FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1966268002> ?p ?o ?g. }

• W1966268002 endingPage "25480" @default.
• W1966268002 startingPage "25475" @default.
• W1966268002 abstract "Senile plaques are primarily comprised of deposits of the β-amyloid protein derived from larger amyloid precursor proteins (APPs). APP is a member of a gene family, including amyloid precursor-like proteins APLP1 and APLP2.Using interspecific mouse backcross mapping, we localized the mouse APLP2 gene to the proximal region of mouse chromosome 9, syntenic with a region of human 11q.We cloned an ˜1.2-kilobase mouse genomic fragment containing the APLP2 gene promoter. The APLP2 promoter lacks a typical TATA box, is GC-rich, and contains several sequences for transcription factor binding. S1 nuclease protection analysis revealed the presence of multiple transcription start sites. The lack of a TATA box, the presence of a high GC content, and multiple transcription start sites place the APLP2 promoter in the class of promoters of “housekeeping genes.”Regulatory regions within the promoter were assayed by transfection of mouse N2a and Ltk- cells with constructs containing progressive 5′-deletions of the APLP2 promoter fused to the bacterial chloramphenicol acetyl transferase (CAT) reporter gene. A minimal region that includes sequences 99 bp upstream of the predominant transcription start site of the APLP2 promoter was sufficient to direct high levels of CAT expression. Senile plaques are primarily comprised of deposits of the β-amyloid protein derived from larger amyloid precursor proteins (APPs). APP is a member of a gene family, including amyloid precursor-like proteins APLP1 and APLP2. Using interspecific mouse backcross mapping, we localized the mouse APLP2 gene to the proximal region of mouse chromosome 9, syntenic with a region of human 11q. We cloned an ˜1.2-kilobase mouse genomic fragment containing the APLP2 gene promoter. The APLP2 promoter lacks a typical TATA box, is GC-rich, and contains several sequences for transcription factor binding. S1 nuclease protection analysis revealed the presence of multiple transcription start sites. The lack of a TATA box, the presence of a high GC content, and multiple transcription start sites place the APLP2 promoter in the class of promoters of “housekeeping genes.” Regulatory regions within the promoter were assayed by transfection of mouse N2a and Ltk- cells with constructs containing progressive 5′-deletions of the APLP2 promoter fused to the bacterial chloramphenicol acetyl transferase (CAT) reporter gene. A minimal region that includes sequences 99 bp upstream of the predominant transcription start site of the APLP2 promoter was sufficient to direct high levels of CAT expression. Senile plaques and neurofibrillary tangles constitute two of the neuropathological hallmarks of Alzheimer's disease. The predominant constituent of senile plaques is the 4-kDa β-amyloid peptide, derived from larger amyloid precursor proteins (APPs) 1The abbreviations used are: APPamyloid precursor proteinAP-1 and AP-2activator protein 1 and 2, respectivelyAPLPamyloid precursor-like proteinbpbase pair(s)kbkilobase(s)CATchloramphenicol acetyltransferaseEts1E26 avian leukemia oncogeneLdlrlow density lipoprotein receptorPenkpreproenkephalinPCRpolymerase chain reactionRT-PCRreverse transcriptase-PCRSP-1promoter-specific transcription factorCHOChinese hamster ovaryPIPESpiperazine-N,N‘-bis(2-ethanesulfonic acid)BESN,N-bis[2-hydroxyethyl]-2-aminoethanesulfonic acid. (1Glenner G.G. Wong C.W. Biochem. Biophys. Res. Commun. 1984; 120: 885-890Crossref PubMed Scopus (4244) Google Scholar, 2Masters C.L. Multhaup G. Simms G. Pottgieser J. Martins R.N. Beyreuther K. EMBO J. 1985; 4: 2757-2763Crossref PubMed Scopus (806) Google Scholar). APP is a member of a larger gene family including amyloid precursor-like proteins APLP1 and APLP2(3Wasco W. Bupp K. Magendantz M. Gusella J.F. Tanzi R.E. Solomon F. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10758-10762Crossref PubMed Scopus (322) Google Scholar, 4Hanes J. von der Kammer H. Kristjansson G.I. Scheit K.H. Biochim. Biophys. Acta. 1993; 1216: 154-156Crossref PubMed Scopus (15) Google Scholar, 5Slunt H.H. Thinakaran G. von Koch C. Lo A.C.Y. Tanzi R.E. Sisodia S.S. J. Biol. Chem. 1994; 269: 2637-2644Abstract Full Text PDF PubMed Google Scholar, 6Sandbrink R. Masters C.L. Beyreuther K. Biochim. Biophys. Acta. 1994; 1219: 167-170Crossref PubMed Scopus (30) Google Scholar, 7Wasco W. Gurubhagavatula S. Paradis M.D. Romano D.M. Sisodia S.S. Hyman B.T. Neve R.L. Tanzi R.E. Nat. Genet. 1993; 5: 95-100Crossref PubMed Scopus (322) Google Scholar, 8Sprecher C.A. Grant F.J. Grimm G. O'Hara P.J. Norris F. Norris K. Foster D.C. Biochemistry. 