FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1965828106> ?p ?o ?g. }

• W1965828106 endingPage "8900" @default.
• W1965828106 startingPage "8893" @default.
• W1965828106 abstract "RON is a receptor tyrosine kinase in the MET family. We have expressed and purified active RON using the Sf9/baculovirus system. The constructs used in this study comprise the kinase domain alone and the kinase domain plus the C-terminal region. The construct containing the kinase domain alone has a higher specific activity than the construct containing the kinase and C-terminal domains. Purified RON undergoes autophosphorylation, and the exogenous RON C terminus serves as a substrate. Peptides containing a dityrosine motif derived from the C-terminal tail inhibit RON in vitro or when delivered into intact cells, consistent with an autoinhibitory mechanism. Phenylalanine substitutions within these peptides increase the inhibitory potency. Moreover, introduction of these Phe residues into the dityrosine motif of the RON kinase leads to a decrease in kinase activity. Taken together, our data suggest a model in which the C-terminal tail of RON regulates kinase activity via an interaction with the kinase catalytic domain. RON is a receptor tyrosine kinase in the MET family. We have expressed and purified active RON using the Sf9/baculovirus system. The constructs used in this study comprise the kinase domain alone and the kinase domain plus the C-terminal region. The construct containing the kinase domain alone has a higher specific activity than the construct containing the kinase and C-terminal domains. Purified RON undergoes autophosphorylation, and the exogenous RON C terminus serves as a substrate. Peptides containing a dityrosine motif derived from the C-terminal tail inhibit RON in vitro or when delivered into intact cells, consistent with an autoinhibitory mechanism. Phenylalanine substitutions within these peptides increase the inhibitory potency. Moreover, introduction of these Phe residues into the dityrosine motif of the RON kinase leads to a decrease in kinase activity. Taken together, our data suggest a model in which the C-terminal tail of RON regulates kinase activity via an interaction with the kinase catalytic domain. RON is a receptor tyrosine kinase that is involved in cell proliferation, survival, and motility (1Comoglio P.M. Boccaccio C. Genes Cells. 1996; 1: 347-354Crossref PubMed Scopus (68) Google Scholar, 2Wang M.H. Wang D. Chen Y.Q. Carcinogenesis. 2003; 24: 1291-1300Crossref PubMed Scopus (126) Google Scholar, 3Danilkovitch-Miagkova A. Curr. Cancer Drug Targets. 2003; 3: 31-40Crossref PubMed Scopus (59) Google Scholar). RON is one of the three members of the MET family of receptor tyrosine kinases (MET, RON, and SEA) (4Ronsin C. Muscatelli F. Mattei M.G. Breathnach R. Oncogene. 1993; 8: 1195-1202PubMed Google Scholar, 5Rubin J.S. Bottaro D.P. Aaronson S.A. Biochim. Biophys. Acta. 1993; 1155: 357-371Crossref PubMed Scopus (287) Google Scholar). The MET family members share a number of unique structural properties, most notably an αβ disulfide-linked heterodimeric structure. RON is composed of a 40-kDa extracellular α chain and a 150-kDa transmembrane β chain with intrinsic protein kinase activity (4Ronsin C. Muscatelli F. Mattei M.G. Breathnach R. Oncogene. 1993; 8: 1195-1202PubMed Google Scholar, 6Wang M.H. Ronsin C. Gesnel M.C. Coupey L. Skeel A. Leonard E.J. Breathnach R. Science. 1994; 266: 117-119Crossref PubMed Scopus (247) Google Scholar, 7Gaudino G. Follenzi A. Naldini L. Collesi C. Santoro M. Gallo K.A. Godowski P.J. Comoglio P.M. EMBO J. 1994; 13: 3524-3532Crossref PubMed Scopus (291) Google Scholar).RON is expressed in a variety of cells, including epithelial cells and macrophages (7Gaudino G. Follenzi A. Naldini L. Collesi C. Santoro M. Gallo K.A. Godowski P.J. Comoglio P.M. EMBO J. 1994; 13: 3524-3532Crossref PubMed Scopus (291) Google Scholar, 8Gaudino G. Avantaggiato V. Follenzi A. Acampora D. Simeone A. Comoglio P.M. Oncogene. 1995; 11: 2627-2637PubMed Google Scholar, 9Wang M.H. Dlugosz A.A. Sun Y. Suda T. Skeel A. Leonard E.J. Exp. Cell Res. 1996; 226: 39-46Crossref PubMed Scopus (99) Google Scholar, 10Wang M.H. Montero-Julian F.A. Dauny I. Leonard E.J. Oncogene. 