1998; 85: 9071-9075Crossref Scopus (61) Google Scholar, 13Lopez-Aparicio P. Belfrage P. Manganiello V.C. Kono T. Degerman E. Biochem. Biophys. Res. Commun. 1993; 193: 1137-1144Crossref PubMed Scopus (30) Google Scholar, 14Movsesian M.A. J. Am. Coll. Cardiol. 1999; 34: 318-324Crossref PubMed Scopus (58) Google Scholar, 15Smith C.J. Krall J. Manganiello V.C. Movsesian M.A. Biochem. Biophys. Res. Commun. 1993; 190: 516-521Crossref PubMed Scopus (49) Google Scholar, 16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar, 17Hayes J.S. Brunton L.L. Mayer S.E. J. Biol. Chem. 1980; 255: 5113-5119Abstract Full Text PDF PubMed Google Scholar, 18Xiao R.P. Lakatta E.G. Circ. Res. 1993; 73: 286-300Crossref PubMed Scopus (209) Google Scholar, 19Xiao R.P. Hohl C. Altschuld R. Jones L. Livingston B. Ziman B. Tantini B. Lakatta E.G. J. Biol. Chem. 1994; 269: 19151-19156Abstract Full Text PDF PubMed Google Scholar, 20Meacci E. Taira M. Moos Jr., M. Smith C.J. Movsesian M.A. Degerman E. Belfrage P. Manganiello V.C. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 3721-3725Crossref PubMed Scopus (146) Google Scholar) × 106 cells/75-cm2 flask, grown in TNM-FH medium (Pharmingen, San Diego, CA), were infected with medium containing PDE3A1-Flag baculovirus. For amplification, 100–500 μl of medium was collected after 72–96 h and used to infect fresh cultures, after which viral titers were determined by a 12-well end point dilution assay according to the manufacturer's instructions. Cells from 75 cm2 flasks, usually 10–20 × 106 cells per flask, were sedimented for 10 min at 1000 × g, washed twice with ice-cold phosphate-buffered saline, and resuspended in 10 mmHEPES, 1 mm EDTA, 250 mm sucrose, 10 mm pyrophosphate, 5 mm NaF, 1 mmphenylmethylsulfonyl fluoride, 1 mm sodium orthovanadate, 1% Nonidet P-40, and 10 μg/ml each of aprotinin, leupeptin, and pepstatin. Lysates were prepared by sonication on ice (two 20-s pulses, output 2, 40% of cycle) with a Sonifier cell disruptor 350 (Branson Sonic Power, Danbury, CT). Lysates were sedimented for 10 min at 12,000 × g; supernatant fractions were used for Western blotting. Cytosolic and KCl-washed microsomal fractions, from the left ventricular myocardium of the explanted hearts of cardiac transplant recipients with idiopathic dilated cardiomyopathy, were prepared by homogenization, differential sedimentation, and high-salt washing as described previously (21Krall J. Taskén K. Staheli J. Jahnsen T. Movsesian M.A. J. Mol. Cell. Cardiol. 1999; 31: 971-980Abstract Full Text PDF PubMed Scopus (8) Google Scholar). Each preparation was made from tissue pooled from at least three different hearts. Comparable fractions of cultured human aortic myocytes (Clonetics, seventh passage) were prepared as described previously (16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar). Lysates of Sf21 cells expressing rtPDE3A1 and subcellular fractions of human myocardium and aortic myocytes were precipitated with trichloroacetic acid (final concentration 50%), dissolved in SDS buffer, subjected to SDS-PAGE (8% acrylamide), and transferred electrophoretically to nitrocellulose membranes (Schleicher & Schuell). Western blotting was performed with antibodies that were raised against peptides corresponding to aa 29–42, 424–460, and 1125–1141 of the ORF of PDE3A1 as described previously (16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar). The entire coding region of PDE3A1 cDNA was inserted into pBluescript as previously described (16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar). In addition, a plasmid with an ATGATG to CTGCTG mutation (Met-Met → Leu-Leu) at nt 1450–1455 was generated by PCR using QuikChange site-directed mutagenesis (Stratagene); the primers used for mutagenesis were 5′-GGAATAATCCAGTGCTGCTGACCCTCACCAAAAGCAGATCC-3′ (sense) and its complementary antisense primer (corresponding to nt 1436–1476 of the PDE3A1 ORF). After amplification inEscherichia coli (XL1-Blue), mutated plasmids were purified