FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1966320426> ?p ?o ?g. }

• W1966320426 endingPage "18782" @default.
• W1966320426 startingPage "18776" @default.
• W1966320426 abstract "We present viral evolution as a novel and powerful method to optimize non-viral proteins. We used this approach to optimize the tetracycline (Tc)-regulated gene expression system (Tet system) for its function in mammalian cells. The components of the Tet system were incorporated in the human immunodeficiency virus (HIV)-1 virus such that viral replication is controlled by this regulatory system. Upon long term replication of this HIV-rtTA virus in human T cells, we obtained a virus variant with an enhanced replication potential resulting from an improved rtTA component of the introduced Tet system. We identified a single amino acid exchange, F86Y, which enhances the transcriptional activity and doxycycline (dox) sensitivity of rtTA. We generated a new rtTA variant that is 5-fold more active at high dox levels than the initial rtTA, and 25-fold more sensitive to dox, whereas the background activity in the absence of dox is not increased. This new rtTA variant will be very useful in biological applications that require a more sensitive or active Tet system. Our results demonstrate that the viral evolution strategy can be used to improve the activity of genes by making them an integral and essential part of the virus. We present viral evolution as a novel and powerful method to optimize non-viral proteins. We used this approach to optimize the tetracycline (Tc)-regulated gene expression system (Tet system) for its function in mammalian cells. The components of the Tet system were incorporated in the human immunodeficiency virus (HIV)-1 virus such that viral replication is controlled by this regulatory system. Upon long term replication of this HIV-rtTA virus in human T cells, we obtained a virus variant with an enhanced replication potential resulting from an improved rtTA component of the introduced Tet system. We identified a single amino acid exchange, F86Y, which enhances the transcriptional activity and doxycycline (dox) sensitivity of rtTA. We generated a new rtTA variant that is 5-fold more active at high dox levels than the initial rtTA, and 25-fold more sensitive to dox, whereas the background activity in the absence of dox is not increased. This new rtTA variant will be very useful in biological applications that require a more sensitive or active Tet system. Our results demonstrate that the viral evolution strategy can be used to improve the activity of genes by making them an integral and essential part of the virus. Technology for the regulation of gene expression in mammalian cells and tissues is of primary importance for a wide variety of basic and applied biological research areas, including functional genomics, gene therapy, animal models for human diseases, and biopharmaceutical protein production. All these applications require that production of the protein(s) of interest be regulated in both a quantitative and temporal way. For this purpose, artificial gene expression systems have been developed that are controlled by effector molecules in a dose-dependent and reversible manner. The most frequently used regulatory circuit is the so-called Tet system, which allows stringent control of gene expression by tetracycline (Tc) 1The abbreviations used are: Tc, tetracycline; dox, doxycycline; r, reverse; HIV-1, human immunodeficiency virus, type 1; FBS, fetal bovine serum; CMV, cytomegalovirus; ELISA, enzyme-linked immunosorbent assay; TAR, trans-acting response region; LTR, long terminal repeat; wt, wild type; CSR, compartmentalized self-replication. 1The abbreviations used are: Tc, tetracycline; dox, doxycycline; r, reverse; HIV-1, human immunodeficiency virus, type 1; FBS, fetal bovine serum; CMV, cytomegalovirus; ELISA, enzyme-linked immunosorbent assay; TAR, trans-acting response region; LTR, long terminal repeat; wt, wild type; CSR, compartmentalized self-replication. or its derivative doxycycline (dox) (1Gossen M. Bujard H. Nelson M. Hillen W. Greenwald R.A. Tetracyclines in Biology, Chemistry and Medicine. Birkhäuser Verlag, Basel2001: 139-157Google Scholar, 2Baron U. Bujard H. Methods Enzymol. 2000; 327: 401-421Google Scholar, 3Freundlieb S. Baron U. Bonin A.L. Gossen M. Bujard H. Methods Enzymol. 