FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1966691296> ?p ?o ?g. }

• W1966691296 endingPage "40497" @default.
• W1966691296 startingPage "40492" @default.
• W1966691296 abstract "Insulin receptor substrate-1 (IRS-1) protein is a major substrate of the insulin receptor tyrosine kinase and is essential for transducing many of the biological effects of insulin including mitogenesis, gene expression, and glucose transport. The N terminus of IRS-1 contains a pleckstrin homology (PH) domain that is critical for recognition and subsequent phosphorylation of IRS-1 by the activated insulin receptor. Here we report the isolation of a novel protein, PHIP (PH-interactingprotein), which selectively binds to the PH domain of IRS-1in vitro and stably associates with IRS-1 in vivo. Importantly, mutants of the IRS-1 PH domain that disrupt the PH fold fail to bind to PHIP. Anti-phosphotyrosine immunoblots of PHIP revealed no discernible insulin receptor-regulated phosphorylation, suggesting that PHIP is not itself a substrate of the insulin receptor. In contrast to full-length PHIP, overexpression of the PH-binding region of PHIP has a pronounced inhibitory effect on insulin-induced IRS-1 tyrosine phosphorylation levels. Furthermore, expression of this dominant-negative PHIP mutant leads to a marked attenuation of insulin-stimulated mitogen-activated protein kinase activity. We conclude that PHIP represents a novel protein ligand of the IRS-1 PH domain that may serve to link IRS-1 to the insulin receptor. Insulin receptor substrate-1 (IRS-1) protein is a major substrate of the insulin receptor tyrosine kinase and is essential for transducing many of the biological effects of insulin including mitogenesis, gene expression, and glucose transport. The N terminus of IRS-1 contains a pleckstrin homology (PH) domain that is critical for recognition and subsequent phosphorylation of IRS-1 by the activated insulin receptor. Here we report the isolation of a novel protein, PHIP (PH-interactingprotein), which selectively binds to the PH domain of IRS-1in vitro and stably associates with IRS-1 in vivo. Importantly, mutants of the IRS-1 PH domain that disrupt the PH fold fail to bind to PHIP. Anti-phosphotyrosine immunoblots of PHIP revealed no discernible insulin receptor-regulated phosphorylation, suggesting that PHIP is not itself a substrate of the insulin receptor. In contrast to full-length PHIP, overexpression of the PH-binding region of PHIP has a pronounced inhibitory effect on insulin-induced IRS-1 tyrosine phosphorylation levels. Furthermore, expression of this dominant-negative PHIP mutant leads to a marked attenuation of insulin-stimulated mitogen-activated protein kinase activity. We conclude that PHIP represents a novel protein ligand of the IRS-1 PH domain that may serve to link IRS-1 to the insulin receptor. insulin receptor cAMP response element-binding protein CREB-binding protein mitogen-activated protein MAP kinase pleckstrin homology phosphotyrosine binding polymerase chain reaction glutathione S-transferase base pair PH-binding region hemagglutinin antigen dominant-negative wild type N-terminal C-terminal rapid amplification of cDNA ends pre-C-terminal Dulbecco's modified Eagle's medium phenylmethylsulfonyl fluoride polyvinylidene difluoride polyacrylamide gel electrophoresis antibodies myelin basic protein mouse PHIP human PHIP bromodomain son of sevenless Upon ligand stimulation of insulin receptors (IR),1IRS-1 is rapidly phosphorylated on multiple tyrosine residues, which serve as docking sites for the assembly and activation of Src homology 2-containing signaling proteins that function in eliciting many insulin-dependent biological responses (1White M.F. Yenush L. Curr. Top. Microbiol. Immunol. 1998; 228: 179-208Crossref PubMed Google Scholar). The N terminus of IRS-1 contains a PH domain followed by the structurally homologous phosphotyrosine-binding (PTB) domain that has been shown to cooperatively contribute in mediating productive receptor/substrate interactions (2Yenush L. Makati K.J. Smith-Hall J. Ishibashi O. Myers M.G.J. White M.F. J. Biol. Chem. 1996; 271: 24300-24306Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 3Voliovitch H. Schindler D.G. Hadari Y.R. Taylor S.I. Accili D. Zick Y. J. Biol. Chem. 1995; 270: 18083-18087Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar, 4Myers M.G.J. Grammer T.C. Brooks J. Glasheen E.M. Wang L.M. Sun X.J. Blenis J. Pierce J.H. White M.F. J. Biol. Chem. 1995; 270: 11715-11718Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). The PTB domain of IRS-1 binds directly to phosphorylated Tyr960within the NPEY motif in the juxtamembrane region of the activated IR (5Wolf G. Trub T. Ottinger E. Groninga L. Lynch A. White M.F. Miyazaki M. Lee J. Shoelson S.E. J. Biol. Chem. 1995; 270: 27407-27410Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar, 6Eck M.J. Dhe-Paganon S. Trub T. Nolte R.T. Shoelson S.E. Cell. 1996; 85: 695-705Abstract Full Text Full Text PDF PubMed Scopus (252) Google Scholar). However, the exact molecular mechanism by which the IRS-1 PH domain promotes receptor coupling is not known. Previous studies have demonstrated that deletion of