1996; 13: 2167-2175PubMed Google Scholar, 11Iwama A. Wang M.H. Yamaguchi N. Ohno N. Okano K. Sudo T. Takeya M. Gervais F. Morissette C. Leonard E.J. Blood. 1995; 86: 3394-3403Crossref PubMed Google Scholar). The ligand for the RON receptor is macrophage-stimulating protein (MSP), 1The abbreviations used are: MSP, macrophage-stimulating protein; EGFR, epidermal growth factor receptor; GST, glutathione S-transferase; IGF1R, insulin-like growth factor I receptor; JM region, juxtamembrane region; MAPK, Ras/mitogen-activated protein kinase; Ni-NTA, nickel-nitrilotriacetic acid; RTK, receptor tyrosine kinase.1The abbreviations used are: MSP, macrophage-stimulating protein; EGFR, epidermal growth factor receptor; GST, glutathione S-transferase; IGF1R, insulin-like growth factor I receptor; JM region, juxtamembrane region; MAPK, Ras/mitogen-activated protein kinase; Ni-NTA, nickel-nitrilotriacetic acid; RTK, receptor tyrosine kinase. also known as hepatocyte growth factor-like protein (6Wang M.H. Ronsin C. Gesnel M.C. Coupey L. Skeel A. Leonard E.J. Breathnach R. Science. 1994; 266: 117-119Crossref PubMed Scopus (247) Google Scholar, 7Gaudino G. Follenzi A. Naldini L. Collesi C. Santoro M. Gallo K.A. Godowski P.J. Comoglio P.M. EMBO J. 1994; 13: 3524-3532Crossref PubMed Scopus (291) Google Scholar). In normal cells, MSP binding leads to a transient increase in RON activity, whereas tumor cells often possess elevated levels of RON protein, expression of altered forms of RON, and increased RON kinase activity (12Maggiora P. Marchio S. Stella M.C. Giai M. Belfiore A. De Bortoli M. Di Renzo M.F. Costantino A. Sismondi P. Comoglio P.M. Oncogene. 1998; 16: 2927-2933Crossref PubMed Scopus (182) Google Scholar, 13Zhou Y.Q. He C. Chen Y.Q. Wang D. Wang M.H. Oncogene. 2003; 22: 186-197Crossref PubMed Scopus (169) Google Scholar, 14Chen Y.Q. Zhou Y.Q. Fisher J.H. Wang M.H. Oncogene. 2002; 21: 6382-6386Crossref PubMed Scopus (48) Google Scholar).Upon activation of RON, the receptor becomes phosphorylated within the activation loop of the kinase catalytic domain, and the enzymatic activity of RON is enhanced. RON also possesses two tyrosine residues in the C-terminal tail in a motif (Y1353VQLPAT1360YMNL) that is conserved in all MET family members (15Ponzetto C. Bardelli A. Zhen Z. Maina F. dalla Zonca P. Giordano S. Graziani A. Panayotou G. Comoglio P.M. Cell. 1994; 77: 261-271Abstract Full Text PDF PubMed Scopus (885) Google Scholar). Ligand stimulation of MET family members leads to phosphorylation of these two tyrosines (Tyr1353 and Tyr1360). These phosphorylated tyrosine residues provide multifunctional docking sites for the p85 regulatory subunit of phosphatidylinositol 3-kinase (16Ponzetto C. Bardelli A. Maina F. Longati P. Panayotou G. Dhand R. Waterfield M.D. Comoglio P.M. Mol. Cell. Biol. 1993; 13: 4600-4608Crossref PubMed Scopus (159) Google Scholar), the Grb2·SOS complex (15Ponzetto C. Bardelli A. Zhen Z. Maina F. dalla Zonca P. Giordano S. Graziani A. Panayotou G. Comoglio P.M. Cell. 1994; 77: 261-271Abstract Full Text PDF PubMed Scopus (885) Google Scholar, 17Fixman E.D. Naujokas M.A. Rodrigues G.A. Moran M.F. Park M. Oncogene. 1995; 10: 237-249PubMed Google Scholar), STAT3 (18Boccaccio C. Ando M. Tamagnone L. Bardelli A. Michieli P. Battistini C. Comoglio P.M. Nature. 1998; 391: 285-288Crossref PubMed Scopus (451) Google Scholar), and the adaptor protein Gab1 (19Weidner K.M. Di Cesare S. Sachs M. Brinkmann V. Behrens J. Birchmeier W. Nature. 1996; 384: 173-176Crossref PubMed Scopus (501) Google Scholar, 20Bardelli A. Longati P. Gramaglia D. Stella M.C. Comoglio P.M. Oncogene. 1997; 15: 3103-3111Crossref PubMed Scopus (116) Google Scholar, 21Nguyen L. Holgado-Madruga M. Maroun C. Fixman E.D. Kamikura D. Fournier T. Charest A. Tremblay M.L. Wong A.J. Park M. J. Biol. Chem. 1997; 272: 20811-20819Abstract Full Text Full Text PDF PubMed Scopus (154) Google Scholar). Mutation of these two tyrosines (Y1353F/Y1360F) suppressed the transforming ability of activated forms of RON (15Ponzetto C. Bardelli A. Zhen Z. Maina F. dalla Zonca P. Giordano S. Graziani A. Panayotou G. Comoglio P.M. Cell. 1994; 77: 261-271Abstract Full Text PDF PubMed Scopus (885) Google Scholar). A similar mutation caused a complete loss of transforming ability of the related SEA kinase (22Park