1997; 283: 159-173Google Scholar). The Tet system is based on the specific, high affinity binding of the Escherichia coli Tet repressor protein (TetR) to the tet operator (tetO) sequence. Tc and dox induce a conformational change in TetR, which impedes the interaction with tetO. Fusion of the activation domain of the herpes simplex virus VP16 protein to TetR resulted in the transcriptional activator tTA, which induces gene expression from promoters placed downstream of tetO elements (Ptet) in eukaryotic cells. The presence of Tc or dox abolishes this gene expression. A tTA variant with four amino acid substitutions in the TetR moiety exhibits a reverse phenotype (4Gossen M. Freundlieb S. Bender G. Muller G. Hillen W. Bujard H. Science. 1995; 268: 1766-1769Google Scholar). This reverse tTA (rtTA) binds to Ptet, and activates gene expression in the presence of dox but not in its absence. The Tet system is now widely applied to control gene expression in eukaryotes, including mammals, plants, and insects (reviewed in Ref. 1Gossen M. Bujard H. Nelson M. Hillen W. Greenwald R.A. Tetracyclines in Biology, Chemistry and Medicine. Birkhäuser Verlag, Basel2001: 139-157Google Scholar). Since the Tet system originates from a bacterial regulatory system, it seems likely that the components can be optimized for their new transcriptional function in mammalian cells.A commonly used strategy to improve or alter a specific biological function is directed evolution, which involves genetic diversification followed by selection. This strategy mimics natural evolution, but in a guided and accelerated fashion. In the first step of this approach, cloned DNA sequences, for example encoding a protein, are mutated via random mutagenesis or recombination, resulting in a library of related mutant sequences. In the second step, the mutant sequences with improved or novel function are selected from this library through careful screening in an in vitro or in vivo assay. Directed evolution has been used to change the activity, selectivity, or stability of enzymes (reviewed in Refs. 5Farinas E.T. Bulter T. Arnold F.H. Curr. Opin. Biotechnol. 2001; 12: 545-551Google Scholar and 6Sutherland J.D. Curr. Opin. Chem. Biol. 2000; 4: 263-269Google Scholar) but also to improve viral vector stability (7Powell S.K. Kaloss M.A. Pinkstaff A. McKee R. Burimski I. Pensiero M. Otto E. Stemmer W.P. Soong N.W. Nat. Biotechnol. 2000; 18: 1279-1282Google Scholar), cytokine efficacy (8Leong S.R. Chang J.C. Ong R. Dawes G. Stemmer W.P. Punnonen J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 1163-1168Google Scholar), and antibody fragment binding (9Boder E.T. Midelfort K.S. Wittrup K.D. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 10701-10705Google Scholar). Recently, Yokobayashi et al. (10Yokobayashi Y. Weiss R. Arnold F.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 16587-16591Google Scholar) successfully applied directed evolution to genes comprising a simple genetic circuit and demonstrated that a nonfunctional circuit containing improperly matched components could evolve rapidly into a functional one (10Yokobayashi Y. Weiss R. Arnold F.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 16587-16591Google Scholar, 11Hasty J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 16516-16518Google Scholar). The success of direct evolution depends on both the realization of a sufficiently large genetic diversity and the effectiveness of the selection procedure.Previous optimizations of the Tet system were based on the introduction of rationally designed mutations, and on directed evolution, in which large scale mutagenesis of the components of the Tet system was followed by functional screening of the mutants in bacterial or yeast assay systems (12Urlinger S. Baron U. Thellmann M. Hasan M.T. Bujard H. Hillen W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 7963-7968Google Scholar, 13Baumeister R. Helbl V. Hillen W. J. Mol. Biol. 1992; 226: 1257-1270Google Scholar, 14Baron U. Schnappinger D. Helbl V. Gossen M. Hillen W. Bujard H. