FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1966320645> ?p ?o ?g. }

• W1966320645 endingPage "29462" @default.
• W1966320645 startingPage "29453" @default.
• W1966320645 abstract "Saccharomyces cerevisiae RAD54 gene functions in the formation of heteroduplex DNA, a key intermediate in recombination processes. Rad54 is monomeric in solution, but forms a dimer/oligomer on DNA. Rad54 dimer/oligomer alters the conformation of the DNA double helix in an ATP-dependent manner, as revealed by a change in the DNA linking number in a topoisomerase I-linked reaction. DNA conformational alteration does not occur in the presence of non-hydrolyzable ATP analogues, nor when mutant rad54 proteins defective in ATP hydrolysis replace Rad54. Accordingly, the Rad54 ATPase activity is shown to be required for biological functionin vivo and for promoting Rad51-mediated homologous DNA pairing in vitro. Taken together, the results are consistent with a model in which a Rad54 dimer/oligomer promotes nascent heteroduplex joint formation via a specific interaction with Rad51 protein and an ability to transiently unwind duplex DNA. Saccharomyces cerevisiae RAD54 gene functions in the formation of heteroduplex DNA, a key intermediate in recombination processes. Rad54 is monomeric in solution, but forms a dimer/oligomer on DNA. Rad54 dimer/oligomer alters the conformation of the DNA double helix in an ATP-dependent manner, as revealed by a change in the DNA linking number in a topoisomerase I-linked reaction. DNA conformational alteration does not occur in the presence of non-hydrolyzable ATP analogues, nor when mutant rad54 proteins defective in ATP hydrolysis replace Rad54. Accordingly, the Rad54 ATPase activity is shown to be required for biological functionin vivo and for promoting Rad51-mediated homologous DNA pairing in vitro. Taken together, the results are consistent with a model in which a Rad54 dimer/oligomer promotes nascent heteroduplex joint formation via a specific interaction with Rad51 protein and an ability to transiently unwind duplex DNA. Saccharomyces cerevisiae genes of the RAD52epistasis group, viz, RAD50, RAD51, RAD52, RAD54, RAD55, RAD57, RAD59, RDH54/TID1, MRE11, and XRS2, are required for genetic recombination and DNA double-strand break repair by recombination. Since genetic recombination is indispensable for the disjunction of homologous chromosomal pairs during meiosis I, mutational inactivation of the RAD52 group genes engenders severe meiotic defects, manifest as a failure to sporulate and spore inviability (1Bai Y. Symington L.S. Genes Dev. 1996; 10: 2025-2037Crossref PubMed Scopus (215) Google Scholar, 2Game J.C. Semin. Cancer Biol. 1993; 4: 73-83PubMed Google Scholar, 3Klein H. Genetics. 1997; 147: 1533-1543Crossref PubMed Google Scholar, 4Petes T.D. Malone R.E. Symington L.S. Broach J.R. Jones E.W. Pringle J.R. The Molecular and Cellular Biology of the Yeast Saccharomyces: Genome Dynamics, Protein Synthesis, and Energetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1991: 407-521Google Scholar, 5Shinohara M. Shita-Yamaguchi E. Buerstedde J.M. Shinagawa H. Ogawa H. Shinohara A. Genetics. 1997; 147: 1545-1556Crossref PubMed Google Scholar). The results from recent cloning studies have revealed a remarkable degree of conservation of the RAD52group genes among eukaryotes, from yeast to humans. A conceptual model concerning the mechanism of homologous recombination has been formulated based on genetic studies in S. cerevisiae (6Szostak J.W. Orr-Weaver T.L. Rothstein R.J. Cell. 1983; 33: 25-35Abstract Full Text PDF PubMed Scopus (1748) Google Scholar). When S. cerevisiae cells enter meiosis, DNA double-strand breaks are formed at various chromosomal “hot spots” that exhibit a propensity to recombine. Subsequent to break formation, unidirectional nucleolytic end-processing of the break yields 3′ ssDNA 1The abbreviations used are:ssDNAsingle-stranded DNAdsDNAdouble-stranded DNAMMSmethyl methanesulfonateDTTdithiothreitolBSAbovine serum albuminMOPS4-morpholinepropanesulfonic acidATPγSadenosine 5′-O-(thiotriphosphate)BMHbis-maleimidohexane1The abbreviations used are:ssDNAsingle-stranded DNAdsDNAdouble-stranded DNAMMSmethyl methanesulfonateDTTdithiothreitolBSAbovine serum albuminMOPS4-morpholinepropanesulfonic acidATPγSadenosine 