C.Y. Hayman M.J. J. Biol. Chem. 1999; 274: 7583-7590Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). These results could be the result of the inability of the double mutant to engage SH2 domain-containing downstream signaling proteins. Another possibility, however, is that the intrinsic kinase activity of the Y1353F/Y1360F mutant is altered. Bardelli et al. (23Bardelli A. Longati P. Williams T.A. Benvenuti S. Comoglio P.M. J. Biol. Chem. 1999; 274: 29274-29281Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar) demonstrated that peptides containing C-terminal sequences inhibited MET kinase activity in vitro. A peptide derived from the C-terminal tail impaired MET-induced invasive growth in transformed epithelial cells. These studies suggested that the carboxy-terminal domain may act as an intramolecular modulator of MET receptor (23Bardelli A. Longati P. Williams T.A. Benvenuti S. Comoglio P.M. J. Biol. Chem. 1999; 274: 29274-29281Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar).At present, the regulatory mechanism of MET family kinases is unclear, partly because no enzymatic studies have been carried out on a purified member of this family. We report the first purification and characterization of active RON from eukaryotic cells, using the Sf9/baculovirus expression system. We present evidence that the C-terminal region of RON plays an autoinhibitory role.EXPERIMENTAL PROCEDURESMaterials—Monoclonal antibody against phosphotyrosine (4G10) and anti-MAPK antibody were obtained from Upstate Biotechnology, Inc. (Lake Placid, NY). Anti-phospho-RON polyclonal antibody was obtained from BIOSOURCE (Camarillo, CA). Anti-phospho-MAPK antibody was purchased from BD Transduction Laboratories (San Diego). RON antibody (sc-322) was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Human MSP was from R&D Systems (Minneapolis). pBACgus-9 transfer plasmid and Bacvector-3000 DNA transfection kits were from Novagen (Madison, WI). Protein A-agarose was from Sigma. Glutathione-agarose and glutathione S-transferase (GST) antibody were purchased from Molecular Probes (Eugene, OR). Ni-NTA affinity resin was from Qiagen, and Affi-Gel-15 was from Bio-Rad. RON100(1300–1400) antibody was raised in rabbit. The Chariot peptide transfection reagent was purchased from Active Motif (Carlsbad, CA).Peptide Synthesis and Characterization—The following synthetic peptides were used in this study: Abl substrate (EAIYAAPFAKKKG), Src substrate (AEEEIYGEFEAKKKKG), EGFR substrate (AEEEEYFELVAKKKG), insulin receptor substrate (KKEEEEYMMMMG), peptide Y1353/Y1360 (residues 1349–1367 of RON, LGDHYVQLPATYMNLGPST), peptide Y1353 (1346–1359, SALLGDHYVQLPAT), peptide Y1360 (1354–1367, VQLPATYMNLGPST), and peptide F1353/F1360 (1349–1367, LGDHFVQLPATFMNLGPST). Peptides were synthesized on an Applied Biosystems 431A automated peptide synthesizer using standard Fmoc (N-(9-fluorenyl)methoxycarbonyl) chemistry (24Atherton E. Sheppard R.C. Solid-phase Peptide Synthesis. IRL Press, Oxford, UK1989Google Scholar). The synthetic peptides were purified by preparative reversed phase high performance liquid chromatography and characterized by matrix-assisted laser description/ionization time-of-flight mass spectrometry.Baculovirus Expression Vectors—The RON kinase-C-terminal tail construct (RON-CT) was generated by PCR. This construct encoded amino acids Ala1065-Thr1400 of RON. The PCR 5′-primer had the sequence CGCGGATCCGGCGCTCTTGGCTGAGGTCAAG, and the 3′-primer was GGAATTCGGAGTGGGCCGAGGAGGCTCTGAGAG. These primers had 31 nucleotides (5′-primer) and 33 nucleotides (3′-primer) of complementarily with the template and encoded unique restriction sites (BamHI at the 5′-end and EcoRI at the 3′-end). The PCR product was ligated into plasmid pCR-BluntII-TOPO (Invitrogen). The resulting plasmid was digested with BamHI/EcoRI, and the RON insert was purified on an agarose gel. The RON fragment was subcloned into plasmid pBACgus-9 (N-terminal T7 tag, C-terminal CBD tag, and polyhistidine tag; Novagen), and expressed in Sf9 cells using the Bacvector-3000 DNA transfection kit (Novagen). The 2YF mutant form (RON-2YF) was generated by site-directed mutagenesis of the pBACgus-9 RON-CT construct using the QuikChange mutagenesis system (Stratagene). The mutation was confirmed by