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1013-1018Google Scholar, 15Baron U. Gossen M. Bujard H. Nucleic Acids Res. 1997; 25: 2723-2729Google Scholar). However, these approaches are labor intensive, and mutations selected in a bacterial or yeast assay system may not be improvements in higher eukaryotes. We here present viral evolution as a novel and powerful method to optimize non-viral proteins. We used this approach to optimize the Tet system for its function in mammalian cells. The components of the Tet system were incorporated into the HIV-1 virus such that virus replication is controlled by this regulatory system. During replication of this virus on human T cells, genetic diversity is continuously generated due to the error-prone reverse transcription process, followed by outgrowth of faster replicating variants. Thus, the generation of genetic diversity and selection of improved variants are combined in this natural evolution approach. In this way, we have selected for HIV variants with improved replication capacity resulting from an improved rtTA-component of the introduced Tet system. The observed rtTA mutation does not only improve virus replication but also the Tet system.EXPERIMENTAL PROCEDURESCells and Viruses—SupT1 T cells were grown at 37 °C and 5% CO2 in RPMI 1640 medium containing 10% fetal bovine serum (FBS), 100 units/ml penicillin, 100 units/ml streptomycin. SupT1 cells were transfected with HIV-1 molecular clones by electroporation. Briefly, 5 × 106 cells were washed in RPMI 1640 with 20% FBS and mixed with 1–10 μg of DNA in 250 μl of RPMI 1640 with 20% FBS. Cells were electroporated in 0.4-cm cuvettes at 250 V and 960 microfarads and subsequently resuspended in RPMI 1640 with 10% FBS. Cells were split 1 to 10 twice a week.HeLa X1/6 cells (15Baron U. Gossen M. Bujard H. Nucleic Acids Res. 1997; 25: 2723-2729Google Scholar) are derivatives of the HeLa cervix carcinoma cell line and harbor chromosomally integrated copies of the CMV-7tetO promoter/luciferase reporter construct pUHC13–3 (16Gossen M. Bujard H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5547-5551Google Scholar). HeLa X1/6 and C33A cervix carcinoma cells (ATCC HTB31) (17Auersperg N. J. Nat. Cancer Inst. 1964; 32: 135-163Google Scholar) were grown at 37 °C and 5% CO2 as a monolayer in Dulbecco's modified Eagle's medium supplemented with 10% FBS, minimal essential medium nonessential amino acids, 100 units/ml penicillin, and 100 units/ml streptomycin. Cells were transfected by the calcium phosphate method. Cells were grown in 1 ml of culture medium in 2-cm2 wells of a 24-well plate to 60% confluence. 1 μg of DNA in 15 μl of water was mixed with 25 μl of 50 mm HEPES (pH 7.1)-250 mm NaCl-1.5 mm Na2HPO4 and 10 μl of 0.6 m CaCl2, incubated at room temperature for 20 min, and added to the culture medium. The culture medium was refreshed after 16 h.The incorporation of the Tet system into the HIV-1 genome was described previously (18Verhoef K. Marzio G. Hillen W. Bujard H. Berkhout B. J. Virol. 2001; 75: 979-987Google Scholar). The HIVrtTA used in this study is the KYK version, which contains the inactivating Y26A mutation in the Tat gene and five nucleotide substitutions in the TAR (trans-acting response region) hairpin motif. This virus contains the rtTA2S-S2 gene (12Urlinger S. Baron U. Thellmann M. Hasan M.T. Bujard H. Hillen W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 7963-7968Google Scholar) in place of the nef gene and eight tetO sequences in the LTR promoter region.For the selection of viruses with improved replication capacity, 10 μg of the HIVrtTA molecular clone was transfected into SupT1 cells. Cells were cultured in the presence of 1 μg/ml doxycycline (Sigma) for up to 114 days. When HIV-induced cytopathic effects were seen, high level virus replication was maintained by passage of the cell-free culture supernatant onto uninfected SupT1 cells. Cell and supernatant samples were isolated and stored at -80 °C. An HIVLAI virus stock was produced by transfection of 10 μg of the corresponding molecular clone (19Peden K. Emerman M. Montagnier L. Virology. 1991; 185: 661-672Google Scholar) into SupT1 cells. Virus was quantitated by CA-p24 antigen ELISA (Abbott) (20Back N.K.T. Nijhuis M. Keulen W. Boucher C.A.B. Oude Essink B.B. van Kuilenburg A.B.P. Van Gennip A.H. Berkhout B. EMBO J. 1996; 15: 4040-4049Google Scholar).Proviral DNA Analysis and Cloning of Revertant Sequences—HIV-1-infected cells were pelleted by centrifugation at 4000 rpm for 4 min and washed with phosphate-buffered saline. DNA was solubilized by resuspending the cells in 10 mm Tris-HCl (pH 8.0)-1 mm EDTA-0.5% Tween 20, followed by incubation with 200 μg of proteinase K/ml at 56 °C for 30 min and at 95 °C for 10 min. Proviral DNA sequences were PCR amplified from total cellular DNA, using the 5′ primer nef-seq1 (positions 56 to 37 upstream of the rtTA translation start site) and the 3′ U3 primer anti-U3-att (positions 63 to 44 downstream of the rtTA translation stop codon). PCR fragments were digested with XcmI and SmaI and cloned into the corresponding sites in the shuttle vector pBlue3′LTRext-ΔU3-rtTA-2ΔtetO, which is identical to the vector pBlue3′LTRext-ΔU3-rtTA-K8-TAR* (18Verhoef K. Marzio G. Hillen W. Bujard H. Berkhout B. J. Virol. 