1993; 32: 4481-4486Crossref PubMed Scopus (162) Google Scholar). Notably, APLP2 shares considerable sequence homology with APP with the exception of the β-amyloid domain(5Slunt H.H. Thinakaran G. von Koch C. Lo A.C.Y. Tanzi R.E. Sisodia S.S. J. Biol. Chem. 1994; 269: 2637-2644Abstract Full Text PDF PubMed Google Scholar, 7Wasco W. Gurubhagavatula S. Paradis M.D. Romano D.M. Sisodia S.S. Hyman B.T. Neve R.L. Tanzi R.E. Nat. Genet. 1993; 5: 95-100Crossref PubMed Scopus (322) Google Scholar, 8Sprecher C.A. Grant F.J. Grimm G. O'Hara P.J. Norris F. Norris K. Foster D.C. Biochemistry. 1993; 32: 4481-4486Crossref PubMed Scopus (162) Google Scholar). In earlier studies, we demonstrated that APLP2 matures through the same unusual secretory/cleavage pathway as APP. Furthermore, APLP2 pre-mRNAs are alternatively spliced to generate at least four alternatively spliced transcripts(9Sandbrink R. Masters C.L. Beyreuther K. J. Biol. Chem. 1994; 269: 14227-14234Abstract Full Text PDF PubMed Google Scholar, 10Sandbrink R. Masters C.L. Beyreuther K. Neurobiol. Dis. 1994; 1: 13-24Crossref PubMed Scopus (38) Google Scholar). Using in situ hybridization and reverse transcriptase-polymerase chain reaction (RT-PCR) approaches, we and others have demonstrated that in most adult tissues, APLP2 and APP mRNAs were expressed at similar, if not identical, levels. There are several exceptions; notably, in liver APP mRNA is essentially undetectable, but APLP2 mRNA is fairly abundant(5Slunt H.H. Thinakaran G. von Koch C. Lo A.C.Y. Tanzi R.E. Sisodia S.S. J. Biol. Chem. 1994; 269: 2637-2644Abstract Full Text PDF PubMed Google Scholar, 7Wasco W. Gurubhagavatula S. Paradis M.D. Romano D.M. Sisodia S.S. Hyman B.T. Neve R.L. Tanzi R.E. Nat. Genet. 1993; 5: 95-100Crossref PubMed Scopus (322) Google Scholar, 9Sandbrink R. Masters C.L. Beyreuther K. J. Biol. Chem. 1994; 269: 14227-14234Abstract Full Text PDF PubMed Google Scholar, 11Lorent K. Overbergh L. Moechars D. deStrooper B. van Leuven F. van den Berghe H. Neuroscience. 1995; 65: 1009-1025Crossref PubMed Scopus (139) Google Scholar). In recent studies, we have also demonstrated that specific alternatively spliced APLP2 mRNAs are differentially expressed in the olfactory epithelium(12Thinakaran G. Roskams A.J.I. Kitt C.A. Slunt H.H. Masliah E. von Koch C. Ginsberg S.D. Ronnett G.V. Reed R.R. Price D.L. Sisodia S.S. J. Neurosci. 1995; (in press)PubMed Google Scholar). Moreover, APLP2 is highly enriched in olfactory sensory axons and axon terminals in glomeruli. On the other hand, APP is expressed, albeit at lower levels, in olfactory sensory neurons and to a lesser extent in sensory axons. This suggests that APLP2 and APP are regulated differentially in selected neuronal populations. amyloid precursor protein activator protein 1 and 2, respectively amyloid precursor-like protein base pair(s) kilobase(s) chloramphenicol acetyltransferase E26 avian leukemia oncogene low density lipoprotein receptor preproenkephalin polymerase chain reaction reverse transcriptase-PCR promoter-specific transcription factor Chinese hamster ovary piperazine-N,N‘-bis(2-ethanesulfonic acid) N,N-bis[2-hydroxyethyl]-2-aminoethanesulfonic acid. In order to assess whether the differential levels of APLP2 and APP expression may be a reflection of differences in sequence elements contained within respective promoters, we cloned and characterized an ˜1.2-kb fragment of the mouse APLP2 gene promoter. The mouse APP promoter has been characterized previously(13Izumi R. Yamada T. Yoshikai S. Sasaki H. Hattori M. Sakaki Y. Gene (Amst.). 1992; 112: 189-195Crossref PubMed Scopus (67) Google Scholar). We show that the mouse APLP2 gene promoter contains several features characteristic of promoters of “housekeeping genes”; these include the lack of a typical TATA box, the presence of a high GC content, and multiple transcription start sites. These latter features of the APLP2 promoter are similar to features described for mouse, rat, and human APP promoter regions(13Izumi R. Yamada T. Yoshikai S. Sasaki H. Hattori M. Sakaki Y. Gene (Amst.). 1992; 112: 189-195Crossref PubMed Scopus (67) Google Scholar, 14Salbaum J.M. Weidemann A. Lemaire H.G. Masters C.L. Beyreuther K. EMBO J. 1988; 7: 2807-2813Crossref PubMed Scopus (248) Google Scholar, 15Hoffman P.W. Chernak J.M. Biochem. Biophys. Res. Commun. 1994; 201: 610-617Crossref PubMed Scopus (17) Google Scholar, 16La Fauci G. Lahiri D.K. Salton S.R.J. Robakis N.K. Biochem. Biophys. Res. Commun. 1989; 159: 297-304Crossref PubMed Scopus (58) Google Scholar, 17Chernak J.M. Gene (Amst.). 