automated DNA sequencing.To produce the isolated kinase catalytic domain of RON (RON-KIN), PCR was carried out with the 5′-primer 5′-CGCGGATCCGGCGCTCTTGGCTGAGGTCAAG and the 3′-primer 5′-GGAATTCGGCACTATCTGCTCCACCTCCCC. These primers had 31 and 30 nucleotides of complementarily with the template, respectively, and encoded unique restriction sites (BamHI at the 5′-end and EcoRI at the 3′ end). The RON-KIN construct encodes amino acids Ala1065-Val1345. Baculovirus expression of RON-KIN was carried out using the methods described above for RON-CT. For production of RON-CT and RON-KIN proteins, 0.6 liter of Sf9 cells (1.8 × 106 cells/ml) were infected with recombinant baculovirus at a multiplicity of infection of 7.5 and 9.0, respectively. After 4 days of infection, cells were harvested and washed twice with phosphate-buffered saline.Purification of RON-CT—Sf9 Cells were lysed in a French pressure cell in 20 mm Tris-HCl buffer (pH 8.0) containing 2 mm Na3VO4, 5 mm 2-mercaptoethanol, 10 μg/ml leupeptin, 10 μg/ml aprotinin, and 1 mm phenylmethylsulfonyl fluoride. After centrifugation at 40,000 × g for 30 min, the supernatant was filtered and applied to a 1.6 × 10-cm Source Q FPLC column (Amersham Biosciences), which was preequilibrated with homogenizing buffer. Flow-through fractions were applied to a 4-ml Ni-NTA column (Qiagen). The column was washed with buffer containing 20 mm imidazole, 0.5 m NaCl, 2 mm Na3VO4, 10% glycerol, 5 mm 2-mercaptoethanol, 20 mm Tris-HCl (pH. 8.0), and 1 m NaCl. RON-CT was eluted with buffer containing 100 mm imidazole, 5 mm 2-mercaptoethanol, 2 mm Na3VO4, 10% glycerol, and 20 mm Tris-HCl (pH. 8.0). RON kinase activity was measured using the phosphocellulose paper binding assay (25Casnellie J.E. Methods Enzymol. 1991; 200: 115-120Crossref PubMed Scopus (131) Google Scholar) with peptide EAIYAAPFAKKKG as a substrate. Peaks of activity were pooled and concentrated. For some preparations, additional purification was carried out on a Mono Q FPLC column. The column was washed with buffer containing 0.05 m NaCl, and RON-CT was eluted with a linear gradient of 0.05–0.3 m NaCl in the same buffer. The RON-KIN and RON-2YF proteins were purified by similar methods.In some experiments, the C-terminal tags were removed proteolytically from RON-CT. 100 μg of RON-CT was digested with 0.25 milliunit of thrombin for 2.5 h at 30 °C. The digested enzyme was applied to a Superdex 200 gel filtration column to separate away the cleaved CBD and polyhistidine tags.RON Kinase Assay Using Synthetic Peptide Substrates—RON kinase activity was determined using the phosphocellulose paper assay. Reaction mixtures contained 20 mm Tris-HCl (pH 7.4), 10 mm MgCl2, 0.1 mm Na3VO4, 0.5 mm dithiothreitol, 0.25 mm ATP, 2.5 mg/ml albumin, varying concentrations of peptide substrate, and [γ-32P]ATP (200–400 cpm/pmol). Reactions were terminated by the addition of 50% acetic acid, and samples were spotted on P-81 phosphocellulose paper (25Casnellie J.E. Methods Enzymol. 1991; 200: 115-120Crossref PubMed Scopus (131) Google Scholar). Incorporation of 32P into peptide was determined by liquid scintillation counting. The value of Km (peptide) was determined using a range of peptide concentrations (0.05–2.0 mm) and 0.25 mm [γ-32P]ATP. Kinetic parameters were calculated by fitting data to the Michaelis-Menten equation. For some experiments, a continuous spectrophotometric assay was employed (26Barker S.C. Kassel D.B. Weigl D. Huang X. Luther M.A. Knight W.B. Biochemistry. 1995; 34: 14843-14851Crossref PubMed Scopus (158) Google Scholar). In this assay, production of ADP is coupled to the oxidation of NADH, which is measured as a reduction in absorbance at 340 nm.Autophosphorylation of RON—Purified RON proteins were incubated with 0.25 mm [γ-32P]ATP (400–700 cpm/pmol) in kinase buffer containing 20 mm Tris-HCl (pH 7.5), 10 mm MgCl2, 0.5 mm dithiothreitol, and 0.1 mm Na3VO4 at 30 °C. To analyze the effects of synthetic peptides on RON autophosphorylation, RON was preincubated with peptides for 10 min prior to the addition of [γ-32P]ATP. Reactions were stopped by the addition of SDS-sample buffer and analyzed by SDS-PAGE and autoradiography.Western Blotting—Proteins were analyzed on 8% SDS-polyacrylamide gels and transferred to Immobilon membrane (Millipore, Bedford, MA) in the presence of 0.1% SDS. The membranes were blocked using 5% milk in Tris-buffered saline plus 0.1% Tween 20, then probed with the appropriate antibodies. Blots were visualized using horseradish peroxidase-conjugated second antibody with ECL (enhanced chemiluminescence, Amersham Biosciences) or alkaline phosphatase-conjugated second antibody with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium as substrates.GST-RON Fusion Proteins—GST-RON65 (amino acids 1335–1400 of RON) and GST-RON100 (amino acids 1300–1400) were expressed in Escherichia coli DH5α cells as GST fusion proteins. The fusion proteins were purified using glutathione-agarose, as described previously (27Xu B. Miller W.T. Mol. Cell Biochem. 1996; 158: 57-63PubMed Google Scholar). For phosphorylation experiments, 0.125 μg of purified RON-CT was incubated with 2.0-μg GST-RON65 or GST-RON100 fusion protein plus 0.25 mm [γ-32P]ATP in kinase assay buffer for 40 min. Reactions were stopped by the addition of SDS-sample buffer, then subjected to SDS-PAGE. Phosphorylation was analyzed by autoradiography. Purified GST was used as a control.Delivery of Peptides to NIH3T3 Cells—RON-NIH3T3 cells (28Ischenko I. Petrenko O. Gu H. Hayman M.J. Oncogene. 2003; 22: 6311-6318Crossref PubMed Scopus (20) Google Scholar) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum at 37 °C with 7% CO2. Chariot-peptide complexes were prepared according to the manufacturer's protocol. RON-NIH3T3 cells were serum starved for 1 h and incubated further with Chariot-peptide complexes for 3 h. Cells were stimulated with 100 ng/ml MSP for 30 min before harvesting. Cell lysates were applied to a 10% SDS-polyacrylamide gel and analyzed by Western immunoblotting with anti-phosphotyrosine, anti-RON, anti-phospho-MAPK, and MAPK antibodies.RESULTSPurification of RON and Kinetics of Peptide Phosphorylation—We produced a RON construct containing the kinase domain plus the C-terminal tail (RON-CT) by infection of Sf9 cells with a recombinant baculovirus vector (Fig. 1A). We purified RON-CT to homogeneity by chromatography on Source-Q and Ni-NTA columns (Fig. 1B). Kinase activity was monitored during the purification by the phosphocellulose paper binding assay, using the Abl consensus peptide EAIYAAPFAKKKG as a substrate. Purified RON-CT migrates with the expected molecular mass (≈55.4 kDa) (Fig. 1B). RON-CT reacted with a rabbit polyclonal antibody raised against GST-RON100 (residues 1300–1400), as well as with anti-phospho-RON antibody, suggesting that the purified protein is autophosphorylated or phosphorylated by an endogenous Sf9 cell kinase (Fig. 1B).As an initial test of the substrate specificity of RON kinase, we carried out experiments with four peptides containing recognition motifs for different subfamilies of tyrosine kinases. The kinase recognition motifs included were for Src, Abl, EGFR, and insulin receptor. RON-CT preferred the EGFR substrate from this group of peptides (Table I). We carried out initial rate kinetic measurements with saturating concentrations of ATP and varying concentrations of peptides. These experiments yielded a Km for the EGFR peptide of 520 μm and a kcat of 13.72 min–1 (kcat/Km = 26.2 × 10–3 min–1 μm–1) (Table I). The next best substrate for RON, Abl peptide, was phosphorylated with a kcat/Km = 11 × 10–3 min–1μm–1, ∼2.4 times lower than the EGFR substrate (Table I). Phosphorylation of the Src and insulin receptor-specific peptides was barely detectable. Thus, our kinetic experiments show that RON phosphorylates the EGFR peptide with a kcat/Km value > 17-fold higher than that seen with a preferred substrate for another RTK, insulin receptor kinase. Previous experiments with immunoprecipitated RON also showed that RON preferred the EGFR peptide sequence (29Santoro M.M. Penengo L. Orecchia S. Cilli M. Gaudino G. Oncogene. 