2001; 75: 979-987Google Scholar) but with the optimized 2ΔtetO promoter configuration (21Marzio G. Verhoef K. Vink M. Berkhout B. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6342-6347Google Scholar, 22Marzio G. Vink M. Verhoef K. de Ronde A. Berkhout B. J. Virol. 2002; 76: 3084-3088Google Scholar). Sequence analysis was performed by big dye terminator cycle sequencing (PE Biosystems). For the construction of the F86Y single mutant, the F86Y-containing XcmI-NdeI rtTA fragment of pBlue3′LTRext-ΔU3-rtTAF86Y A209T-2ΔtetO was used to replace the corresponding sequence in pBlue3′LTRext-ΔU3-rtTA-2ΔtetO to create pBlue3′LTRext-ΔU3-rtTAF86Y-2ΔtetO. For the cloning of the mutant rtTA sequences into the HIVrtTA provirus, the BamHI-BglI fragment of the shuttle vectors was used to replace the corresponding sequences in HIVrtTA.The plasmid pCMV-rtTA contains the improved rtTA2S-S2 gene cloned in the expression vector pUHD141–1/X (12Urlinger S. Baron U. Thellmann M. Hasan M.T. Bujard H. Hillen W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 7963-7968Google Scholar). The XbaI-SmaI fragment from the shuttle vector pBlue3′LTRext-ΔU3-rtTAF86Y-2ΔtetO and pBlue3′LTRext-ΔU3-rtTAF86Y A209T-2ΔtetO was used to replace the corresponding sequence in pCMV-rtTA, resulting in the plasmid pCMV-rtTAF86Y and pCMV-rtTAF86Y A209T, respectively. The plasmids pCMV-rtTAS12G and pCMV-rtTAS12G F86Y A209T were constructed by site-directed mutagenesis in which the oligonucleotide 5′-ATAACCATGTCTAGACTGCACAAGAGCAAAGTCATAAACGGAGCTCTGGAATTACTCAATGGTGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCT (mutated codon underlined) was annealed to the oligonucleotide 5′-AGCAGGGCCCGCTTGTTCTTCACGTGCCAGTACAGGGTAGGCTGCTCAACTCCCAGCTTTTGAGCGAGTTTCCTTGTCGTCAGGCCTTCGA, both strands were completed with Klenow DNA polymerase in the presence of dNTPs, digested with XcmI and ApaI, and cloned into the corresponding sites of pCMV-rtTA and pCMV-rtTAF86Y A209T, respectively.rtTA Activity Assay—In the plasmid pLTR-2ΔtetO-lucff the expression of firefly luciferase is under the control of the LTR-2ΔtetO-promoter of HIVrtTA (22Marzio G. Vink M. Verhoef K. de Ronde A. Berkhout B. J. Virol. 2002; 76: 3084-3088Google Scholar). In the plasmid pCMV-7tetO-lucff the firefly luciferase expression is controlled by seven tetO elements coupled to a minimal CMV promoter. This plasmid was previously named pUHC13–3 (16Gossen M. Bujard H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5547-5551Google Scholar). The plasmid pRL-CMV, in which the expression of renilla luciferase is controlled by a CMV promoter, is co-transfected into the C33A and HeLa X1/6 cells to allow correction for differences in transfection efficiency.C33A cells were co-transfected with 0.4 ng of pCMV-rtTA (wild type or mutant), 0.5 ng of pRL-CMV, and either 20 ng of pLTR-2ΔtetO-lucff or pCMV-7tetO-lucff. HeLa X1/6 cells were co-transfected with 8 ng of pCMV-rtTA and 2.5 ng of pRL-CMV. pBluescript was added to the transfection mix to a total of 1 μg of DNA. The cells were cultured after transfection for 48 h in the presence of different dox concentrations. Cells were lysed in passive lysis buffer and firefly and Renilla luciferase activities were determined with the dual-luciferase assay (Promega). The expression of firefly and Renilla luciferase was within the linear range and no squelching effects were observed. The ratio between the firefly and Renilla luciferase activities reflects the activity of the rtTA proteins.Western Blot Analysis—HeLa X1/6 cells were transfected at 90% confluency with 1 μg of wild-type or mutant pCMV-rtTA and 2 μl of LipofectAMINE 2000 (Invitrogen) in 2-cm2 wells. Cells were cultured for 48 h in the absence of dox and lysed in 100 μl of passive lysis buffer (Promega). 