using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA) and sequenced. PCR products with different 5′ deletions were generated from the wild-type and mutated pBluescript-PDE3A1 plasmids using five sense primers containing T7 promoter sites immediately upstream from gene-specific sequences and an antisense primer containing the stop codon and a poly(A) tail (Table I).In vitro translation products were synthesized from the PCR fragment templates and labeled with 4 μCi of [35S]methionine (1000 Ci/mmol) in reticulocyte lysates using the TnT T7 Quick for PCR DNA system (Promega).Table IPCR primers used for in vitro transcription and translationIsoform start siteSense primer location (PDE3A1 ORF)Primer sequence (5′–3′)ATG1(−)22–7TAATACGACTCACTATAGGGAGTGAA GAGGGCACCCTATACCATGGCAGATG2409–438TAATACGACTCACTATAGGGTTCAGT CTCCTGTGTGCCTTCTTCTGGATGATG3511–537TAATACGACTCACTATAGGGGAAGCG CTCGTCCAGATTGGGCTGGGCATG4706–732TAATACGACTCACTATAGGGTGGAGA CCTTACCTGGCGTACCTGGCCATG7/81401–1427TAATACGACTCACTATAGGGACTGCA GGAAGCACCTTCATCCAGTCCThe T7 promoter sequence is shown in italics. Numbers correspond to the nucleotide of the PDE3A1 coding region; negative numbers represent the 5′-untranslated region. A common antisense primer, TTTTTTTTTTTTTTTTTTTTTCACTGGTCTGGCTTTTGGGTTGGTAT, corresponding to nt 3400–3426, was used in all cases. Open table in a new tab The T7 promoter sequence is shown in italics. Numbers correspond to the nucleotide of the PDE3A1 coding region; negative numbers represent the 5′-untranslated region. A common antisense primer, TTTTTTTTTTTTTTTTTTTTTCACTGGTCTGGCTTTTGGGTTGGTAT, corresponding to nt 3400–3426, was used in all cases. PCR amplification was performed on Marathon RACE-Ready cDNA from human myocardium (Clontech) using 1 pmol of gene-specific antisense primer and 1 pmol of sense primer corresponding to the 5′ end of the manufacturer's 5′ tag. A second round of PCR was performed for 35 cycles using 1 pmol of nested gene-specific primer and 1 pmol of nested sense primer corresponding to a second sequence within the manufacturer's tag. RACE products were purified on agarose gels and ligated into pCR2.1 vector with T4 ligase (14 °C, overnight) using a TA cloning kit (Invitrogen). Competent cells (INVαF′) were transformed using a One Shot Kit (Invitrogen) and plated on 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal) LB-ampicillin plates (100 μg/ml ampicillin). Positive colonies were grown overnight in LB-ampicillin medium. Plasmids were purified using the Mini- or Midiprep Plasmid purification systems (Qiagen) and inserts were excised with EcoRI. Insert sizes were estimated by electrophoresis through agarose gels. DNA probes were prepared from PDE3A1 plasmid by PCR using region-specific primers. PCR products were purified using QIA Quick kits (Qiagen). DNA was labeled with [α-32P]dCTP (3000 Ci/mmol, 10 mCi/ml) using a random primer labeling kit (Stratagene). Unincorporated nucleotides were removed using Sephadex G-50 (fine) columns (Roche Molecular Biochemicals). For Southern blotting, linear DNA corresponding to nt −268 to nt 2610 of PDE3A1 ORF was prepared from PDE3A1 template by PCR and purified as described above. The PCR product was quantified by measurement of theA 260/A 280 ratio and its purity confirmed by agarose gel electrophoresis. PCR product samples were subjected to electrophoresis on 0.7% agarose gels, transferred to Gene Screen Plus Nylon Membranes (PerkinElmer Life Sciences), cross-linked, and pre-hybridized for 2–3 h in QuikHyb (Stratagene). Labeled DNA probes were hybridized with DNA blots at 65 °C for 3–4 h using 1.25 × 106 cpm/ml of probe and 0.1 mg/ml salmon sperm DNA. Following hybridization, excess radiolabeled probe was removed by rinsing in SSC, 0.1% SDS and autoradiography was performed at −80 °C. For Northern blotting, RNA was extracted from human left ventricular myocardium from the excised hearts of transplant recipients with dilated cardiomyopathy using TRI reagent (Molecular Research Center, Cincinnati, OH). Poly(A) RNA was prepared from total RNA using a