1993; 133: 255-260Crossref PubMed Scopus (25) Google Scholar). We assessed whether the APLP2 promoter contained positive or negative regulatory elements by transfecting mouse neuroblastoma (N2a) cells and mouse fibroblast (Ltk-) cells with constructs containing progressive 5′-truncated promoter fragments of the APLP2 gene fused with the reporter gene chloramphenicol acetyl transferase (CAT). We demonstrate that CAT expression remains fairly constant across different deletion constructs in both N2a and Ltk- cells and that a fragment representing just 99 bp upstream of the predominant transcription start site is sufficient to direct high levels of transgene expression in both cell lines. Interestingly, 5′-deletion studies of the human, mouse, and rat promoters also revealed that ˜100 bp of the respective promoters can drive high levels of expression of reporter genes(13Izumi R. Yamada T. Yoshikai S. Sasaki H. Hattori M. Sakaki Y. Gene (Amst.). 1992; 112: 189-195Crossref PubMed Scopus (67) Google Scholar, 15Hoffman P.W. Chernak J.M. Biochem. Biophys. Res. Commun. 1994; 201: 610-617Crossref PubMed Scopus (17) Google Scholar, 18Quitschke W.W. Goldgaber D. J. Biol. Chem. 1992; 267: 17362-17368Abstract Full Text PDF PubMed Google Scholar). Interspecific backcross progeny were generated by mating (C57BL/6J × Mus spretus)F1 females and C57BL/6J males as described(19Copeland N.G. Jenkins N.A. Trends Genet. 1991; 7: 113-118Abstract Full Text PDF PubMed Scopus (475) Google Scholar). A total of 205 N2 mice were used to map the APLP2 locus (see “Results and Discussion” for details). DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, Southern blot transfer, and hybridization were performed essentially as described(20Jenkins N.A. Copeland N.G. Taylor B.A. Lee B.K. J. Virol. 1982; 43: 26-36Crossref PubMed Google Scholar). All blots were prepared with Hybond-N+ nylon membrane (Amersham Corp.). The probe, an ˜2.65-kb XhoI/EcoRI fragment of mouse cDNA, was labeled with [α32P]dCTP using a nick translation labeling kit (Boehringer Mannheim); washing was done to a final stringency of 0.1 × SSCP, 0.1% SDS, 65°C. Major fragments of 21.0, 3.5, 2.9, and 2.5 kb were detected in ScaI-digested C57BL/6J DNA, and major fragments of 6.6, 4.2, and 2.7 kb were detected in ScaI-digested M. spretus DNA. The presence or absence of the 6.6-, 4.2-, and 2.7-kb M. spretus-specific fragments, which cosegregated, was followed in backcross mice. A description of the probes and restriction fragment length polymorphisms for the loci linked to APLP2 including low density lipoprotein receptor (Ldlr), preproenkephalin (Penk), and E26 avian leukemia oncogene (Ets1) has been reported previously (21Wilkie T.M. Chen Y. Gilbert D.J. Moore K.J. Yu L. Simon M.I. Copeland N.G. Jenkins N.A. Genomics. 1993; 18: 175-184Crossref PubMed Scopus (58) Google Scholar). Recombination distances were calculated as described (22Green E.L. Genetics and Probability in Animal Breeding Experiments. Oxford University Press, New York1981: 77-113Crossref Google Scholar) using the computer program SPRETUS MADNESS. Gene order was determined by minimizing the number of recombination events required to explain the allele distribution patterns. To isolate the promoter of mouse APLP2, a 67-bp fragment of the 5′-untranslated region of mouse APLP2, position −64 to +3 with respect to the translation start codon, was generated by PCR and labeled with [α-32P]dATP by random primer-initiated synthesis. This probe was used to screen a genomic DNA library, prepared from 129 SV mouse embryonic stem cells cloned into λEMBL3. Hybridization and wash conditions were 50% formamide, 6 × SSC at 42°C for 16 h, and 2 × SSC at 50°C for 15 min, followed by 0.2 × SSC at 50°C for 15 min, respectively. One positive phage contained a 14-kb SalI-SalI fragment, which included 2.8 kb of sequence upstream of the translation start codon. A 2.84-kb SalI-HindIII restriction fragment from this phage was subsequently subcloned into Bluescript KS+ (Stratagene) to generate plasmid pAPLP2P and partially sequenced with Sequenase (U.S. Biochemical Corp.). Sequences were analyzed for putative transcription factor binding sites using a MacVector version 4.1 software package. Total RNA was isolated by homogenization of mouse thymus, heart, brain, liver, kidney, lung, testes, and spleen in 4 M guanidine thiocyanate and centrifugation of the lysate over a 5.7 M cesium chloride cushion (23Chirgwin J.M. Przybyla A.E. MacDonald R.J. Rutter W.J. Biochemistry. 