5′-O-(thiotriphosphate)BMHbis-maleimidohexane tails of a considerable length (7Cao L. Alani E. Kleckner N. Cell. 1990; 61: 1089-1101Abstract Full Text PDF PubMed Scopus (533) Google Scholar, 8Sun H. Treco D. Szostak J.W. Cell. 1991; 64: 1155-1161Abstract Full Text PDF PubMed Scopus (423) Google Scholar). It is believed that nucleation of various recombination factors onto the ssDNA tails gives rise to a nucleoprotein complex that has the ability to conduct a search to locate a DNA homolog and to invade the homolog to form heteroduplex DNA. Concurrent and subsequent events include DNA synthesis to replace the genetic information eliminated during double-strand break processing, resolution of the DNA intermediates, and DNA ligation to complete the recombination process. The repair of DNA double-strand breaks induced by ionizing radiation and radiomimetic chemicals very likely proceeds through the same mechanistic route, as the repair process shares the same requirement for the RAD52 epistasis group genes. single-stranded DNA double-stranded DNA methyl methanesulfonate dithiothreitol bovine serum albumin 4-morpholinepropanesulfonic acid adenosine 5′-O-(thiotriphosphate) bis-maleimidohexane single-stranded DNA double-stranded DNA methyl methanesulfonate dithiothreitol bovine serum albumin 4-morpholinepropanesulfonic acid adenosine 5′-O-(thiotriphosphate) bis-maleimidohexane Extensive genetic evidence has indicated that the nucleolytic end-processing of DNA double-strand breaks during recombination processes is dependent on the RAD50, MRE11, andXRS2 genes. The Mre11 protein from both yeast (9Furuse M. Nagase Y. Tsubouchi H. Murakami-Murofushi K. Shibata T. Ohta K. EMBO J. 1998; 17: 6412-6425Crossref PubMed Scopus (220) Google Scholar, 10Moreau S. Ferguson J.R. Symington L.S. Mol. Cell. Biol. 1999; 19: 556-566Crossref PubMed Scopus (363) Google Scholar, 11Usui T. Ohta T. Oshiumi H. Tomizawa J. Ogawa H. Ogawa T. Cell. 1998; 95: 705-716Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar) and humans (12Paull T.T. Gellert M. Mol. Cell. 1998; 1: 969-979Abstract Full Text Full Text PDF PubMed Scopus (697) Google Scholar) and a protein complex (13Trujillo K.M. Yuan S-S.F. Lee E.Y-H.P. Sung P. J. Biol. Chem. 1998; 273: 21447-21450Abstract Full Text Full Text PDF PubMed Scopus (324) Google Scholar) consisting of the human Rad50, Mre11, and the Xrs2 equivalent NBS1, product of the gene mutated in Nijmegen breakage syndrome (14Carney J.P. Maser R.S. Olivares H. Davis E.M. Le Beau M. Yates J.R. Hays L. Morgan W.F. Petrini J.H. Cell. 1998; 93: 477-486Abstract Full Text Full Text PDF PubMed Scopus (1019) Google Scholar, 15Varon R. Vissinga C. Platzer M. Cerosaletti K.M. Chrzanowska K.H. Saar K. Beckmann G. Seemanova E. Cooper P.R. Nowak N.J. Stumm M. Weemaes C.M.R. Gatti R.A. Wilson R.K. Digweed M. Rosenthal A. Sperling K. Concannon P. Reis A. Cell. 1998; 93: 467-476Abstract Full Text Full Text PDF PubMed Scopus (868) Google Scholar), have ssDNA endonuclease and dsDNA specific 3′ to 5′ exonuclease activities. It has been suggested that the Mre11-associated nuclease complex functions with a DNA helicase to create the 3′ ssDNA tails known to form during recombination processes (9Furuse M. Nagase Y. Tsubouchi H. Murakami-Murofushi K. Shibata T. Ohta K. EMBO J. 1998; 17: 6412-6425Crossref PubMed Scopus (220) Google Scholar, 10Moreau S. Ferguson J.R. Symington L.S. Mol. Cell. Biol. 1999; 19: 556-566Crossref PubMed Scopus (363) Google Scholar, 11Usui T. Ohta T. Oshiumi H. Tomizawa J. Ogawa H. Ogawa T. Cell. 1998; 95: 705-716Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar, 13Trujillo K.M. Yuan S-S.F. Lee E.Y-H.P. Sung P. J. Biol. Chem. 1998; 273: 21447-21450Abstract Full Text Full Text PDF PubMed Scopus (324) Google Scholar). Once the 3′ single-strand (ss) tail is generated by the end-processing reaction, it is believed that a number of recombination factors, including Rad51, Rad52, Rad54, Rad55, Rad57, Rdh54, the ssDNA binding factor RPA, and possibly Rad59, nucleate onto this ssDNA tail to form a nucleoprotein complex, which initiates a search to locate a DNA homolog. Invasion of the homolog by the nucleoprotein complex then leads to the formation of heteroduplex DNA. Rad51 protein is the eukaryotic equivalent of Escherichia coli RecA protein, which is central to recombination processes by virtue of its ability to mediate the homologous DNA pairing and strand exchange reaction that yields heteroduplex DNA (reviewed in Refs. 16Cox M.M. Genes Cells. 