Message Maker kit (Invitrogen). RNA was quantified and its purify confirmed as described above. Poly(A) RNA samples were subjected to electrophoresis on 1% agarose, 0.5 m formaldehyde gels, transferred to GeneScreen Plus Nylon membranes, cross-linked, and pre-hybridized for 2–3 h in QuikHyb. Labeled DNA probes were hybridized with RNA blots, excess radiolabeled probe was removed, and autoradiography performed as described for Southern blotting. Polyclonal antibodies raised against synthetic peptides whose sequences correspond to selected regions of PDE3A1 ORF, including aa 29–42 (N-terminal, or “NT”), aa 424–460 (“MID”), and aa 1125–1141 (C-terminal, or “CT”), the extreme C terminus (16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar), were used for Western blotting of lysates of Sf21 cells expressing rtPDE3A1 and of cytosolic and microsomal fractions of human myocardium (Fig. 2). All three antibodies reacted with rtPDE3A1 bands in Sf21 lysates. Anti-CT reacted with proteins in cytosolic and microsomal fractions of human myocardium with apparent M r of 94,000 and 118,000 and with a protein with an apparent M r of 136,000 seen only in microsomal fractions. Anti-MID reacted with the 118- and 136-kDa proteins but not with the 94-kDa protein. Anti-PDE3-NT did not react with any protein bands in these fractions. The presence of multiple immunoreactive PDE3A bands might have resulted from the activation of tissue proteases during the preparation of subcellular fractions of human myocardium. To examine this possibility, we added 35S-labeled rtPDE3A to a fresh homogenate of human myocardium, prepared cytosolic and microsomal fractions, and subjected these fractions to SDS-PAGE. Autoradiograms showed the same35S-labeled proteins bands in tissue fractions as in original Sf21 lysates (Fig. 3), compatible with the notion that the three PDE3 bands identified in subcellular fractions of cardiac myocytes are not the result of proteolysis during the preparation of subcellular fractions. These results suggested that the isoforms of PDE3A in cardiac muscle, which we have designated PDE3A-136, PDE3A-118, and PDE3A-94, the numbers corresponding to their apparent M r on SDS-PAGE, all contain the same C-terminal amino acid sequences downstream of different N-terminal starting points. Unexpectedly, the N terminus predicted by the PDE3A1 ORF was absent from PDE3A-136, the longest PDE3A isoform we identified, despite the fact that the apparentM r of this isoform on SDS-PAGE is greater than the M r predicted by the amino acid sequence of the PDE3A1 ORF. To gain insight into this apparent discrepancy, we compared the migration of native PDE3 isoforms on SDS-PAGE to the migration of rtPDE3As generated by in vitrotranscription/translation from constructs with 5′ deletions designed to result in translation from different in-frame AUGs (Fig.4). All rtPDE3A isoforms migrated with apparent M r ∼20,000 higher than predicted by their amino acid sequences. The apparent M r of PDE3A-136 (lane 6) was slightly higher than the apparentM r of 131,000 for the rtPDE3A translated from AUG2 in the PDE3A1 ORF (lane 2), implying that PDE3A-136 contains part of NHR1 (consistent with its recovery only in microsomal fractions), all of NHR2, and the sites for phosphorylation and activation by PK-B and PK-A. The apparent M r of PDE3A-118 (lanes 7 and 8) was indistinguishable from that of the rtPDE3A translated from AUG4 (lane 4), implying that PDE3A-118 lacks NHR1 and the PK-B site but includes NHR2 and the PK-A sites. The apparent M r of PDE3A-94 (lanes 7 and 8) was slightly lower than the apparent M r of 95,000 for the rtPDE3A translated from AUG7/8 (lane 5), implying that PDE3A-94 contains neither of the membrane-association domains nor any of the three phosphorylation sites. The absence of NHR1 from PDE3A-118, the isoform we originally identified in vascular myocytes, contradicts our predicted amino acid sequence for this isoform, which included NHR1 (16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar). This