1979; 18: 5294-5299Crossref PubMed Scopus (16652) Google Scholar). Poly(A)+ RNA from Chinese hamster ovary (CHO) cells was prepared similarly with the addition of fractionation on an oligo(dT)-Sepharose column(24Aviv H. Leder P. Proc. Natl. Acad. Sci. U. S. A. 1972; 69: 1408-1412Crossref PubMed Scopus (5183) Google Scholar). Total cytoplasmic RNA, from confluent dishes of mouse neuroblastoma (N2a) cells and mouse fibroblast (Ltk-) cells, was isolated as described(25Sisodia S.S. Sollner-Webb B. Cleveland D.W. Mol. Cell Biol. 1987; 7: 3602-3612Crossref PubMed Scopus (91) Google Scholar). A 534-bp KpnI-HindIII fragment, extending from 494 bp upstream of the translation start site to 40 bp into exon 1, was liberated from pAPLP2P and subcloned into KpnI-HindIII-digested Bluescript KS+ (Stratagene), to generate plasmid pAPLP2S1. This plasmid was linearized with HindIII, which lies 40 bp 3′ to the translation start codon, and the 5′ ends were dephosphorylated with calf alkaline phosphatase. S1 nuclease probe was prepared by 5′ end-labeling with [γ-32P]ATP. For S1 nuclease analysis (25Sisodia S.S. Sollner-Webb B. Cleveland D.W. Mol. Cell Biol. 1987; 7: 3602-3612Crossref PubMed Scopus (91) Google Scholar) 0.02 pmol of 32P-end-labeled double-stranded DNA probe was mixed with either 20 μg of total RNA or with 1 μg of poly(A)+ RNA and hybridized in a solution containing 80% formamide, 0.4 M NaCl, 40 mM PIPES, pH 6.4, and 1 mM EDTA for 12-16 h at 57°C. Samples were then diluted 15-fold with ice-cold S1 nuclease buffer to yield a final concentration of 1 × S1 buffer (0.2 M NaCl, 30 mM NaOAc, pH 4.5, 5 mM ZnCl2, and 0.05 μg/μl salmon sperm DNA) and treated with 100 units of S1 nuclease at 25°C for 1 h. S1-resistant hybrids were fractionated by electrophoresis on 4% acrylamide, 9 M urea-containing gels, and the protected probe was visualized by autoradiography. To determine the endogenous levels of APLP2 and APP mRNA in mouse N2a and mouse Ltk- cells, 1 μg of total cytoplasmic RNA was reverse-transcribed in the presence of reverse transcriptase and random hexamer primers (Pharmacia Biotech Inc.). The first strand cDNA obtained from reverse-transcribed RNA was then subjected to PCR with degenerate primers, APP/APLP2S and APP/APLP2AS(5Slunt H.H. Thinakaran G. von Koch C. Lo A.C.Y. Tanzi R.E. Sisodia S.S. J. Biol. Chem. 1994; 269: 2637-2644Abstract Full Text PDF PubMed Google Scholar). Primer APP/APLP2S is GAGCAYGCCCRYTTCCAGAARGC, where Y = C + T and R = A + G, and encodes APLP2-751 residues 386-392 or APP-751 residues 368-374. Primer APP/APLP2AS is GGAGGTGTGTCATMACCTGGGA, where M = A + C, and is complementary to sequences that encode APLP2-751 residues 527-532 or APP-751 residues 509-514(5Slunt H.H. Thinakaran G. von Koch C. Lo A.C.Y. Tanzi R.E. Sisodia S.S. J. Biol. Chem. 1994; 269: 2637-2644Abstract Full Text PDF PubMed Google Scholar). PCR was performed at an annealing temperature of 58°C for 20 cycles. PCR generated 444-bp products consisting of a mixture of APP and APLP2 cDNAs, which were subsequently digested with XhoI to specifically cleave the APP-related species. Digested PCR products were fractionated on 2% agarose gels and stained with ethidium bromide. PCR products generated from plasmids encoding mouse APLP2 and mouse APP templates were used as controls. A ˜2.8-kb SalI-BamHI fragment, extending from ˜2.7 kb upstream of the transcription start codon to 62 bp of exon 1, was isolated by PCR using a sense primer EMBL (GCTTCTCATAGAGTCTTGCAGACAAACTGCGCAAC, located in the left arm of λEMBL3 polylinker; (26Manninen I. Schulman A.H. BioTechniques. 1993; 14: 174PubMed Google Scholar)) and an antisense primer BamHI+62 (CCGGGATCCCTCTCCCCGTCTCTCGCACAGCCAGGCTACAG, located from +62 to +31 with respect to the transcription start codon), in the presence of λ-APLP2 DNA and subcloned into SalI-BamHI-digested pBLCAT3(27Luckow B. Schuetz G. Nucleic Acids Res. 1987; 15: 5490Crossref PubMed Scopus (1401) Google Scholar), to generate plasmid pAPLP2PCAT. pAPLP2PCAT was digested with PstI and religated to generate plasmid pAPLP2PCAT-380. During this digestion, a 590-bp PstI-PstI fragment was isolated and cloned in the sense orientation into PstI-digested pAPLP2PCAT-380 to generate plasmid pAPLP2PCAT-971. APLP2 promoter fragments range from −380 to +62 in pAPLP2PCAT-380 and from −971 to +62 in pAPLP2PCAT-971 (with respect to the transcription start site). Additional promoter deletions were prepared by PCR using the following sense primers linked to a HindIII site, GCCAAGCTTCACGGTCTACCCGCGAAG, GCCAAGCTTAGCCTCGGGTCCAGAG, GCCAAGCTTGAGTCGGTGTATCCGTGCT, and GCCAAGCTTGTTATGCCGGCTCGTATTG, respectively, with antisense primer BamHI+62 in the presence of pAPLP2P. The resulting 334-bp HindIII-BamHI (−272 to +62), 302-bp HindIII-BamHI (−240 to +62), 222-bp HindIII-BamHI (−160 to +62), and 161-bp HindIII-BamHI (−99 to +62) fragments were ligated to HindIII-BamHI-digested pBLCAT3 to generate plasmids pAPLP2PCAT-272, pAPLP2PCAT-240, pAPLP2PCAT-160, and pAPLP2PCAT-99, respectively. pRSVCAT(28Gorman C.M. Moffat L. Howard B. Mol. Cell. Biol. 1982; 2: 1044-1051Crossref PubMed Scopus (5292) Google Scholar, 29Gorman C.M. Merlino G.T. Willingham M.C. Pastan I. Howard B.H. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 6777-6781Crossref PubMed Scopus (881) Google Scholar), including the Rous sarcoma virus long terminal repeat as a promoter, was used as a positive control, and pBLCAT3 containing no insert was used as a negative control. Mouse N2a cells were grown in Dulbecco's modified Eagle's medium and reduced serum-modified Eagle's medium with 10% fetal bovine serum. Cells were plated 22-26 h prior to transfection at a density of 0.25 × 106 cells/well in a 6-well dish. N2a cells were transiently transfected with 2 μg of double CsCl-purified DNA using a calcium phosphate co-precipitation procedure(30Chen C. Okayama H. Mol. Cell. Biol. 1987; 7: 2745-2752Crossref PubMed Scopus (4824) Google Scholar). 0.12 μg of pBLCAT3, or equivalent molar amounts of APLP2-CAT constructs containing various 5′-deletions of APLP2 promoter were adjusted to 2 μg with empty vector DNA. DNA was incubated with 62.5 μmol of CaCl2 and 1 × BES-buffered saline (pH 6.97) at 25°C for 20 min, and the mixture was added dropwise to each well. Cells were incubated at 3% CO2 for 16-18 h, after which time the precipitate was removed by washing cells two times with culture medium. The cells were subsequently returned to 5% CO2 for 12-14 h, washed once with 1 × phosphate-buffered saline and scraped in 200 μl of 0.25 M Tris/HCl, pH 7.9. To assay for CAT activity, 20 μg of cell lysate was incubated in the presence of 1.1 mM acetyl CoA, 100 nCi of [14C]chloramphenicol (60 mCi/mmol) in 0.22 M Tris/HCl, pH 7.7, at 37°C for 45 min. Acetylated and nonacetylated forms of chloramphenicol were extracted with 0.5 ml of ethyl acetate and separated by ascending silica gel thin-layer chromatography in chloroform:methanol (95:5) at room temperature. Thin-layer chromatography sheets were then air-dried, and acetylated and nonacetylated forms of chloramphenicol were quantified using a PhosphorImager. The percentages of monoacetylated forms of chloramphenicol were plotted for each construct and normalized to the CAT activity of pRSVCAT. Each construct was tested in three separate transfections, and standard error of the mean was determined. For transfections of mouse fibroblast Ltk- cells, cells were plated at a density of 0.2 × 106 cells/well in a 6-well dish. Cells were transiently transfected with 4.26 μg of pBLCAT3 or equivalent molar amounts of CAT plasmids containing various 5′-deletions of the APLP2 promoter adjusted to 7 μg with empty vector DNA. 20 μg of cell lysate was used for CAT assays. Recent studies have indicated that APP is a member of a larger gene family that includes APLP1 and APLP2. The physiological function(s) and regulation of the APP-related proteins is not well understood. In this study, we mapped the genomic location of APLP2 and have analyzed the APLP2 promoter for the presence of potential regulatory sequences that may be involved in transcriptional activity of the APLP2 gene. The chromosomal location of the mouse APLP2 gene was determined by interspecific backcross analysis using progeny derived from matings of ((C57BL/6J × M. spretus)F1× C57BL/6J) mice. This interspecific backcross mapping panel has been typed for over 1800 loci that are well distributed among all of the autosomes as well as the X chromosome(19Copeland N.G. Jenkins N.A. Trends Genet. 1991; 7: 113-118Abstract Full Text PDF PubMed Scopus (475) Google Scholar). C57BL/6J and M. spretus DNAs were digested with several enzymes and analyzed by Southern blot hybridization for informative restriction fragment length polymorphisms using a mouse cDNA APLP2 probe. The 6.6-, 4.2-, and 2.7-kb M. spretus restriction fragment length polymorphisms (see “Materials and Methods”) were used to follow the segregation of the APLP2 locus in backcross mice. The mapping results indicated that APLP2 is located in the proximal region of mouse chromosome 9 linked to Ldlr, Penk, and Ets1. Although 152 mice were analyzed for every marker and are shown in the segregation analysis (Fig. 1), up to 185 mice were typed for some pairs of markers. Each locus was analyzed in pairwise combinations for recombination frequencies using the additional data. The ratios of the total number of mice exhibiting recombinant chromosomes to the total number of mice analyzed for each pair of loci and the most likely gene order are: centromere, Ldlr (3/162) Penk (13/185) APLP2 (5/158) Ets1. The recombination frequencies (expressed as genetic distances in centimorgans ± the standard error) are as follows: Ldlr (1.9 ± 1.1) Penk (7.0 ± 1.9) APLP2 (3.2 ± 1.4) Ets1. We have compared our interspecific map of chromosome 9 with a composite mouse linkage map that reports the map location of many uncloned mouse mutations (provided from the Mouse Genome data base, a computerized data base maintained at The Jackson Laboratory, Bar Harbor, ME). APLP2 mapped in a region of the composite map that lacks mouse mutations with a phenotype that might be expected for an alteration in this locus (data not shown). The proximal region of mouse chromosome 9 shares regions of homology with human chromosomes 19p, 8q, and 11q (summarized in Fig. 1). The recent assignment of APLP2 to 11q23-q25 (31von der Kammer H. Loeffler C. Hanes J. Klaudiny J. Scheit K.H. Hansmann I. Genomics. 