2000; 19: 5208-5211Crossref PubMed Scopus (19) Google Scholar). In those studies, however, a Src substrate sequence was phosphorylated roughly equally to the EGFR sequence, whereas in our studies (Table I) we found a difference of ∼24-fold in terms of kcat/Km.Table IKinetic parameters for RON.PeptideSequencekcat/KmkcatKmmin-1 μm-1min-1μmAbl substrateEAIYAAPFAKKKG11.0 × 10-36.2510Src substrateAEEEIYGEFEAKKKKG1.1 × 10-30.89800EGFR substrateAEEEEYFELVAKKKG26.2 × 10-313.7520IRKaIRK, insulin receptor kinase. substrateKKEEEEYMMMMG1.5 × 10-31.4950a IRK, insulin receptor kinase. Open table in a new tab Autophosphorylation of RON—Many tyrosine kinases are regulated by autophosphorylation within the activation loop, a segment that lies between the N- and C-terminal lobes of the catalytic domain. MET family receptors contain a pair of tyrosine residues in the activation loop (tyrosines 1238 and 1239 in RON). For the MET receptor itself, autophosphorylation has been mapped to the residues corresponding to Tyr1238 and Tyr1239, and phosphorylation at these sites activates MET (30Ferracini R. Longati P. Naldini L. Vigna E. Comoglio P.M. J. Biol. Chem. 1991; 266: 19558-19564Abstract Full Text PDF PubMed Google Scholar, 31Longati P. Bardelli A. Ponzetto C. Naldini L. Comoglio P.M. Oncogene. 1994; 9: 49-57PubMed Google Scholar). By Western blotting with an antibody that recognizes RON that is doubly phosphorylated at Tyr1238/Tyr1239, we detected phosphorylation of RON-CT after expression in Sf9 cells (Fig. 1B). We investigated whether purified RON-CT can undergo autophosphorylation. Purified RON-CT was incubated with [γ-32P]ATP in kinase buffer, and the reaction mixtures were analyzed by SDS-PAGE and autoradiography. RON-CT was autophosphorylated in a time-dependent manner, and preincubation of RON-CT with unlabeled ATP reduced the level of autophosphorylation (Fig. 2).Fig. 2Autophosphorylation of RON. Purified RON-CT was incubated with 0.25 mm [γ-32P]ATP in kinase buffer for the indicated times. The reaction was terminated by the addition of SDS-sample buffer and analyzed by SDS-PAGE and autoradiography. In the lane marked +, RON was preincubated with 0.25 mm ATP for 40 min followed by an incubation with [γ-32P]ATP for 40 min as described above.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Phosphorylation of the RON C-terminal dityrosine motif (Y1353/Y1360) has been suggested to be caused by autophosphorylation by RON itself (15Ponzetto C. Bardelli A. Zhen Z. Maina F. dalla Zonca P. Giordano S. Graziani A. Panayotou G. Comoglio P.M. Cell. 1994; 77: 261-271Abstract Full Text PDF PubMed Scopus (885) Google Scholar, 16Ponzetto C. Bardelli A. Maina F. Longati P. Panayotou G. Dhand R. Waterfield M.D. Comoglio P.M. Mol. Cell. Biol. 1993; 13: 4600-4608Crossref PubMed Scopus (159) Google Scholar, 17Fixman E.D. Naujokas M.A. Rodrigues G.A. Moran M.F. Park M. Oncogene. 1995; 10: 237-249PubMed Google Scholar), although it is also possible that another kinase phosphorylates these residues. To test whether purified RON has the capacity to phosphorylate these C-terminal tyrosines, we synthesized two peptides (peptides Y1353 and Y1360) corresponding to these sequences. Peptide Y1353 contains residues 1346–1359 (SALLGDHYVQLPAT), and peptide Y1360 contains residues 1354–1367 (VQLPATYMNLGPST). We also prepared a synthetic peptide (peptide Y1353/Y1360) containing the entire dityrosine motif (residues 1349–1367; LGDHYVQLPATYMNLGPST). These peptides showed essentially no phosphorylation (data not shown). We next tested two GST fusion proteins containing residues 1335–1400 (GST-RON65) and 1300–1400 (GST-RON100) from the RON C-terminal tail. These GST fusion proteins were incubated with purified RON-CT and [γ-32P]ATP in kinase buffer. Autoradiography showed 32P incorporation into GST-RON65 and GST-RON100 as well as into RON-CT itself (Fig. 3). GST alone was not a substrate for RON. GST-RON65 in particular contains no other tyrosines besides Tyr1353 and Tyr1360; thus, these results show that RON has the capacity to phosphorylate these sites, at least in the context of an exogenous fusion protein.Fig. 3RON phosphorylates tyrosine residues in the bidentate motif. GST-RON65 or GST-RON100 was incubated with purified RON-CT plus 0.25 mm [γ-32P]ATP in kinase assay buffer for 40 min. The reaction was stopped by the addition of SDS-sample buffer then subjected to SDS-PAGE. Reactions were analyzed by autoradiography (top panel) and by anti-GST Western blotting (bottom panel).