earlier prediction was based on the assumption that the apparent molecular weights of PDE3s on SDS-PAGE correspond to the molecular weights derived from their amino acid sequences, which our current results demonstrate to be incorrect. The absence of NHR1 from PDE3A-118 is consistent with its presence in both cytosolic and microsomal fractions. In addition to the higher molecular weight bands discussed above, transcription/translation in vitro from every rtPDE3A construct generated a rtPDE3A isoform with an apparentM r of 95,000, similar to that of the AUG7/8 translation product. To examine the possibility that this 95,000M r rtPDE3A might be generated from larger constructs by translation from AUG7/8, we prepared a construct starting from ATG1 in which ATG7/8 was mutated to CTGCTG (Met-Met → Leu-Leu). Expression of the mutated construct resulted in the disappearance of the 95,000 M r rtPDE3A (Fig.5), consistent with its generation from the longer mRNA by translation from AUG7/8. We turned our attention to identifying the mRNAs from which these three PDE3A protein isoforms are translated. Our previous studies (16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar) had shown that a PDE3A2 mRNA, whose sequence is identical to that of the PDE3A1 cDNA downstream of nt ≈300 in the latter's ORF but which lacks the latter's upstream sequence, is present in both cardiac and vascular myocytes, although PDE3A1 mRNA is present in cardiac but not in vascular myocytes. Whether PDE3A2 mRNA contained an alternative 5′ sequence upstream of nt ≈300 remained unknown. To search for any such sequence, we performed 5′-RACE of a human myocardial cDNA library using three pairs of antisense primers derived from the shared sequence of PDE3A1 and PDE3A2 (TableII). Subcloning and sequencing of multiple 5′-RACE products yielded no alternative upstream sequence. These results are similar to those obtained when 5′-RACE was performed with comparable primers in a human aortic cDNA library (16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar).Table IIGene-specific antisense primers used for 5′-RACERound 1Round 2 (nested)Pair No. 1Sequence (5′–3′)ATCCATGACAAGAGGTTCGGGAGCTGAGGAGCAGGGCGATGAAAGAGGTGACorresponds to nt2017–20401558–1584Pair No. 2Sequence (5′–3′)TGAGGAGCAGGGCGATGAAAGAGGTGAGGTGGTGGTCCAAGTGGAAGAAACTCGCorresponds to nt1558–15841306–1332Pair No. 3Sequence (5′–3′)CCAGGCGACCTTGAACCTCTCTAAGCCCAGCCCAATCTGGACGAGCGCTTCCorresponds to nt685–708511–537 Open table in a new tab We proceeded to perform Northern blotting on poly(A) RNA from human left ventricular myocardium using probes derived from different regions of the PDE3A1 ORF (Fig. 6). Three cDNA probes were used. The first, derived from nt −268–189, corresponds to a region predicted to be present in PDE3A1 but not PDE3A2; the other two cDNA probes correspond to nt 517–957 and 2248–2610 of PDE3A1, regions predicted to be present in both PDE3A1 and PDE3A2. All three probes bound to an 8.2-kb band. The two downstream probes also bound to a 6.9-kb band to which the upstream probe did not bind. These results are consistent with the 8.2-kb band being PDE3A1 and the 6.9-kb band being PDE3A2. Their size differences can be accounted for by the absence of the first ≈300 nt of the ORF of PDE3A1 from PDE3A2, consistent with the generation of the latter by alternative transcription or splicing within exon 1. This absence of ≈300 nt of PDE3A1 in PDE3A2 was previously predicted by ribonuclease protection assays of RNA prepared from human myocardium and cultured human aortic myocytes with antisense probes spanning nt 208–537 and 2248–2610 of PDE3A1 (16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar). The fact that PDE3A1 mRNA and PDE3A-136 are present only in cardiac myocytes while PDE3A2 mRNA and PDE3A-118 and PDE3A-94 are present in both cardiac and vascular myocytes is consistent with PDE3A1 mRNA giving rise to PDE3A-136 and PDE3A2 mRNA giving rise to both PDE3A-118 and PDE3A-94 (Fig.7).Figure 7Hypothesis for generation of