1994; 10: 308-311Crossref Scopus (22) Google Scholar) confirms and extends the synteny between mouse chromosome 9 and human 11q. RNA prepared from CHO cells and several mouse tissues was subjected to S1 nuclease protection analysis using a double-stranded DNA probe 5′ end-labeled 40 bp downstream of the translation start codon (Fig. 2A). Although the predominant start site is located ˜89 bp upstream of the translation start codon, there appeared to be variable levels of alternatively initiated APLP2 transcripts in mRNA isolated from CHO cells or from mouse thymus, heart, brain, liver, kidney, lung, testes, and spleen (Fig. 2B, lanes 1 and 2-9, respectively). Primer extension analysis also revealed the presence of multiple transcription start sites in mouse tissues (data not shown). Multiple transcription start sites have been identified for human (14Salbaum J.M. Weidemann A. Lemaire H.G. Masters C.L. Beyreuther K. EMBO J. 1988; 7: 2807-2813Crossref PubMed Scopus (248) Google Scholar) and rat (15Hoffman P.W. Chernak J.M. Biochem. Biophys. Res. Commun. 1994; 201: 610-617Crossref PubMed Scopus (17) Google Scholar) APP mRNA, with the predominant start sites located 146 and 156 bp upstream of the translation start codons, respectively. However, the transcription start site of mouse APP has not yet been reported. We screened ˜800,000 independent phage-containing genomic DNA from a 129 SV embryonic stem cell library with a 67-bp fragment of the 5′-untranslated region of APLP2 (position −64 to +3 with respect to the translation start codon). We obtained two overlapping phage with the longest insert containing 2.8 kb of sequence upstream of the translation start codon. ˜1.2 kb of this promoter region was sequenced (Fig. 3). The DNA sequence upstream of the predominant transcription start site contains a CAAT box (−135 in antisense orientation) but lacks a typical TATA box (Fig. 3). The promoter has a high GC content, specifically between positions −1 and −300 (68%) and −500 and −700 (69%). Multiple consensus sequences for transcription factor binding sites are present in the entire region, including one AP-1, two AP-2s, five GC boxes, one GC element, two GC factors, and seven SP-1 sites. Similar putative transcription factor binding sites are found in the APP promoter, however, at different locations with respect to the transcription start site(13Izumi R. Yamada T. Yoshikai S. Sasaki H. Hattori M. Sakaki Y. Gene (Amst.). 1992; 112: 189-195Crossref PubMed Scopus (67) Google Scholar, 14Salbaum J.M. Weidemann A. Lemaire H.G. Masters C.L. Beyreuther K. EMBO J. 1988; 7: 2807-2813Crossref PubMed Scopus (248) Google Scholar, 16La Fauci G. Lahiri D.K. Salton S.R.J. Robakis N.K. Biochem. Biophys. Res. Commun. 1989; 159: 297-304Crossref PubMed Scopus (58) Google Scholar, 17Chernak J.M. Gene (Amst.). 1993; 133: 255-260Crossref PubMed Scopus (25) Google Scholar). Furthermore, the APP promoter contains sites for transcription factors not present in the APLP2 promoter, including a potential heat shock element and an overlapping AP-1/AP-4 site(14Salbaum J.M. Weidemann A. Lemaire H.G. Masters C.L. Beyreuther K. EMBO J. 1988; 7: 2807-2813Crossref PubMed Scopus (248) Google Scholar, 16La Fauci G. Lahiri D.K. Salton S.R.J. Robakis N.K. Biochem. Biophys. Res. Commun. 1989; 159: 297-304Crossref PubMed Scopus (58) Google Scholar, 18Quitschke W.W. Goldgaber D. J. Biol. Chem. 1992; 267: 17362-17368Abstract Full Text PDF PubMed Google Scholar), suggesting that the transcriptional regulation of APLP2 and APP genes may be dissimilar. The presence of multiple transcription start sites, the absence of a typical TATA box, the high GC content, and the presence of GC-rich boxes places the APLP2 promoter in the class of promoters of housekeeping genes; these include the human, rat, and mouse APP genes (13Izumi R. Yamada T. Yoshikai S. Sasaki H. Hattori M. Sakaki Y. Gene (Amst.). 1992; 112: 189-195Crossref PubMed Scopus (67) Google Scholar, 14Salbaum J.M. Weidemann A. Lemaire H.G. Masters C.L. Beyreuther K. EMBO J. 1988; 7: 2807-2813Crossref PubMed Scopus (248) Google Scholar, 16La Fauci G. Lahiri D.K. Salton S.R.J. Robakis N.K. Biochem. Biophys. Res. Commun. 1989; 159: 297-304Crossref PubMed Scopus (58) Google Scholar, 17Chernak J.M. Gene (Amst.). 