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Peptides Derived from the C-terminal Tail Inhibit RON Kinase Activity—It has been demonstrated previously that a peptide corresponding to the C-terminal tail of the MET receptor inhibits MET kinase activity (23Bardelli A. Longati P. Williams T.A. Benvenuti S. Comoglio P.M. J. Biol. Chem. 1999; 274: 29274-29281Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). To investigate whether the RON C-terminal tail regulates kinase activity, we tested peptides Y1353, Y1360, and Y1353/Y1360 as potential inhibitors. We also synthesized a peptide in which the two tyrosines in the C-terminal sequence (residues 1349–1367) were replaced with phenylalanines (peptide F1353/F1360). In these experiments, we first removed the CBD and His tags from RON-CT by treatment with thrombin to avoid any interference by the tags in our assays. RON-CT activity was measured toward 0.5 mm Abl peptide substrate in the presence of various concentrations of the C-terminal peptides. As shown in Fig. 4A, peptide F1353/F1360 dramatically inhibited RON-CT activity. Peptide Y1353 also showed inhibition, whereas peptides Y1360 and Y1353/Y1360 had very little effect (Fig. 4A). Consistent with the results shown in Fig. 4A, phosphorylation of GST-RON65 and GST-RON100 was also inhibited by peptide F1353/F1360 but not by peptide Y1353/Y1360 (Fig. 4B). We also analyzed the effects of the synthetic peptides on RON-CT autophosphorylation (Fig. 4C). The results of this experiment correlated well with the results presented in Fig. 4A; peptide F1353/F1360 was the most effective inhibitor of RON-CT autophosphorylation, and peptide Y1353 also gave inhibition at higher concentrations. Peptides Y1360 and Y1353/Y1360 were inactive in this assay (Fig. 4C).Fig. 4RON-CT inhibition by C-terminal tail peptides.A, purified RON-CT was preincubated with various concentrations of the indicated peptides for 10 min followed by a kinase assay with 0.5 mm Abl peptide as a substrate and 0.25 mm [γ-32P]ATP for 30 min. RON activity was measured with the phosphocellulose paper assay. B, RON-CT was incubated with 0.75 mm peptide Y1353/Y1360 (YY) or F1353/F1360 (FF), then further incubated with GST-RON65 or GST-RON100 and 0.25 mm [γ-32P]ATP for 40 min in kinase assay buffer. The reaction was stopped by the addition of SDS-sample buffer then subjected to SDS-PAGE. Phosphorylation was analyzed by autoradiography. C, RON-CT was preincubated with peptides for 10 min. Next, 0.25 mm [γ-32P]ATP was added in kinase buffer. After a 40-min incubation, the reaction was terminated by the addition of SDS-sample buffer and analyzed by SDS-PAGE and autoradiography.View Large Image Figure ViewerDownload Hi-res image Download (PPT)We investigated whether these peptides are specific for RON kinase. We carried out inhibition experiments using the purified catalytic domain of another receptor tyrosine kinase, the insulin-like growth factor I receptor (IGF1R). We measured phosphorylation of a specific IGF1R peptide substrate by the triply phosphorylated, activated form of IGF1R. Even at concentrations as high as 1 mm, none of the RON C-terminal peptides gave any inhibition of IGF1R (data not shown).Deletion of the C-terminal Tail Enhances RON Kinase Activity—To test further the idea that the RON C terminus is inhibitory, we produced a form of RON containing the kinase catalytic domain alone (RON-KIN). RON-KIN was expressed in Sf9 insect cells and purified to homogeneity using a strategy similar to that for RON-CT. RON-KIN migrates with the expected molecular mass (≈50.9 kDa) and reacts with anti-RON antibody (Fig. 5A). RON-KIN undergoes autophosphorylation, demonstrating that sites exist within the catalytic domain itself (data not shown). We compared the specific activity of RON-CT and RON-KIN using 0.5 mm Abl peptide as substrate. Initial experiments confirmed that the peptide assay is" @default.
• W1965828106 created "2016-06-24" @default.
• W1965828106 creator A5006286880 @default.
• W1965828106 creator A5018779172 @default.
• W1965828106 creator A5050315454 @default.
• W1965828106 creator A5059932991 @default.
• W1965828106 date "2005-03-01" @default.
• W1965828106 modified "2023-09-29" @default.
• W1965828106 title "The C Terminus of RON Tyrosine Kinase Plays an Autoinhibitory Role" @default.
• W1965828106 cites W106620489 @default.
• W1965828106 cites W1520077451 @default.
• W1965828106 cites W1607589687 @default.
• W1965828106 cites W1632558799 @default.
