FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1965823999> ?p ?o ?g. }

• W1965823999 endingPage "8" @default.
• W1965823999 startingPage "1" @default.
• W1965823999 abstract "Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2) (-), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)-G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer." @default.
• W1965823999 created "2016-06-24" @default.
• W1965823999 creator A5004492200 @default.
• W1965823999 creator A5052300453 @default.
• W1965823999 creator A5076941392 @default.
• W1965823999 creator A5084462833 @default.
• W1965823999 creator A5085127170 @default.
• W1965823999 creator A5088944638 @default.
• W1965823999 creator A5091637118 @default.
• W1965823999 date "2006-01-01" @default.
• W1965823999 modified "2023-10-15" @default.
• W1965823999 title "Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification" @default.
• W1965823999 cites W1558516755 @default.
• W1965823999 cites W1970033940 @default.
• W1965823999 cites W1991209203 @default.
• W1965823999 cites W1998228312 @default.
• W1965823999 cites W2029009897 @default.
• W1965823999 cites W2046449661 @default.
• W1965823999 cites W2046900004 @default.
• W1965823999 cites W2048191679 @default.
• W1965823999 cites W2059830840 @default.
• W1965823999 cites W2061315595 @default.
• W1965823999 cites W2082691593 @default.
• W1965823999 cites W2092975717 @default.
• W1965823999 cites W2098205015 @default.
• W1965823999 cites W2103268538 @default.
• W1965823999 cites W2133918133 @default.
• W1965823999 cites W2152324024 @default.
• W1965823999 cites W2164571490 @default.
• W1965823999 cites W2912554474 @default.
• W1965823999 doi "https://doi.org/10.1155/bca/2006/63703" @default.
• W1965823999 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1779547" @default.
• W1965823999 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17497012" @default.
• W1965823999 hasPublicationYear "2006" @default.
• W1965823999 type Work @default.
• W1965823999 sameAs 1965823999 @default.
• W1965823999 citedByCount "8" @default.
• W1965823999 countsByYear W19658239992012 @default.
• W1965823999 countsByYear W19658239992017 @default.
• W1965823999 countsByYear W19658239992018 @default.
• W1965823999 countsByYear W19658239992021 @default.
• W1965823999 crossrefType "journal-article" @default.
• W1965823999 hasAuthorship W1965823999A5004492200 @default.
• W1965823999 hasAuthorship W1965823999A5052300453 @default.
• W1965823999 hasAuthorship W1965823999A5076941392 @default.
• W1965823999 hasAuthorship W1965823999A5084462833 @default.
• W1965823999 hasAuthorship W1965823999A5085127170 @default.
• W1965823999 hasAuthorship W1965823999A5088944638 @default.
• W1965823999 hasAuthorship W1965823999A5091637118 @default.
• W1965823999 hasBestOaLocation W19658239991 @default.
• W1965823999 hasConcept C104317684 @default.
• W1965823999 hasConcept C129312508 @default.
• W1965823999 hasConcept C134306372 @default.
• W1965823999 hasConcept C161790260 @default.
• W1965823999 hasConcept C178790620 @default.
• W1965823999 hasConcept C185592680 @default.
• W1965823999 hasConcept C197336794 @default.
• W1965823999 hasConcept C21951064 @default.
• W1965823999 hasConcept C2777516457 @default.
• W1965823999 hasConcept C2780761128 @default.
• W1965823999 hasConcept C33923547 @default.
• W1965823999 hasConcept C40875361 @default.
• W1965823999 hasConcept C512185932 @default.
• W1965823999 hasConcept C540031477 @default.
• W1965823999 hasConcept C552990157 @default.
• W1965823999 hasConcept C55493867 @default.
• W1965823999 hasConcept C75473681 @default.
• W1965823999 hasConceptScore W1965823999C104317684 @default.
• W1965823999 hasConceptScore W1965823999C129312508 @default.
• W1965823999 hasConceptScore W1965823999C134306372 @default.
• W1965823999 hasConceptScore W1965823999C161790260 @default.
• W1965823999 hasConceptScore W1965823999C178790620 @default.
• W1965823999 hasConceptScore W1965823999C185592680 @default.
• W1965823999 hasConceptScore W1965823999C197336794 @default.
• W1965823999 hasConceptScore W1965823999C21951064 @default.
• W1965823999 hasConceptScore W1965823999C2777516457 @default.
• W1965823999 hasConceptScore W1965823999C2780761128 @default.
• W1965823999 hasConceptScore W1965823999C33923547 @default.
• W1965823999 hasConceptScore W1965823999C40875361 @default.
• W1965823999 hasConceptScore W1965823999C512185932 @default.
• W1965823999 hasConceptScore W1965823999C540031477 @default.
• W1965823999 hasConceptScore W1965823999C552990157 @default.
• W1965823999 hasConceptScore W1965823999C55493867 @default.
• W1965823999 hasConceptScore W1965823999C75473681 @default.
• W1965823999 hasFunder F4320321079 @default.
• W1965823999 hasLocation W19658239991 @default.
• W1965823999 hasLocation W19658239992 @default.
• W1965823999 hasLocation W19658239993 @default.
• W1965823999 hasLocation W19658239994 @default.
• W1965823999 hasLocation W19658239995 @default.
• W1965823999 hasOpenAccess W1965823999 @default.
• W1965823999 hasPrimaryLocation W19658239991 @default.
• W1965823999 hasRelatedWork W2022637606 @default.
• W1965823999 hasRelatedWork W2052268297 @default.
• W1965823999 hasRelatedWork W2064230511 @default.
• W1965823999 hasRelatedWork W2066104862 @default.
• W1965823999 hasRelatedWork W2900466724 @default.
• W1965823999 hasRelatedWork W2906325992 @default.

• next