1998; 3: 65-78Crossref PubMed Scopus (103) Google Scholar and 17Kowalczykowski S.C. Dixon D.A. Eggleston A.K. Lauder S.D. Rehrauer W.M. Microbiol. Rev. 1994; 58: 401-465Crossref PubMed Google Scholar). Evidence emerging during the past few years has indicated that Rad51 protein carries out the homologous DNA pairing and strand exchange reaction (18Sugiyama T. Zaitseva E.M. Kowalczykowski S.C. J. Biol. Chem. 1997; 272: 7940-7945Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar, 19Sung P. Science. 1994; 265: 1241-1243Crossref PubMed Scopus (751) Google Scholar). Biochemical studies have revealed that Rad51 protein polymerizes on ssDNA to form a nucleoprotein filament in which the DNA is highly extended (20Ogawa T., Yu, X. Shinohara A. Egelman E.H. Science. 1993; 259: 1896-1899Crossref PubMed Scopus (556) Google Scholar, 21Sung P. Robberson D.L. Cell. 1995; 83: 453-461Abstract Full Text PDF Scopus (424) Google Scholar). The assembly of the Rad51-ssDNA nucleoprotein filament requires ATP binding and is stimulated by RPA (18Sugiyama T. Zaitseva E.M. Kowalczykowski S.C. J. Biol. Chem. 1997; 272: 7940-7945Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar, 19Sung P. Science. 1994; 265: 1241-1243Crossref PubMed Scopus (751) Google Scholar, 22Sung P. Stratton S.A. J. Biol. Chem. 1996; 271: 27983-27986Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). Rad52 protein (23New J.H. Sugiyama T. Zaitseva E. Kowalczykowski S.C. Nature. 1998; 391: 407-410Crossref PubMed Scopus (499) Google Scholar, 24Shinohara A. Ogawa T. Nature. 1998; 391: 404-407Crossref PubMed Scopus (407) Google Scholar, 25Sung P. J. Biol. Chem. 1997; 272: 28194-28197Abstract Full Text Full Text PDF PubMed Scopus (449) Google Scholar) and a heterodimer of Rad55 and Rad57 proteins (26Sung P. Genes Dev. 1997; 11: 1111-1121Crossref PubMed Scopus (459) Google Scholar) have been shown to function as molecular mediators (25Sung P. J. Biol. Chem. 1997; 272: 28194-28197Abstract Full Text Full Text PDF PubMed Scopus (449) Google Scholar, 27Kanaar R. Hoeijmakers J.H.J. Nature. 1998; 391: 335-337Crossref PubMed Scopus (26) Google Scholar), enhancing the efficiency of Rad51-ssDNA nucleoprotein filament assembly when there is a necessity for Rad51 to compete with RPA for binding sites on the ssDNA. In its role as molecular mediators between Rad51 and RPA, Rad52 protein and the Rad55-Rad57 heterodimer resemble the complex of E. coli RecO and RecR proteins (28Umezu K Chi N.W. Kolodner R.D. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3875-3879Crossref PubMed Scopus (199) Google Scholar) and the bacteriophage T4 UvsY protein (29Harris L.D. Griffith J.D. J. Mol. Biol. 1989; 206: 19-28Crossref PubMed Scopus (53) Google Scholar, 30Jiang H. Giedroc D. Kodadek T. J. Biol. Chem. 1993; 268: 7904-7911Abstract Full Text PDF PubMed Google Scholar, 31Yonesaki T. Minagawa T. J. Biol. Chem. 1989; 264: 7814-7820Abstract Full Text PDF PubMed Google Scholar, 32Sweezy M.A. Morrical S.C. J. Mol. Biol. 1997; 266: 927-938Crossref PubMed Scopus (33) Google Scholar), which function to enhance the nucleation of their cognate recombinases RecA and UvsX onto the ssDNA when the DNA substrate is coated with a single-strand DNA-binding protein. The level of homologous DNA pairing and strand exchange that can be achieved by Rad51 protein, even under optimized reaction conditions (21Sung P. Robberson D.L. Cell. 1995; 83: 453-461Abstract Full Text PDF Scopus (424) Google Scholar) and in the presence of various ancillary factors including Rad52 protein and the Rad55-Rad57 heterodimer (23New J.H. Sugiyama T. Zaitseva E. Kowalczykowski S.C. Nature. 1998; 391: 407-410Crossref PubMed Scopus (499) Google Scholar, 24Shinohara A. Ogawa T. Nature. 