cardiac and aortic isoforms of PDE3A. PDE3A1 and PDE3A2 mRNAs are generated by alternative transcription. Exons of the PDE3Agene are depicted at the top. Transcription from alternative sites or alternative mRNA splicing yields PDE3A1 mRNA in cardiac myocytes and PDE3A2 mRNA in cardiac and aortic myocytes. PDE3A-136 is translated from PDE3A1; PDE3A-118 and PDE3A-94 are translated from alternative sites in PDE3A2. Numbers in “mRNA” refer to AUGs.View Large Image Figure ViewerDownload Hi-res image Download (PPT) An important feature of cAMP-mediated signaling in cardiac myocytes is its intracellular compartmentation. cAMP content in cytosolic and microsomal fractions of cardiac myocytes is affected differently depending on whether cAMP formation is stimulated via β1-adrenergic, β2-adrenergic, or PGE1 receptor agonists. These compartment-selective changes in cAMP content are accompanied by different effects on the phosphorylation of individual substrates of PK-A, intracellular Ca2+homeostasis, and contractility (17Hayes J.S. Brunton L.L. Mayer S.E. J. Biol. Chem. 1980; 255: 5113-5119Abstract Full Text PDF PubMed Google Scholar, 18Xiao R.P. Lakatta E.G. Circ. Res. 1993; 73: 286-300Crossref PubMed Scopus (209) Google Scholar, 19Xiao R.P. Hohl C. Altschuld R. Jones L. Livingston B. Ziman B. Tantini B. Lakatta E.G. J. Biol. Chem. 1994; 269: 19151-19156Abstract Full Text PDF PubMed Google Scholar). In addition, increases in the phosphorylation of different PK-A substrates occur when intracellular cAMP content is increased by phosphodiesterase inhibition rather than by stimulation of adenylate cyclase activity, and different cellular responses are elicited (22Rapundalo S.T. Solaro R.J. Kranias E.G. Circulation Res. 1989; 64: 104-111Crossref PubMed Scopus (115) Google Scholar, 23Jurevicius J. Fischmeister R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 295-299Crossref PubMed Scopus (308) Google Scholar). This compartmentation of cAMP-mediated signaling is involved in the pathophysiology of dilated cardiomyopathy, where the reduction in cAMP content in failing myocardium is far greater in microsomal fractions than in cytosolic fractions (24Böhm M. Reiger B. Schwinger R.H.G. Erdmann E. Cardiovasc. Res. 1994; 28: 1713-1719Crossref PubMed Scopus (116) Google Scholar). Recent studies demonstrating differences in the spatial distribution of subtypes of β-adrenergic receptors in cardiac myocyte membranes have offered one mechanism through which compartment-selective regulation may occur (25Rybin V.O., Xu, X. Lisanti M.P. Steinberg S.F. J. Biol. Chem. 2000; 275: 41447-41457Abstract Full Text Full Text PDF PubMed Scopus (465) Google Scholar). Our identification of three isoforms of PDE3A with N-terminal differences involving membrane-association domains and sites for phosphorylation by activating protein kinases in cardiac myocytes offers an additional mechanism, for it suggests that these isoforms are likely to regulate cAMP content in functionally distinct intracellular compartments, and hence to regulate the phosphorylation of different substrates of PK-A, in response to different upstream signals. Our findings may have important ramifications regarding the therapy of dilated cardiomyopathy, in which competitive inhibitors of PDE3 confer short term hemodynamic benefits but adversely affect long term survival (14Movsesian M.A. J. Am. Coll. Cardiol. 1999; 34: 318-324Crossref PubMed Scopus (58) Google Scholar). This biphasic response is likely to result from an increase in the phosphorylation of a large number of PK-A substrates, some of which may contribute to the beneficial effects whereas others contribute to the adverse effects. Phosphorylation of phospholamban, for example, relieves its inhibition of SERCA2, the Ca2+-transporting ATPase of the sarcoplasmic reticulum (26Simmerman H.K. Jones L.R. Physiol. Rev. 1998; 78: 921-947Crossref PubMed Scopus (467) Google Scholar, 27Fentzke R.C. Korcarz C.E. Lang R.M. Lin H. Leiden M. J. Clin. Invest. 