1993; 133: 255-260Crossref PubMed Scopus (25) Google Scholar), the adenosine deaminase gene(32Valerio D. Duyvesteyn M.G.C. Dekker B.M.M. Weeda G. Berkvens T.M. van der Voorn L. van Ormondt G. van der Eb A.J. EMBO J. 1985; 4: 437-443Crossref PubMed Scopus (171) Google Scholar), the dihydrofolate reductase gene(33Crouse G.F. Simonsen C.C. McEwan R.N. Schimke R.T. J. Biol. Chem. 1982; 257: 7887-7897Abstract Full Text PDF PubMed Google Scholar), and the hamster prion gene(34Basler K. Oesch B. Scott M. Westaway D. Walchli M. Groth D.F. McKinley M.P. Prusiner S.B. Weissmann C. Cell. 1986; 46: 417-428Abstract Full Text PDF PubMed Scopus (645) Google Scholar). Recently, the upstream AP-1 site (position −350 with respect to the predominant transcription start site) in the APP promoter has been implicated in protein kinase C mediated up-regulation of APP gene expression(35Trejo J. Massamiri T. Deng T. Dewji N.N. Bayney R.M. Heller Brown J. J. Biol. Chem. 1994; 269: 21682-21690Abstract Full Text PDF PubMed Google Scholar). The AP-1 binding activity is thought to be composed of Jun-Jun homodimers. Interleukin-1, nerve growth factor, and retinoic acid, agents known to increase APP gene expression, have been shown to induce c-jun and c-fos expression and cause transcriptional activation of target genes through AP-1 sites(36Gizang-Ginsberg E. Ziff E.B. Genes & Dev. 1990; 4: 477-491Crossref PubMed Scopus (224) Google Scholar, 37Muegge K. Williams T.M. Kant J. Karin M. Chiu R. Schmidt A. Siebenlist U. Young H.A. Durum S.K. Science. 1989; 246: 249-251Crossref PubMed Scopus (202) Google Scholar, 38Bartel D.P. Sheng M. Lau L.F. Greenberg M.E. Genes & Dev. 1989; 3: 304-313Crossref PubMed Scopus (396) Google Scholar, 39Yang-Yen H. Chiu R. Karin M. New Biol. 1990; 2: 351-361PubMed Google Scholar). Furthermore, interleukin-1 effects are thought to involve protein kinase C activation(40Goldgaber D. Harris H.W. Hla T. Maciag T. Donnelly R.J. Jacobsen J.S. Vitek M.P. Gajdusek D.C. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7606-7610Crossref PubMed Scopus (526) Google Scholar). It remains to be determined if APLP2 gene expression is also regulated by interleukin-1, nerve growth factor, and retinoic acid, particularly in view of the presence of a potential AP-1 site located at position −982. To identify regulatory sequences responsible for the expression of the mouse APLP2 gene, we constructed plasmids containing progressive 5′-deletions of the APLP2 promoter fused upstream of the bacterial reporter gene CAT, as diagrammed in Fig. 4B. Equimolar amounts of each construct were transfected into mouse neuroblastoma (N2a) (Fig. 4C) and mouse fibroblast (Ltk-) (Fig. 4D) cells. RT-PCR analysis of cytoplasmic RNA from mouse N2a and mouse Ltk- cells with degenerate primers which hybridize to both APLP2 and APP mRNA revealed that these two cell lines express moderate levels of endogenous APLP2 mRNA (Fig. 4A, lanes 1 and 2). Hence, we concluded that these cell lines would be appropriate for analysis of the APLP2 promoter. Progressive 5′-deletions from position −971 to position −99, with respect to the predominant transcription start site, had no significant effect on promoter activity in either of the two cell lines tested. These findings suggest that in N2a and Ltk- cells, 99 bp of the APLP2 promoter are sufficient for directing high levels of promoter activity. Similarly, studies that analyzed progressive 5′-deletions of the APP promoter from human, mouse, and rat have shown that reporter gene expression levels remained fairly constant up to approximately 100 bp upstream of the predominant transcription start site(13Izumi R. Yamada T. Yoshikai S. Sasaki H. Hattori M. Sakaki Y. Gene (Amst.). 1992; 112: 189-195Crossref PubMed Scopus (67) Google Scholar, 15Hoffman P.W. Chernak J.M. Biochem. Biophys. Res. Commun. 1994; 201: 610-617Crossref PubMed Scopus (17) Google Scholar, 18Quitschke W.W. Goldgaber D. J. Biol. Chem. 1992; 267: 17362-17368Abstract Full Text PDF PubMed Google Scholar). In summary, we have localized APLP2 to the proximal region of mouse chromosome 9, characterized ˜1.2 kb of the APLP2 promoter, and shown it to contain features characteristic of promoters in the class of housekeeping genes. We further showed that 99 bp upstream of the predominant transcription start site are sufficient to direct high levels of promoter activity. Given the similarities in overall structure of the APLP2 and APP promoters and the minimal sequence requirements for transcription initiation, it is highly likely that additional sequence elements distal to the regions analyzed here are responsible for differential expression of APLP2/APP in specific neuronal populations or systemic organs (i.e. liver). Further studies will be directed toward using transgenic strategies with larger genomic fragments to clarify these issues with the eventual goal of identifying transcription factors responsible for mediating basal level of APLP2 gene expression. We thank Dave Bol for providing the 129 SV embryonic stem cell genomic library and Mary Barnstead for excellent technical assistance." @default.