1998; 391: 404-407Crossref PubMed Scopus (407) Google Scholar, 25Sung P. J. Biol. Chem. 1997; 272: 28194-28197Abstract Full Text Full Text PDF PubMed Scopus (449) Google Scholar, 26Sung P. Genes Dev. 1997; 11: 1111-1121Crossref PubMed Scopus (459) Google Scholar), is still lower than that seen with its prokaryotic analogs RecA and UvsX proteins. These observations have suggested that perhaps another protein factor(s) functions to augment the homologous DNA pairing and strand exchange activities of Rad51 protein to achieve the desirable level of efficiency of heteroduplex DNA formation during recombination processesin vivo. Among the RAD52group proteins required for heteroduplex DNA formation, Rad54 is of particular interest, as it is the only member of this class for which there does not appear to be a structural or functional homolog in prokaryotes. Rad54, a member of the Swi2/Snf2 family of proteins which function in diverse chromosomal processes (reviewed in Refs. 33Eisen J.A. Sweder K.S. Hanawalt P.C. Nucleic Acids Res. 1995; 23: 2715-2723Crossref PubMed Scopus (617) Google Scholar and 34Pazin M.J. Kadonaga J.T. Cell. 1997; 88: 737-740Abstract Full Text Full Text PDF PubMed Scopus (269) Google Scholar), has a DNA-dependent ATPase activity (35Petukhova G. Stratton S. Sung P. Nature. 1998; 393: 91-94Crossref PubMed Scopus (344) Google Scholar). Importantly, the addition of Rad54 to a homologous pairing reaction dramatically stimulates the pairing rate, elevating it to a level comparable to what can be achieved with the prokaryotic recombinases (35Petukhova G. Stratton S. Sung P. Nature. 1998; 393: 91-94Crossref PubMed Scopus (344) Google Scholar). These results indicate that efficient homologous DNA pairing requires the cooperation between Rad51 and Rad54 proteins, and they provide an explanation as to the requirement for Rad54 in heteroduplex DNA formation during recombination processes. However, the manner in which Rad54 protein promotes heteroduplex DNA formation has remained completely unknown. Delineating Rad54 function is clearly of paramount importance for understanding the mechanism of heteroduplex DNA formation. Since the Rad54 protein from other eukaryotes exhibits a high degree of functional and structural homology to the S. cerevisiaecounterpart (36Bezzubova O. Silbergleit A. Yamaguchi-Iwai Y. Takeda S. Buerstedde J.M. Cell. 1997; 89: 185-193Abstract Full Text Full Text PDF PubMed Scopus (237) Google Scholar, 37Essers J.R. Hendriks W. Swagemakers S.M.A. Troelstra C. de Wit J. Bootsma D. Hoeijmakers J.H.J. Kanaar R. Cell. 1997; 89: 195-204Abstract Full Text Full Text PDF PubMed Scopus (371) Google Scholar, 38Kanaar R. Troelstra C. Swagemakers S.M.A. Essers J. Smit B. Franssen J-H. Pastink A. Bezzubova O.Y. Buerstedde J-M. Clever B. Heyer W-D. Hoeijmakers J.H.J. Curr. Biol. 1996; 6: 828-838Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar, 39Swagemakers S.M.A. Essers J. de Wit J. Hoeijmakers J.H.J. Kanaar R. J. Biol. Chem. 1998; 273: 28292-28297Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 40Takata M. Sasaki M.S. Sonoda E. Morrison C. Hashimoto M. Utsumi H. Yamaguchi-Iwai Y. Shinohara A. Takeda S. EMBO J. 1998; 17: 5497-5508Crossref PubMed Scopus (1000) Google Scholar, 41Tan T.L.R. Essers J. Citterio E. Swagemakers S.M.A. de Wit J. Benson F.E. Hoeijmakers J.H.J. Kanaar R. Curr. Biol. 1999; 9: 325-328Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar), the results obtained with yeast Rad54 should be germane for delineating the role of Rad54 protein in recombination processes in other eukaryotes. Here we present results from our biochemical and genetic studies which address the function of Rad54 in heteroduplex DNA formation. The RAD54 gene was placed under theGAL-PGKpromoter in the vector pPM231 (2μ, LEU2-d, GAL-PGK) to yield plasmid pR54.1 (2μ, LEU2-d, GAL-PGK-6His-RAD54). Likewise, the rad54 K341A and therad54 K341R alleles, which were generated by site-directed mutagenesis and sequenced to ensure no mutation other than the intended ones had been introduced, were placed under the GAL-PGKpromoter to yield plasmids pR54.2 (2μ, LEU2-d, GAL-PGK-6His-rad54 K341A), and pR54.3 (2μ, LEU2-d, GAL-PGK-6His-rad54 K341R). These plasmids, pR54.1, pR54.2, and pR54.3, were introduced into strain BJ5464 for protein purification. For examining MMS sensitivity, the RAD54, rad54 K341A, andrad54 K341R alleles were placed under the ADCIpromoter in vector pTB326 (2μ, TRP1, ADCI) to yield plasmids pR54.4 (2μ, TRP1, ADCI-RAD54), pR54.5 (2μ, TRP1, ADCI-rad54 K341A), and pR54.6 (2μ, TRP1, ADCI-rad54 K341R), respectively. These plasmids, pR54.4, pR54.5, and pR54.6, along with the vector pTB326, were introduced