10 μl of the lysate was mixed with 10 μl of reducing SDS sample buffer (100 mm Tris-HCl (pH 6.8), 4% SDS, 10% β-mercaptoethanol, 20% glycerol). Proteins were resolved in an SDS-10% polyacrylamide gel, transferred to Immobilon-P membrane (1 h, 80 V), and subsequently blocked with phosphate-buffered saline containing 5% nonfat dry milk. For immunochemical detection of rtTA, membranes were subsequently incubated with rabbit serum containing polyclonal anti-TetR antibodies (23Krueger C. Berens C. Schmidt A. Schnappinger D. Hillen W. Nucleic Acids Res. 2003; 31: 3050-3056Google Scholar). Bound antibodies were visualized with peroxidase-linked anti-rabbit IgG and the ECL+ kit (Amersham Biosciences) and analyzed with a Storm 860 Imager (Amersham Biosciences).RESULTSThe Tet System as an Essential Component of HIV-1 Replication—We have previously reported the construction of an infectious HIVrtTA virus that is critically dependent on dox for its replication (18Verhoef K. Marzio G. Hillen W. Bujard H. Berkhout B. J. Virol. 2001; 75: 979-987Google Scholar). HIV-1 gene expression and replication are naturally controlled by the viral Tat protein, which binds to the 5′ TAR hairpin in the nascent RNA transcript (24Berkhout B. Silverman R.H. Jeang K.T. Cell. 1989; 59: 273-282Google Scholar) and thereby enhances transcription (reviewed in Ref. 25Jeang K.T. Xiao H. Rich E.A. J. Biol. Chem. 1999; 274: 28837-28840Google Scholar). In the HIVrtTA variant, this Tat-TAR regulatory mechanism was inactivated by mutation of both Tat and TAR and functionally replaced by the components of the Tet system (Fig. 1A). The gene encoding the rtTA transcriptional activator protein was inserted in place of the 3′-terminal nef gene, and eight copies of the tetO binding sites were introduced in the LTR promoter. This virus does not replicate in the absence of dox. Administration of dox induces transcription of the viral genome and expression of the viral proteins, including rtTA. This rtTA protein subsequently activates transcription, gene expression, and virus replication. Other groups have also tried to implement the Tet system in HIV and SIV (simian immunodeficiency virus), but these attempts failed to produce an efficiently replicating virus (26Smith S.M. Khoroshev M. Marx P.A. Orenstein J. Jeang K.T. J. Biol. Chem. 2001; 276: 32184-32190Google Scholar, 27Xiao Y. Kuwata T. Miura T. Hayami M. Shida H. Virology. 2000; 269: 268-275Google Scholar). Although our HIVrtTA virus can initiate a spreading infection in the presence of dox, replication was relatively poor when compared with the parental HIVLAI virus. Instead of trying to improve HIVrtTA by additional molecular-biological manipulations, we set out to let nature select for virus variants with improved replication capacity.Improved Viral Replication through Evolution-driven Optimization of the rtTA Gene—We previously reported that a characteristic change in the LTR-tetO promoter occurred in multiple, independent long term virus cultures (21Marzio G. Verhoef K. Vink M. Berkhout B. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6342-6347Google Scholar, 22Marzio G. Vink M. Verhoef K. de Ronde A. Berkhout B. J. Virol. 2002; 76: 3084-3088Google Scholar). In a particular culture with greatly accelerated virus replication we also observed amino acid changes in the rtTA protein. Genetic analysis at 114 days of culture indicated that HIVrtTA had acquired two amino acid changes in the rtTA protein; the phenylalanine at position 86 was replaced by tyrosine (F86Y) and the alanine at position 209 by threonine (A209T; Fig. 1A). The F86Y mutation is striking because it changes a strictly conserved residue in the TetR domain that is in direct contact with the Tc/dox effector molecule (Fig. 1C). To directly compare the replication capacity of this evolved HIVrtTA, the original HIVrtTA, and the wild-type HIVLAI, we infected SupT1 T cells with equal amounts of virus (Fig. 1B). Replication potential of the evolved HIVrtTA virus was significantly improved when compared with the original virus and approached that of the parental HIVLAI. Like the original HIVrtTA virus, the new HIVrtTA variant does not replicate in the absence of dox.To demonstrate that the rtTA mutations are responsible for the observed improvement in viral replication, we constructed viruses with the individual F86Y mutation (HIVrtTA-F86Y) or the combined F86Y and A209T mutations (HIVrtTA-F86Y A209T) and assayed replication of these variants at different dox concentrations (Fig. 2). The fully wild-type HIVLAI isolate of which the replication is