1998; 101: 2415-2426Crossref PubMed Scopus (216) Google Scholar). Ablation of phospholamban in cardiac myocytes of MLP−/−mice with dilated cardiomyopathy restores normal chamber size and contractility, whereas decreasing phospholamban expression in myocytes from failing hearts improves contractility (28Minamisawa S. Hoshijima M. Chu G. Ward C.A. Frank K., Gu, Y. Martone M.E. Wang Y. Ross Jr., J. Kranias E.G. Giles W.R. Chien K.R. Cell. 1999; 99: 313-322Abstract Full Text Full Text PDF PubMed Scopus (437) Google Scholar, 29del Monte F. Harding S.E. Dec G.W. Gwathmey J.K. Hajjar R.J. Circulation. 2002; 105: 904-907Crossref PubMed Scopus (249) Google Scholar). These observations suggest that increased phosphorylation of phospholamban is beneficial. In contrast, phosphorylation of L-type Ca2+ channels increases their open probability and may be arrhythmogenic (30Fischmeister R. Hartzell H.C. Mol. Pharmacol. 1990; 38: 426-433PubMed Google Scholar), whereas phosphorylation of proteins in the mitogen-activated protein kinase cascade may alter myocardial gene transcription so as to speed the progression of the disease (31Lazou A. Bogoyevitch M.A. Clerk A. Fuller S.J. Marshall C.J. Sugden P.H. Circulation Res. 1994; 75: 932-941Crossref PubMed Scopus (85) Google Scholar). If different isoforms of PDE3A regulate the phosphorylation of different proteins in response to different signals, the beneficial and adverse effects of PDE3 inhibition may result from the inhibition of different PDE3A isoforms. A logical corollary is that agents capable of selectively activating or inhibiting individual PDE3 isoforms may have advantages over currently available nonselective PDE3 inhibitors in therapeutic applications. An agent that selectively inhibits sarcoplasmic reticulum-associated PDE3A-136, for example, might preserve intracellular Ca2+cycling and contractility in patients taking β-adrenergic receptor antagonists, without concomitant arrhythmogenic effects. On the other hand, PDE3A-136 is the only isoform containing the site for phosphorylation and activation by PK-B, an anti-apoptotic effector in cardiac myocytes (32Fujio Y. Nguyen T. Wencker D. Kitsis R.N. Walsh K. Circulation. 2000; 101: 660-667Crossref PubMed Scopus (738) Google Scholar, 33Wu W. Lee W.L., Wu, Y.Y. Chen D. Liu T.J. Jang A. Sharma P.M. Wang P.H. J. Biol. Chem. 2000; 275: 40113-40119Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar, 34Matsui T., Li, L. del Monte F. Fukui Y. Franke T.F Hajjar R.J. Rosenzweig A. Circulation. 1999; 100: 2373-2379Crossref PubMed Scopus (339) Google Scholar). The phosphorylation and stimulation of PDE3A-136 by PK-B may therefore be an anti-apoptotic event, and deleterious long term effects of PDE3 inhibition in dilated cardiomyopathy might be related specifically to inhibition of this isoform. If so, selective PDE3A-136 activators might be useful therapeutic agents. Experiments designed to identify the specific PK-A substrates whose phosphorylation is regulated by individual PDE3A isoforms are a logical next step in extending our observations. At a more basic level, our observations regarding the two PDE3A mRNAs in cardiac and vascular myocytes and the N-terminal deletions in the three PDE3A protein isoforms indicate that the specific mechanisms by which the latter are generated from their cognate mRNAs are complex. PDE3A-136 migrates on SDS-PAGE with an apparent molecular weight higher than that of the rtPDE3A generated from ATG2 but lower than that of the rtPDE3A generated from ATG1. PDE3A-136 may therefore be generated from PDE3A1 either by translation from AUG1 followed by targeted N-terminal proteolysis or by translation from AUG2 followed by some post-translational modification that reduces its electrophoretic mobility. Similarly, PDE3A-118 might be generated from PDE3A2 mRNA by translation from AUG4, the third AUG in the ORF predicted by the cloned cDNA (16Choi Y.