into the rad54 deletion haploid strain LSY403 to examine restoration of resistance to MMS. The strains used for protein purification and genetic experiments are listed in TableI.Table IYeast strains usedBJ5464 (Matα, ura3–52, trp-1, leu2Δ1, his3Δ200, pep4::HIS3, prbΔ1.6R)LSY403 (MATα, rad54Δ::LEU2, leu2–3, 112, trp1–1, ura3–1, can1–100, ade2–1, his3–11,15)Haploids derived from W303 and the genotype leu2-ri::URA3::leu2-bst his3–11,15 ade2–1 ura3–1 trp1–1 can1–100 RAD5HKY855–1CMATα RAD54HKY855–2B MATα RAD54HKY855–5C MAT a RAD54HKY813–2DMATα rad54::HIS3HKY813–9BMAT a rad54::HIS3HKY813–10AMAT a rad54::HIS3HKY862–1DMATα rad54 K341RHKY862–5A MATα rad54 K341RHKY862–8B MAT a rad54 K341RHKY855–1D MATα rad54 K341AHKY855–2AMATα rad54 K341AHKY855–4B MAT a rad54 K341ADiploids derived from W303 and the genotype MATα leu2-ri his3–11,15 ade2–1 ura3–1 trp1–1 can1–100 RAD5 MAT a leu2-bst his3–11,15 ade2–1 ura3–1 trp1–1 can1–100 RAD5HKY857–2C MAT a RAD54 × HKY858–3C MATα RAD54HKY857–3CMATα RAD54 × HKY858–1D MAT a RAD54HKY811–11C MATα rad54::HIS3 × HKY812–4C MAT a rad54::HIS3HKY811–3D MAT a rad54::HIS3 × HKY812–3C MATα rad54::HIS3HKY873–1BMAT a rad54 K341R × HKY872–2A MATα rad54 K341RHKY873–3C MATα rad54 K341R × HKY872–5A MAT a rad54 K341RHKY857–2DMAT a rad54 K341A × HKY858–8B MATα rad54 K341AHKY857–4C MATα rad54 K341A × HKY858–1A MAT a rad54 K341A Open table in a new tab φX 174 viral (+) strand was purchased from New England Biolabs and the replicative form (about 90% supercoiled form and 10% nicked circular form) was from Life Technologies, Inc. The 83-mer oligonucleotides used in the strand exchange experiments were: oligo 1 with 16% GC content: 5′-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATATAAA; oligo 2: the exact complement of oligo 1; oligo 3 with 37% GC content: 5′-TTGATAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAATTGCTGAATCTGGTGCTGTAGCTCAACATGTTTTAAATATGCAA; oligo 4: the exact complement of oligo 3. Oligos 2 and 4 were labeled at the 5′ end with [γ-32P]ATP by T4 polynucleotide kinase, and then annealed to their complements, oligos 1 and 3. The resulting duplexes were purified from 10% polyacrylamide gels by overnight diffusion at 4 °C into TAE buffer (40 mm Tris acetate, pH 7.5, 0.5 mm EDTA). BJ5464 harboring pR54.1 was grown in galactose containing medium as described (35Petukhova G. Stratton S. Sung P. Nature. 1998; 393: 91-94Crossref PubMed Scopus (344) Google Scholar). Cells were harvested by centrifugation and stored at −70 °C until use. All the purification steps were carried out at 4 °C. Extract was prepared from 400 g of yeast paste using a French Press in cell breakage buffer containing high salt (0.6 m KCl) and protease inhibitors, as described (42Sung P. Matson S.W. Prakash L. Prakash S. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 6045-6049Crossref PubMed Scopus (90) Google Scholar). The crude lysate (Fraction I) was clarified by ultracentrifugation (100,000 × g for 120 min) and then treated with ammonium sulfate at 0.28 g/ml to precipitate Rad54 and about 30% of the total protein. The precipitated proteins were redissolved in 300 ml of K buffer (20 mmKH2PO4, pH 7.4, 10% glycerol, 0.5 mm EDTA, 0.5 mm DTT, and the same set of protease inhibitors as used in the cell breakage buffer) to give a conductivity equivalent to 150 mm KCl (Fraction II) and then applied onto a column of Q-Sepharose (2.6 × 8.5 cm; 45 ml total). The Q column flow (Fraction III) was applied directly onto an SP-Sepharose column (2.6 × 8.5 cm; 45 ml total), which was developed with a 300-ml gradient from 150 to 600 mm KCl in buffer K, collecting 50 fractions. The fractions containing Rad54, which eluted at about 350 mm KCl, were identified by immunoblotting, pooled (Fraction IV; 20 ml; ∼300 mm KCl), and mixed with 1 ml of nickel NTA-agarose beads for 3 h. The nickel NTA-agarose containing bound Rad54 protein was poured into a glass column with internal diameter of 0.6 cm, and the protein was eluted sequentially with 10 volumes of buffer K containing 10, 30, and 200 mm imidazole. The 200 mm imidazole eluate (Fraction V; 4 ml), containing the bulk (>85%) of the Rad54 protein, was fractionated in a column of Macro-hydroxyapatite (matrix purchased from Bio-Rad; 1 ml total packed in an HR5/5 column from Amersham Pharmacia Biotech), with a 20-ml 