not influenced by dox was included as a control (Fig. 2A). The parental HIVrtTA did not replicate in the absence of dox and a low level of replication was observed at 100 ng/ml dox (Fig. 2B). Increasing the dox concentration resulted in a gradual increase in replication rate. Replication of HIVrtTA-F86Y was also completely dependent on dox, but a high level of replication was already apparent at 100 ng/ml dox (Fig. 2C). At this dox concentration, HIVrtTA-F86Y replicates even more efficiently than HIVrtTA at 1000 ng/ml dox. The HIVrtTA-F86Y A209T showed the same dox dependence and replication potential as HIVrtTA-F86Y (Fig. 2D). These results indicate that the F86Y rtTA mutation is sufficient to significantly improve viral replication both at low and high dox concentrations. The superior replication capacity of HIVrtTA-F86Y was confirmed in a direct competition experiment with HIVrtTA. SupT1 cells were infected with equal amounts of the two viruses in the presence of 1000 ng/ml dox. The F86Y variant dominated the viral population within 1 week of culture (more than 80% of the population-based sequence), and this variant was exclusively detected at later times (results not shown).Fig. 2The F86Y rtTA mutation improves viral replication. The F86Y and A209T mutations observed upon prolonged culturing of HIVrtTA were cloned into the original HIVrtTA virus. Molecular clones (1 μg) encoding HIVLAI (A), HIVrtTA (B), HIVrtTA-F86Y (C), and HIVrtTA-F86Y A209T (D), all containing the improved LTR-2ΔtetO promoter (21Marzio G. Verhoef K. Vink M. Berkhout B. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6342-6347Google Scholar), were transfected into SupT1 T cells. Cells were cultured in the presence of different dox concentrations (0–1000 ng/ml). Virus replication was monitored by CA-p24 ELISA on culture supernatant samples.View Large Image Figure ViewerDownload (PPT)We also tested the effect of the rtTA mutations in a virus production assay by transiently transfecting plasmids encoding wt and mutant HIVrtTA proviral genomes into C33A cervix carcinoma cells. These cells support viral gene expression and virion production but do not support viral replication because they lack the appropriate receptors. HIVrtTA virus production gradually increases with increasing dox concentration and reaches its maximal level at 250 ng/ml dox (Fig. 3). HIVrtTA-F86Y A209T virus production is also dox-dependent, but a high production level is already reached at 30 ng/ml dox. Thus, the rtTA mutant significantly improves expression of the proviral genome at low dox concentrations.Fig. 3rtTA mutations improve virus production. C33A cervix carcinoma cells were transfected with 1 μg of the molecular clones encoding HIVrtTA and HIVrtTA-F86Y A209T and cultured in the presence of different dox concentrations (0–1000 ng/ml). Virus production was measured by CA-p24 ELISA on culture supernatant samples at 2 days after transfection.View Large Image Figure ViewerDownload (PPT)The Evolved rtTA Variant Greatly Improves the Tet System—To test whether the evolved rtTAs do also improve the Tet gene expression system, we assayed the rtTA variants in a regular Tet system, out of the HIVrtTA virus context. Expression plasmids encoding the wt (rtTAwt) and mutant rtTA proteins (rtTAF86Y and rtTAF86Y A209T) were co-transfected into C33A cells with a plasmid encoding the luciferase reporter gene under the control of the viral LTR-2ΔtetO promoter (Fig. 4A). The luciferase level measured 2 days after transfection reflects the transcriptional activity of the rtTA protein. The wt and mutant rtTAs show no activity in the absence of dox (Fig. 4B). rtTAwt activity is detectable first at 500 ng/ml dox and increases further at 1000 ng/ml. rtTAF86Y and rtTAF86Y A209T activity is detectable at dox levels as low as 50 ng/ml, and this activity gradually increases with higher dox concentrations. Moreover, these mutant rtTAs are ∼4-fold more active than the rtTAwt at higher dox levels. Identical activities are observed with rtTAF86Y and rtTAF86Y A209T, confirming that the F86Y mutation is solely responsible for the increased rtTA activity.Fig. 4Evolved rtTA variants show increased activity and dox sensitivity in different Tet systems. A, the rtTA activity of wild-type (rtTAwt) and mutant rtTA proteins (rtTAF86Y and rtTAF86Y A209T) was measured in Tet systems that differ in the tetO-promoter reporter-gene