-H. Ekholm D. Krall J. Ahmad F. Degerman E. Manganiello V.C. Movsesian M.A. Biochem. J. 2001; 353: 41-50Crossref PubMed Scopus (0) Google Scholar), or by translation from AUG2 or AUG3 followed by targeted N-terminal proteolysis, whereas PDE3A-94 could be generated from PDE3A2 mRNA either by translation from AUG7/8 or by translation from a more upstream AUG followed by proteolytic removal of a more extensive length of N-terminal sequence. The possibility that PDE3A-118 and PDE3A-94 are generated from the same mRNA by alternative translational processing in vivoseems plausible given our observation that a PDE3A-94-like protein is generated from longer constructs by translation from downstream AUGsin vitro. Furthermore, a paradigm exists in the case of the PDE4 family of cyclic nucleotide phosphodiesterases: these enzymes have structurally similar C-terminal catalytic regions, but differences in their N-terminal sequences resulting from alternative splicing result in differences in intracellular targeting, regulation by phosphorylation, and protein-protein interactions (35McPhee I. Yarwood S.J. Scotland G. Huston E. Beard M.B. Ross A.H. Houslay E.S. Houslay M.D. J. Biol. Chem. 1999; 274: 11796-11810Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 36Hoffmann R. Wilkinson I.R. McCallum J.F. Engels P. Houslay M.D. Biochem. J. 1998; 333: 139-149Crossref PubMed Scopus (142) Google Scholar, 37Hoffmann R. Baillie G.S. MacKenzie S.J. Yarwood S.J. Houslay M.D. EMBO J. 1999; 18: 893-903Crossref PubMed Scopus (228) Google Scholar, 38Liu H. Maurice D.M. J. Biol. Chem. 1999; 274: 10557-10565Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). On the other hand, proteolysis of the N terminus of PDE4A5 by caspase-3 during apoptosis removes an Src homology 3-binding domain and alters its intracellular distribution, and this example may be a paradigm for the generation of PDE3A isoforms by targeted proteolysis (39Huston E. Beard M. McCallum F. Pyne N.J. Vandenabeele P. Sotland G. Houslay M.D. J. Biol. Chem. 2000; 275: 28063-28074Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Other investigators have identified a protein resembling PDE3A-94 in placenta that is translated from a third PDE3A mRNA, PDE3A3, that is generated from the PDE3A gene by transcription from a site downstream from the PDE3A2 start site (40Kasuya J. Goko H. Fujita-Yamaguchi Y. J. Biol. Chem. 1995; 270: 14305-14312Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). Our data do not indicate that this mRNA, which is ∼4.4 kb in length, is present in cardiac myocytes. These considerations are of therapeutic interest because agents capable of altering the transcription or translation of individual PDE3A isoforms may have the same advantages as agents capable of selectively activating or inhibiting their activities. For this reason, further delineation of the transcriptional, translational, and/or post-translational mechanisms through which the generation of PDE3A mRNAs and proteins are regulated is an important future direction. We are indebted to Todd Peterson and Mary Scriven for assistance in preparing the figures and to Mark L. Entman and Feraydoon Niroomand for their advice." @default.
• W1965475055 created "2016-06-24" @default.
• W1965475055 creator A5017542878 @default.
• W1965475055 creator A5057050066 @default.
• W1965475055 creator A5061537205 @default.
• W1965475055 creator A5062027051 @default.
• W1965475055 creator A5072208105 @default.
• W1965475055 creator A5082311477 @default.
• W1965475055 date "2002-10-01" @default.
• W1965475055 modified "2023-10-18" @default.
• W1965475055 title "Isoforms of Cyclic Nucleotide Phosphodiesterase PDE3A in Cardiac Myocytes" @default.
• W1965475055 cites W1485952666 @default.
• W1965475055 cites W1554059014 @default.
• W1965475055 cites W1589589448 @default.
• W1965475055 cites W1738497100 @default.
• W1965475055 cites W1757478802 @default.
• W1965475055 cites W1814425117 @default.
• W1965475055 cites W1881785961 @default.
• W1965475055 cites W1963751073 @default.
• W1965475055 cites W1963851797 @default.
• W1965475055 cites W1982537841 @default.
• W1965475055 cites W1983372510 @default.