60 to 300 mmKH2PO4 gradient in buffer K. Rad54 protein eluted from hydroxyapatite at about 200 mmKH2PO4, and the peak fractions were pooled (Fraction VI; 3 ml), concentrated to 0.8 ml in a Centricon-30 microconcentrator (Amicon) and then subject to sizing in a column of Sephacryl S300 (35-ml matrix) in buffer K containing 150 mmKCl. Rad54 protein elutes from S300 in a position expected for a monomeric protein, and the protein pool (Fraction VII; 3 ml) was chromatographed in a Mini S column (Amersham Pharmacia Biotech) with a 5-ml 150 to 500 mm KCl gradient in buffer K. Rad54 protein elutes from Mini S at about 300 mm KCl, and the pool of which was concentrated to a small volume to 1.5 mg/ml (Fraction VIII) and stored in small portions at −70 °C. For the purification of the rad54 K341A and rad54 K341R mutant proteins, 400 g of yeast strain BJ5464 harboring pR54.2 and pR54.3 were used. Extract preparation and the column chromatographic steps were carried out as described for wild type Rad54 protein above. Rad51 protein was purified to near homogeneity from yeast strain LP2749-9B harboring the plasmid pR51.3 (2μ, PGK-RAD51) as described previously (22Sung P. Stratton S.A. J. Biol. Chem. 1996; 271: 27983-27986Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). The RPA used in this study was purified either from a bacterial overexpression system (43He Z. Wong J.M.S. Maniar H.S. Brill S.J. Ingles C.J. J. Biol. Chem. 1996; 271: 28243-28249Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar) or from yeast strain BJ5464 harboring plasmids which overexpress the three subunits of RPA simultaneously; the latter yeast-based RPA overexpression system was a kind gift from Richard Kolodner. Chromatographic fractionation of bacterial and yeast extracts was done as described previously (26Sung P. Genes Dev. 1997; 11: 1111-1121Crossref PubMed Scopus (459) Google Scholar). We have noticed no difference between RPA preparations obtained from bacteria or from yeast in their ability to promote Rad51/Rad54-mediated homologous DNA pairing. The sensitivity of various yeast strains to methyl methanesulfonate was examined as described previously (22Sung P. Stratton S.A. J. Biol. Chem. 1996; 271: 27983-27986Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). Briefly, the rad54Δ yeast strain LSY403 harboring pTB326, pR54.4, pR54.5, or pR54.6 was grown in complete synthetic medium lacking tryptophan for 24 h to stationary phase, collected by centrifugation, washed once with 50 mmKH2PO4, pH 7.5, and then resuspended in the same buffer to the density of 1 × 107 cells/ml. MMS (Aldrich; >99%) was added to the cell suspensions to 0.5% final concentration and after varying times at 25 °C, aliquots of the cell suspensions were withdrawn, treated with an equal volume of 10% Na2S2O3 to neutralize the MMS, and the cells were plated on complete synthetic medium lacking tryptophan after appropriate dilutions with distilled water. Colonies were counted after 5 days of incubation at 30 °C. Recombination rates were calculated according to the median method of Lea and Coulson (44Lea D.E. Coulson C.A. J. Genet. 1948; 49: 264-284Crossref Scopus (1079) Google Scholar) as described (45Aguilera A. Klein H.L. Genetics. 1988; 119: 779-790Crossref PubMed Google Scholar). Strains were streaked onto solid YEPD medium and grown at 30 °C for 2–3 days. Nine colonies from each strain were used for each fluctuation test. For the haploid strains, three strains of each genotype were subject to fluctuation tests. Rate determinations in diploid strains were done on two crosses of each genotype using fresh zygotes. Three zygotes from each cross were subject to fluctuation tests. The indicated amounts of Rad54 and mutant rad54 proteins were incubated at 37 °C with φX174 replicative form DNA (30 μm base pairs; 90% supercoiled form and 10% nicked circular form) in 10 μl of reaction buffer (30 mmTris-HCl, pH 7.5, 100 μg/ml BSA, 5 mm MgCl2, 1.5 mm [γ-32P]ATP, 0.5 mm DTT, and 50 mm KCl), and the reaction was terminated by the addition of SDS to 1% final concentration. Reaction products were separated by thin layer chromatography on PEI cellulose (46Randerath K. Randerath E. J. Chromatogr. 