configuration. The rtTA activity was measured in C33A cells transfected with a plasmid carrying the firefly luciferase reporter gene under the control of the viral LTR-2ΔtetO promoter (LTR-2ΔtetO; B) or under the control of a minimal CMV-derived promoter coupled to seven tetO elements (CMV-7tetO; C). Furthermore, rtTA activity was measured in HeLA X1/6 cells (15Baron U. Gossen M. Bujard H. Nucleic Acids Res. 1997; 25: 2723-2729Google Scholar) that contain a chromosomally integrated copy of the CMV-7tetO firefly luciferase construct (CMV-7tetO-integrated; D). Cells were transfected with rtTA expression plasmids (rtTAwt, rtTAF86Y, and rtTAF86Y A209T) or pBluescript (-; no rtTA) and a plasmid constitutively expressing Renilla luciferase to correct for differences in transfection efficiency. Cells were cultured in the presence of different concentrations of dox (0–1000 ng/ml), and the ratio of the firefly and Renilla luciferase activities measured 2 days after transfection reflects the activity of the rtTA protein.View Large Image Figure ViewerDownload (PPT)This optimization of the rtTA protein by spontaneous virus evolution is not a specific adaptation to the LTR-2ΔtetO promoter, since similar results were obtained in assays with a standard reporter gene construct in which the luciferase gene is under control of seven tet operators coupled to a minimal CMV promoter (Fig. 4C). We also assayed the rtTA activity in HeLa X1/6 cells that contain a chromosomally integrated copy of this CMV-7tetO reporter construct (15Baron U. Gossen M. Bujard H. Nucleic Acids Res. 1997; 25: 2723-2729Google Scholar) (Fig. 4D). Also in these cells, both rtTAF86Y and rtTAF86Y A209T show activity at much lower dox concentrations when compared with rtTAwt, and the mutants are more active than the wild type at high dox levels. Thus, the F86Y mutation improves rtTA activity independent of the type of promoter and the episomal or chromosomal status of the promoter.In their random mutagenesis studies, Urlinger et al. (12Urlinger S. Baron U. Thellmann M. Hasan M.T. Bujard H. Hillen W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 7963-7968Google Scholar) recently identified an S12G mutation that improved rtTA activity. We made expression vectors encoding this mutant (rtTAS12G; previously named rtTA2S-M2 in Ref. 12Urlinger S. Baron U. Thellmann M. Hasan M.T. Bujard H. Hillen W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 7963-7968Google Scholar) and a mutant in which the S12G mutation was combined with the F86Y and A209T mutations (rtTAS12G F86Y A209T). The rtTAs were tested in combination with the LTR-2ΔtetO reporter construct in C33A cells (Table I). rtTAS12G is indeed more active than rtTAwt, both at low and high dox levels. When compared with rtTAF86Y A209T, rtTAS12G is more active at the lowest dox concentration assayed but less active at high dox levels. Combining the mutations in rtTAS12G F86Y A209T yielded the highest activity at both low and high dox concentrations. To reach an activity that is comparable with the activity of rtTAwt at 1000 ng/ml dox, rtTAS12G F86Y A209T only needs 40 ng/ml dox, which can be translated into a 25-fold increased dox sensitivity (Table I). Importantly, like the other mutants, rtTAS12G F86Y A209T does not show any activity in the absence of dox. The optimal performance of this rtTA is also obvious when considering the fold induction of gene expression by dox. The rtTAS12G F86Y A209T activity is induced up to 47-fold, whereas rtTAwt can only be induce" @default.
• W1966320426 created "2016-06-24" @default.
• W1966320426 creator A5013456091 @default.
• W1966320426 creator A5019287445 @default.
• W1966320426 creator A5020102382 @default.
• W1966320426 creator A5022203746 @default.
• W1966320426 creator A5025017358 @default.
• W1966320426 creator A5025335365 @default.
• W1966320426 creator A5078277456 @default.
• W1966320426 date "2004-04-01" @default.
• W1966320426 modified "2023-09-30" @default.
• W1966320426 title "Viral Evolution as a Tool to Improve the Tetracycline-regulated Gene Expression System" @default.
• W1966320426 cites W1503689886 @default.
• W1966320426 cites W1530368384 @default.
• W1966320426 cites W1599543066 @default.
• W1966320426 cites W1816644759 @default.
• W1966320426 cites W1857344328 @default.
• W1966320426 cites W1964626368 @default.
• W1966320426 cites W1971592398 @default.
• W1966320426 cites W1974729150 @default.