• W1965475055 cites W1989435471 @default.
• W1965475055 cites W1993171057 @default.
• W1965475055 cites W1996571204 @default.
• W1965475055 cites W2004169102 @default.
• W1965475055 cites W2006717125 @default.
• W1965475055 cites W2012755089 @default.
• W1965475055 cites W2013039234 @default.
• W1965475055 cites W2018426463 @default.
• W1965475055 cites W2022642767 @default.
• W1965475055 cites W2048327066 @default.
• W1965475055 cites W2048867275 @default.
• W1965475055 cites W2049143026 @default.
• W1965475055 cites W2057534786 @default.
• W1965475055 cites W2080477342 @default.
• W1965475055 cites W2085847022 @default.
• W1965475055 cites W2114497687 @default.
• W1965475055 cites W2117290383 @default.
• W1965475055 cites W2117487814 @default.
• W1965475055 cites W2121430531 @default.
• W1965475055 cites W2131642914 @default.
• W1965475055 cites W2142889758 @default.
• W1965475055 cites W2147410890 @default.
• W1965475055 cites W2158574592 @default.
• W1965475055 cites W2164323243 @default.
• W1965475055 cites W2165286550 @default.
• W1965475055 cites W2166076256 @default.
• W1965475055 cites W2402700043 @default.
• W1965475055 cites W58055601 @default.
• W1965475055 doi "https://doi.org/10.1074/jbc.m203647200" @default.
• W1965475055 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12154085" @default.
• W1965475055 hasPublicationYear "2002" @default.
• W1965475055 type Work @default.
• W1965475055 sameAs 1965475055 @default.
• W1965475055 citedByCount "114" @default.
• W1965475055 countsByYear W19654750552012 @default.
• W1965475055 countsByYear W19654750552013 @default.
• W1965475055 countsByYear W19654750552014 @default.
• W1965475055 countsByYear W19654750552015 @default.
• W1965475055 countsByYear W19654750552016 @default.
• W1965475055 countsByYear W19654750552017 @default.
• W1965475055 countsByYear W19654750552018 @default.
• W1965475055 countsByYear W19654750552019 @default.
• W1965475055 countsByYear W19654750552020 @default.
• W1965475055 countsByYear W19654750552021 @default.
• W1965475055 countsByYear W19654750552022 @default.
• W1965475055 countsByYear W19654750552023 @default.
• W1965475055 crossrefType "journal-article" @default.
• W1965475055 hasAuthorship W1965475055A5017542878 @default.
• W1965475055 hasAuthorship W1965475055A5057050066 @default.
• W1965475055 hasAuthorship W1965475055A5061537205 @default.
• W1965475055 hasAuthorship W1965475055A5062027051 @default.
• W1965475055 hasAuthorship W1965475055A5072208105 @default.
• W1965475055 hasAuthorship W1965475055A5082311477 @default.
• W1965475055 hasBestOaLocation W19654750551 @default.
• W1965475055 hasConcept C104317684 @default.
• W1965475055 hasConcept C126322002 @default.
• W1965475055 hasConcept C153911025 @default.
• W1965475055 hasConcept C181199279 @default.
• W1965475055 hasConcept C185592680 @default.
• W1965475055 hasConcept C207200792 @default.
• W1965475055 hasConcept C2778524494 @default.
• W1965475055 hasConcept C2780215583 @default.
• W1965475055 hasConcept C512185932 @default.
• W1965475055 hasConcept C53345823 @default.
• W1965475055 hasConcept C55493867 @default.
• W1965475055 hasConcept C62826618 @default.
• W1965475055 hasConcept C71924100 @default.
• W1965475055 hasConcept C86803240 @default.
• W1965475055 hasConcept C95444343 @default.
• W1965475055 hasConceptScore W1965475055C104317684 @default.
• W1965475055 hasConceptScore W1965475055C126322002 @default.
• W1965475055 hasConceptScore W1965475055C153911025 @default.
• W1965475055 hasConceptScore W1965475055C181199279 @default.
• W1965475055 hasConceptScore W1965475055C185592680 @default.
• W1965475055 hasConceptScore W1965475055C207200792 @default.
• W1965475055 hasConceptScore W1965475055C2778524494 @default.

• next