1964; 16: 111-125Crossref PubMed Google Scholar) and quantified in the PhosphorImager. The reaction was assembled as described previously (21Sung P. Robberson D.L. Cell. 1995; 83: 453-461Abstract Full Text PDF Scopus (424) Google Scholar, 35Petukhova G. Stratton S. Sung P. Nature. 1998; 393: 91-94Crossref PubMed Scopus (344) Google Scholar). Briefly, 3.6 μg of Rad51 protein (6.6 μm) and 82 ng of φX174 viral (+) strand (20 μm nucleotides) were mixed in 10 μl of reaction buffer (35 mm potassium/MOPS, pH 7.2, 40 mm KCl, 2.5 mm ATP, 3 mm MgCl2, 1 mm DTT, and an ATP regenerating system consisting of 20 mm creatine phosphate and 28 μg/ml creatine kinase). After a 5-min incubation at 37 °C, 1.6 μg of RPA (1.1 μm) was added, followed by a 5-min incubation at 37 °C, and then the indicated amounts of Rad54 protein or rad54 mutant proteins, 50 ng of 32P-labeled ApaLI linearized φX174 dsDNA (12.3 μm nucleotides), and 1 μl of 50 mm spermidine were incorporated. The complete reaction mixture (12.5 μl) was incubated at 37 °C, and 6-μl portions were withdrawn at the indicated times and processed for agarose gel electrophoresis as described (35Petukhova G. Stratton S. Sung P. Nature. 1998; 393: 91-94Crossref PubMed Scopus (344) Google Scholar). Oligo 2 or oligo 4 (23 μm nucleotides) and 3.3 μg of Rad51 (7.7 μm) were incubated in 8 μl of reaction buffer (30 mm potassium/MOPS, pH 7.2, 1.5 mm ATP, 10 mm creatine phosphate, 28 μg/ml creatine kinase, 3 mm MgCl2, 0.5 mm DTT) for 4 min at 37 °C. Rad54 protein, 1 μl of 50 mm spermidine, and the homologous 32P-labeled duplex (46 μmnucleotides) were incorporated to complete the reaction mixture (10 μl). After incubation at 37 °C for the indicated times, reaction mixtures were deproteinized and resolved in 12% polyacrylamide gels, which were dried onto a sheet of DEAE paper (DE81 from Whatman), and the reaction product was quantified in the PhosphorImager. The 83-mer duplex obtained by hybridizing oligo 1 to 5′ 32P-labeled oligo 2 was prepared as described above. The indicated amounts of Rad54 protein (18 to 108 nm) and the DNA substrate (7.6 μmnucleotides) were incubated for 5 min at 25 °C in 10 μl of reaction buffer (30 mm potassium/HEPES, pH 7.2, 5 mm MgCl2, 0.5 mm DTT, 10 mm creatine phosphate, 28 μg/ml creatine kinase, 50 μg/ml BSA, and 50 mm KCl) and DNA mobility shift was analyzed in 12% polyacrylamide gels run in TAE buffer at 4 °C. ATP was added to 1.5 mm final concentration as indicated. In the standard cross-linking reaction, wild type Rad54 or mutant rad54 protein, 2 μg (2 μm), was preincubated with or without 400 ng of DNA (61 μm base pairs) for 5 min at 25 °C in 10 μl reaction buffer (20 mm HEPES, pH 7.2, 5 mm EDTA, 5 mm MgCl2, 50 mm NaCl), followed by the addition of bis-maleimidohexane (BMH; purchased from Pierce) to the final concentration of 200 μm. After a 10-min incubation at 25 °C, the reaction was quenched by the addition of 1 μl of 2-mercaptoethanol. The samples were analyzed by SDS-polyacrylamide gel electrophoresis in 7.5% gels. For the sizing experiments, the protein cross-linking reactions were scaled up 10-fold to contain 20 μg of Rad54 protein in a reaction volume of 100 μl. After quenching the reaction with 2-mercaptoethanol, the volume of the mixtures was adjusted to 600 μl with buffer K containing 500 mm KCl, 0.01% Nonidet P-40, and 1 mm 2-mercaptoethanol, before it was filtered through a Sephacryl S300 column as described below. The content of Rad54 protein in various column fractions was determined by immunoblot analysis. In the experiment in Fig. 7 D, Rad54 protein, 30 ng (30 nm), was incubated with 5 ng to 2 μg of DNA (0.75 to 300 μm base pairs) in 10 μl of buffer and BMH, quenched with mercaptoethanol, and then subject to immunoblot analysis. All the sizing experiments were carried out at 4 °C. In the experiment described in Fig. 7 B, the sample containing Rad54 protein was filtered through a Sephacryl S300 column (1 × 44.5 cm; total 35 ml) at a flow rate of 0.1 ml/min, collecting 4-min fractions. Portions of the column fractions were subject to immunoblot analysis to determine their content of the Rad54 protein. The molecular size markers used for calibrating t" @default.
• W1966320645 created "2016-06-24" @default.
• W1966320645 creator A5013658493 @default.
• W1966320645 creator A5074023767 @default.
• W1966320645 creator A5077911091 @default.
• W1966320645 creator A5077918155 @default.