• W1966320426 cites W1979159575 @default.
• W1966320426 cites W1983078492 @default.
• W1966320426 cites W2001256775 @default.
• W1966320426 cites W2005167964 @default.
• W1966320426 cites W2005275397 @default.
• W1966320426 cites W2015210486 @default.
• W1966320426 cites W2017738521 @default.
• W1966320426 cites W2020276950 @default.
• W1966320426 cites W2028231353 @default.
• W1966320426 cites W2029817555 @default.
• W1966320426 cites W2034287217 @default.
• W1966320426 cites W2055528600 @default.
• W1966320426 cites W2058527659 @default.
• W1966320426 cites W2072528655 @default.
• W1966320426 cites W2078078883 @default.
• W1966320426 cites W2078769518 @default.
• W1966320426 cites W2080528351 @default.
• W1966320426 cites W2087430988 @default.
• W1966320426 cites W2090429649 @default.
• W1966320426 cites W2092652351 @default.
• W1966320426 cites W2121520649 @default.
• W1966320426 cites W2131590438 @default.
• W1966320426 cites W2146950428 @default.
• W1966320426 cites W2150712887 @default.
• W1966320426 cites W2153094676 @default.
• W1966320426 doi "https://doi.org/10.1074/jbc.m313895200" @default.
• W1966320426 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14761948" @default.
• W1966320426 hasPublicationYear "2004" @default.
• W1966320426 type Work @default.
• W1966320426 sameAs 1966320426 @default.
• W1966320426 citedByCount "122" @default.
• W1966320426 countsByYear W19663204262012 @default.
• W1966320426 countsByYear W19663204262013 @default.
• W1966320426 countsByYear W19663204262014 @default.
• W1966320426 countsByYear W19663204262015 @default.
• W1966320426 countsByYear W19663204262016 @default.
• W1966320426 countsByYear W19663204262017 @default.
• W1966320426 countsByYear W19663204262018 @default.
• W1966320426 countsByYear W19663204262019 @default.
• W1966320426 countsByYear W19663204262020 @default.
• W1966320426 countsByYear W19663204262021 @default.
• W1966320426 countsByYear W19663204262022 @default.
• W1966320426 countsByYear W19663204262023 @default.
• W1966320426 crossrefType "journal-article" @default.
• W1966320426 hasAuthorship W1966320426A5013456091 @default.
• W1966320426 hasAuthorship W1966320426A5019287445 @default.
• W1966320426 hasAuthorship W1966320426A5020102382 @default.
• W1966320426 hasAuthorship W1966320426A5022203746 @default.
• W1966320426 hasAuthorship W1966320426A5025017358 @default.
• W1966320426 hasAuthorship W1966320426A5025335365 @default.
• W1966320426 hasAuthorship W1966320426A5078277456 @default.
• W1966320426 hasBestOaLocation W19663204261 @default.
• W1966320426 hasConcept C104317684 @default.
• W1966320426 hasConcept C150194340 @default.
• W1966320426 hasConcept C159047783 @default.
• W1966320426 hasConcept C2780923616 @default.
• W1966320426 hasConcept C501593827 @default.
• W1966320426 hasConcept C54355233 @default.
• W1966320426 hasConcept C70721500 @default.
• W1966320426 hasConcept C86803240 @default.
• W1966320426 hasConceptScore W1966320426C104317684 @default.
• W1966320426 hasConceptScore W1966320426C150194340 @default.
• W1966320426 hasConceptScore W1966320426C159047783 @default.
• W1966320426 hasConceptScore W1966320426C2780923616 @default.
• W1966320426 hasConceptScore W1966320426C501593827 @default.
• W1966320426 hasConceptScore W1966320426C54355233 @default.
• W1966320426 hasConceptScore W1966320426C70721500 @default.
• W1966320426 hasConceptScore W1966320426C86803240 @default.
• W1966320426 hasIssue "18" @default.
• W1966320426 hasLocation W19663204261 @default.
• W1966320426 hasOpenAccess W1966320426 @default.
• W1966320426 hasPrimaryLocation W19663204261 @default.
• W1966320426 hasRelatedWork W1991523530 @default.
• W1966320426 hasRelatedWork W2002128513 @default.
• W1966320426 hasRelatedWork W2009966535 @default.
• W1966320426 hasRelatedWork W2020824267 @default.
• W1966320426 hasRelatedWork W2031436818 @default.
• W1966320426 hasRelatedWork W2057739827 @default.

• next