• W1966268002 created "2016-06-24" @default.
• W1966268002 creator A5010416927 @default.
• W1966268002 creator A5030034684 @default.
• W1966268002 creator A5035350944 @default.
• W1966268002 creator A5064614154 @default.
• W1966268002 creator A5065042659 @default.
• W1966268002 creator A5068784832 @default.
• W1966268002 creator A5083481724 @default.
• W1966268002 date "1995-10-01" @default.
• W1966268002 modified "2023-09-26" @default.
• W1966268002 title "The Mouse APLP2 Gene" @default.
• W1966268002 cites W1502339211 @default.
• W1966268002 cites W1534119891 @default.
• W1966268002 cites W1562523373 @default.
• W1966268002 cites W1592880910 @default.
• W1966268002 cites W1598870275 @default.
• W1966268002 cites W1615018161 @default.
• W1966268002 cites W1628335029 @default.
• W1966268002 cites W1657789828 @default.
• W1966268002 cites W1758831574 @default.
• W1966268002 cites W1869274906 @default.
• W1966268002 cites W1954929088 @default.
• W1966268002 cites W1965617697 @default.
• W1966268002 cites W1982598173 @default.
• W1966268002 cites W1982929714 @default.
• W1966268002 cites W1990493528 @default.
• W1966268002 cites W199686417 @default.
• W1966268002 cites W2010356985 @default.
• W1966268002 cites W2011802630 @default.
• W1966268002 cites W2012421057 @default.
• W1966268002 cites W2014310159 @default.
• W1966268002 cites W2023463516 @default.
• W1966268002 cites W2032920422 @default.
• W1966268002 cites W2038718099 @default.
• W1966268002 cites W2039487593 @default.
• W1966268002 cites W2042458199 @default.
• W1966268002 cites W2051968416 @default.
• W1966268002 cites W2060253596 @default.
• W1966268002 cites W2060333964 @default.
• W1966268002 cites W2066160869 @default.
• W1966268002 cites W2068225545 @default.
• W1966268002 cites W2070456004 @default.
• W1966268002 cites W2072935057 @default.
• W1966268002 cites W2086048645 @default.
• W1966268002 cites W2088948837 @default.
• W1966268002 cites W2144206181 @default.
• W1966268002 cites W4244405070 @default.
• W1966268002 doi "https://doi.org/10.1074/jbc.270.43.25475" @default.
• W1966268002 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7592716" @default.
• W1966268002 hasPublicationYear "1995" @default.
• W1966268002 type Work @default.
• W1966268002 sameAs 1966268002 @default.
• W1966268002 citedByCount "20" @default.
• W1966268002 countsByYear W19662680022014 @default.
• W1966268002 countsByYear W19662680022015 @default.
• W1966268002 countsByYear W19662680022016 @default.
• W1966268002 crossrefType "journal-article" @default.
• W1966268002 hasAuthorship W1966268002A5010416927 @default.
• W1966268002 hasAuthorship W1966268002A5030034684 @default.
• W1966268002 hasAuthorship W1966268002A5035350944 @default.
• W1966268002 hasAuthorship W1966268002A5064614154 @default.
• W1966268002 hasAuthorship W1966268002A5065042659 @default.
• W1966268002 hasAuthorship W1966268002A5068784832 @default.
• W1966268002 hasAuthorship W1966268002A5083481724 @default.
• W1966268002 hasBestOaLocation W19662680021 @default.
• W1966268002 hasConcept C104317684 @default.
• W1966268002 hasConcept C54355233 @default.
• W1966268002 hasConcept C86803240 @default.
• W1966268002 hasConcept C95444343 @default.
• W1966268002 hasConceptScore W1966268002C104317684 @default.
• W1966268002 hasConceptScore W1966268002C54355233 @default.
• W1966268002 hasConceptScore W1966268002C86803240 @default.
• W1966268002 hasConceptScore W1966268002C95444343 @default.
• W1966268002 hasIssue "43" @default.
• W1966268002 hasLocation W19662680021 @default.
• W1966268002 hasOpenAccess W1966268002 @default.
• W1966268002 hasPrimaryLocation W19662680021 @default.
• W1966268002 hasRelatedWork W1828691184 @default.
• W1966268002 hasRelatedWork W1903732681 @default.
• W1966268002 hasRelatedWork W1991523530 @default.
• W1966268002 hasRelatedWork W2001677368 @default.
• W1966268002 hasRelatedWork W2002128513 @default.
• W1966268002 hasRelatedWork W2020824267 @default.
• W1966268002 hasRelatedWork W2057739827 @default.
• W1966268002 hasRelatedWork W2120393042 @default.
• W1966268002 hasRelatedWork W2171277769 @default.
• W1966268002 hasRelatedWork W2092874662 @default.
• W1966268002 hasVolume "270" @default.
• W1966268002 isParatext "false" @default.
• W1966268002 isRetracted "false" @default.
• W1966268002 magId "1966268002" @default.
• W1966268002 workType "article" @default.