• W1966320645 creator A5090899284 @default.
• W1966320645 date "1999-10-01" @default.
• W1966320645 modified "2023-10-13" @default.
• W1966320645 title "Yeast Rad54 Promotes Rad51-dependent Homologous DNA Pairing via ATP Hydrolysis-driven Change in DNA Double Helix Conformation" @default.
• W1966320645 cites W122675378 @default.
• W1966320645 cites W1532653491 @default.
• W1966320645 cites W1540750107 @default.
• W1966320645 cites W1563567580 @default.
• W1966320645 cites W1594568422 @default.
• W1966320645 cites W1604305208 @default.
• W1966320645 cites W1637563944 @default.
• W1966320645 cites W1676891985 @default.
• W1966320645 cites W1694178424 @default.
• W1966320645 cites W1859642 @default.
• W1966320645 cites W1958548845 @default.
• W1966320645 cites W1966608028 @default.
• W1966320645 cites W1986730363 @default.
• W1966320645 cites W1988005908 @default.
• W1966320645 cites W1990586926 @default.
• W1966320645 cites W1991640287 @default.
• W1966320645 cites W1992632955 @default.
• W1966320645 cites W1994338971 @default.
• W1966320645 cites W2000199388 @default.
• W1966320645 cites W2000657327 @default.
• W1966320645 cites W2013735712 @default.
• W1966320645 cites W2016015955 @default.
• W1966320645 cites W2017145640 @default.
• W1966320645 cites W2022100127 @default.
• W1966320645 cites W2023647884 @default.
• W1966320645 cites W2025821843 @default.
• W1966320645 cites W2028084970 @default.
• W1966320645 cites W2034252391 @default.
• W1966320645 cites W2040015408 @default.
• W1966320645 cites W2040779655 @default.
• W1966320645 cites W2043757833 @default.
• W1966320645 cites W2052521064 @default.
• W1966320645 cites W2058800908 @default.
• W1966320645 cites W2062127054 @default.
• W1966320645 cites W2073440834 @default.
• W1966320645 cites W2081581449 @default.
• W1966320645 cites W2082981258 @default.
• W1966320645 cites W2087116290 @default.
• W1966320645 cites W2089804282 @default.
• W1966320645 cites W2090263062 @default.
• W1966320645 cites W2096679672 @default.
• W1966320645 cites W2098126099 @default.
• W1966320645 cites W2102684624 @default.
• W1966320645 cites W2116538548 @default.
• W1966320645 cites W2120365943 @default.
• W1966320645 cites W2133554835 @default.
• W1966320645 cites W2137347518 @default.
• W1966320645 cites W2137428107 @default.
• W1966320645 cites W2145304961 @default.
• W1966320645 cites W2152054208 @default.
• W1966320645 cites W2154317163 @default.
• W1966320645 cites W2166248803 @default.
• W1966320645 cites W2168149052 @default.
• W1966320645 doi "https://doi.org/10.1074/jbc.274.41.29453" @default.
• W1966320645 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10506208" @default.
• W1966320645 hasPublicationYear "1999" @default.
• W1966320645 type Work @default.
• W1966320645 sameAs 1966320645 @default.
• W1966320645 citedByCount "198" @default.
• W1966320645 countsByYear W19663206452012 @default.
• W1966320645 countsByYear W19663206452013 @default.
• W1966320645 countsByYear W19663206452014 @default.
• W1966320645 countsByYear W19663206452015 @default.
• W1966320645 countsByYear W19663206452016 @default.
• W1966320645 countsByYear W19663206452017 @default.
• W1966320645 countsByYear W19663206452018 @default.
• W1966320645 countsByYear W19663206452019 @default.
• W1966320645 countsByYear W19663206452020 @default.
• W1966320645 countsByYear W19663206452021 @default.
• W1966320645 countsByYear W19663206452022 @default.
• W1966320645 countsByYear W19663206452023 @default.
• W1966320645 crossrefType "journal-article" @default.
• W1966320645 hasAuthorship W1966320645A5013658493 @default.
• W1966320645 hasAuthorship W1966320645A5074023767 @default.
• W1966320645 hasAuthorship W1966320645A5077911091 @default.
• W1966320645 hasAuthorship W1966320645A5077918155 @default.
• W1966320645 hasAuthorship W1966320645A5090899284 @default.
• W1966320645 hasBestOaLocation W19663206451 @default.
• W1966320645 hasConcept C102744134 @default.
• W1966320645 hasConcept C104317684 @default.
• W1966320645 hasConcept C141315368 @default.
• W1966320645 hasConcept C181199279 @default.
• W1966320645 hasConcept C185592680 @default.
• W1966320645 hasConcept C18903297 @default.
• W1966320645 hasConcept C23265538 @default.
• W1966320645 hasConcept C2778530040 @default.
• W1966320645 hasConcept C2779012473 @default.
• W1966320645 hasConcept C2779222958 @default.

• next