• W1965828106 cites W1649526546 @default.
• W1965828106 cites W1887673571 @default.
• W1965828106 cites W1965950769 @default.
• W1965828106 cites W1972494491 @default.
• W1965828106 cites W1973119106 @default.
• W1965828106 cites W1975637940 @default.
• W1965828106 cites W1976718703 @default.
• W1965828106 cites W1981981787 @default.
• W1965828106 cites W1984101180 @default.
• W1965828106 cites W1990922168 @default.
• W1965828106 cites W1992945955 @default.
• W1965828106 cites W1995624383 @default.
• W1965828106 cites W2012792646 @default.
• W1965828106 cites W2021347994 @default.
• W1965828106 cites W2031491298 @default.
• W1965828106 cites W2040194285 @default.
• W1965828106 cites W2041415161 @default.
• W1965828106 cites W2042919832 @default.
• W1965828106 cites W2049184213 @default.
• W1965828106 cites W2049507332 @default.
• W1965828106 cites W2050274692 @default.
• W1965828106 cites W2052092007 @default.
• W1965828106 cites W2055333512 @default.
• W1965828106 cites W2056163848 @default.
• W1965828106 cites W2066810358 @default.
• W1965828106 cites W2079984286 @default.
• W1965828106 cites W2089766601 @default.
• W1965828106 cites W2104812730 @default.
• W1965828106 cites W2118460316 @default.
• W1965828106 cites W2126077006 @default.
• W1965828106 cites W2158137003 @default.
• W1965828106 cites W2160803577 @default.
• W1965828106 cites W2329944909 @default.
• W1965828106 cites W2404010186 @default.
• W1965828106 doi "https://doi.org/10.1074/jbc.m412623200" @default.
• W1965828106 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15632155" @default.
• W1965828106 hasPublicationYear "2005" @default.
• W1965828106 type Work @default.
• W1965828106 sameAs 1965828106 @default.
• W1965828106 citedByCount "23" @default.
• W1965828106 countsByYear W19658281062013 @default.
• W1965828106 countsByYear W19658281062014 @default.
• W1965828106 countsByYear W19658281062015 @default.
• W1965828106 countsByYear W19658281062016 @default.
• W1965828106 countsByYear W19658281062019 @default.
• W1965828106 countsByYear W19658281062021 @default.
• W1965828106 crossrefType "journal-article" @default.
• W1965828106 hasAuthorship W1965828106A5006286880 @default.
• W1965828106 hasAuthorship W1965828106A5018779172 @default.
• W1965828106 hasAuthorship W1965828106A5050315454 @default.
• W1965828106 hasAuthorship W1965828106A5059932991 @default.
• W1965828106 hasBestOaLocation W19658281061 @default.
• W1965828106 hasConcept C108636557 @default.
• W1965828106 hasConcept C184235292 @default.
• W1965828106 hasConcept C185592680 @default.
• W1965828106 hasConcept C2776165026 @default.
• W1965828106 hasConcept C42362537 @default.
• W1965828106 hasConcept C55493867 @default.
• W1965828106 hasConcept C62478195 @default.
• W1965828106 hasConcept C86803240 @default.
• W1965828106 hasConcept C90059517 @default.
• W1965828106 hasConcept C95444343 @default.
• W1965828106 hasConceptScore W1965828106C108636557 @default.
• W1965828106 hasConceptScore W1965828106C184235292 @default.
• W1965828106 hasConceptScore W1965828106C185592680 @default.
• W1965828106 hasConceptScore W1965828106C2776165026 @default.
• W1965828106 hasConceptScore W1965828106C42362537 @default.
• W1965828106 hasConceptScore W1965828106C55493867 @default.
• W1965828106 hasConceptScore W1965828106C62478195 @default.
• W1965828106 hasConceptScore W1965828106C86803240 @default.
• W1965828106 hasConceptScore W1965828106C90059517 @default.
• W1965828106 hasConceptScore W1965828106C95444343 @default.
• W1965828106 hasIssue "10" @default.
• W1965828106 hasLocation W19658281061 @default.
• W1965828106 hasOpenAccess W1965828106 @default.
• W1965828106 hasPrimaryLocation W19658281061 @default.
• W1965828106 hasRelatedWork W1807266461 @default.
• W1965828106 hasRelatedWork W1963500867 @default.
• W1965828106 hasRelatedWork W1966417922 @default.
• W1965828106 hasRelatedWork W1989437563 @default.
• W1965828106 hasRelatedWork W2007750331 @default.
• W1965828106 hasRelatedWork W2024504837 @default.
• W1965828106 hasRelatedWork W2044732680 @default.
• W1965828106 hasRelatedWork W2051873991 @default.
• W1965828106 hasRelatedWork W2121040984 @default.

• next