the PH domain attenuates IRS-1 phosphorylation and subsequent insulin-mediated mitogenesis (2Yenush L. Makati K.J. Smith-Hall J. Ishibashi O. Myers M.G.J. White M.F. J. Biol. Chem. 1996; 271: 24300-24306Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 3Voliovitch H. Schindler D.G. Hadari Y.R. Taylor S.I. Accili D. Zick Y. J. Biol. Chem. 1995; 270: 18083-18087Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar, 4Myers M.G.J. Grammer T.C. Brooks J. Glasheen E.M. Wang L.M. Sun X.J. Blenis J. Pierce J.H. White M.F. J. Biol. Chem. 1995; 270: 11715-11718Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). Moreover, heterologous PH domains from the β-adrenergic receptor kinase, phospholipase Cγ, or spectrin, known to promote plasma membrane targeting by binding phosphatidylinositol phospholipids, fail to restore IRS-1-specific signaling, suggesting that the IRS-1 PH domain is not simply a membrane-targeting device but may interact with specific cellular ligands (7Burks D.J. Pons S. Towery H. Smith-Hall J. Myers M.G.J. Yenush L. White M.F. J. Biol. Chem. 1997; 272: 27716-27721Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). This ligand does not appear to be the insulin receptor itself as in vitro binding studies and yeast two hybrid analysis failed to detect a direct interaction between the IRS-1 PH domain and IR (8He W. Craparo A. Zhu Y. O'Neill T.J. Wang L.M. Pierce J.H. Gustafson T.A. J. Biol. Chem. 1996; 271: 11641-11645Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 9Gustafson T.A. He W. Craparo A. Schaub C.D. O'Neill T.J. Mol. Cell. Biol. 1995; 15: 2500-2508Crossref PubMed Scopus (324) Google Scholar, 10O'Neill T.J. Craparo A. Gustafson T.A. Mol. Cell. Biol. 1994; 14: 6433-6442Crossref PubMed Scopus (165) Google Scholar, 11Sawka-Verhelle D. Tartare-Deckert S. White M.F. Obberghen E. J. Biol. Chem. 1996; 271: 5980-5983Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). Although a recent report by Burkset al. (12Burks D.J. Wang J. Towery H. Ishibashi O. Lowe D. Riedel H. White M.F. J. Biol. Chem. 1998; 273: 31061-31067Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar) revealed that the IRS-1 PH domain can bind to acidic motifs in the nucleolar protein, nucleolin, physiological ligands for the IRS-1 PH domain have yet to be defined. In an attempt to identify functional partners of the IRS-1 PH domain, we used a yeast two hybrid system where the PH domain of IRS-1 was used as a bait to screen a mouse cDNA library. A clone that coded for a novel protein termed PHIP, for PH-interactingprotein, selectively bound to the IRS-1 PH domain but not to PH domains from unrelated proteins and was thus chosen for further characterization. PH domains from rat IRS-1 (residues 3–133) (13Sun X.J. Rothenberg P. Kahn C.R. Backer J.M. Araki E. Wilden P.A. Cahill D.A. Goldstein B.J. White M.F. Nature. 1991; 352: 73-77Crossref PubMed Scopus (1279) Google Scholar), mouse SOS1 (residues 448–577) (14Bowtell D. Fu P. Simon M. Senior P. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6511-6515Crossref PubMed Scopus (238) Google Scholar), human RasGAP (GTPase-activatingprotein) (residues 464–603) (15Trahey M. McCormick F. Science. 1987; 238: 542-545Crossref PubMed Scopus (832) Google Scholar), and mouse Ect-2 (residues 495–621) (16Miki T. Smith C.L. Long J.E. Eva A. Fleming T.P. Nature. 1993; 362: 462-465Crossref PubMed Scopus (257) Google Scholar) were amplified by polymerase chain reaction (PCR) and fused in frame to the LexA DNA-binding domain of the yeast expression plasmid BTM116. The 612-base pair (bp) fragment spanning the IRS-1 PH-binding region (PBR) of the PHIP cDNA isolated from the yeast two hybrid screen was subcloned in frame into the BamHI/EcoRI sites of pGEX-3X (Invitrogen). The expressed fusion protein is ∼45 kDa, corresponding to GST and residues 4–209 of PHIP. All of the following constructs were subcloned in frame with the hemagglutinin antigen (HA) epitope in the pCGN mammalian expression vector. To prepare constructs encoding IRS-1 PHWT, a PCR-generated fragment containing the IRS-1 PH domain (residues 3–133), was subcloned into SmaI andBamHI sites within the pCGN expression vector. To generate the IRS-1 PH domain mutant constructs designated IRS-1 PHW106A, where the Trp106 residue conserved in all PH domains was changed to Ala, and either N-terminal (PHNT; residues 3–67) or C-terminal (PHCT; residues 55–133) PH domain regions, the following primers were used to amplify the corresponding regions. For PHW106A, primer 1, 5′ AAAAACCCGGGAAGCCCTCCGGATACCGATG 3′ and primer 2, 5′ AAAAAAGGATCCTCAATTATGCAGCTGCAGAAGAGCCTGGTACGCGCTGTCTTGTTCAGCCTCG 3′ (CCA is replaced with CGC); for PHNT, primer 1 and primer 3, 5′ AAAAAAGGATCCTCACTCGAGGGGGATCGAGCG 3′; for PHCT, primer 4, 5′ AAAAAATCTAGAAGCTGTTTCAACATCAACAAGC 3′ and primer 5, 5′ AAAAAAGGATCCTCAGCTGCAGCTACCACCGCA 3′ were used. SmaI, BamHI, and XbaI restriction sites were added (underlined) to facilitate subcloning into pCGN, which had been digested with the same enzymes. To generate the pCGN/HA-DN-PHIP mutant construct, a PCR fragment of 639 bp encompassing the IRS-1 PH-binding region of PHIP (residues 4–217) was amplified using sense primer 5′ GGACTAGTGCGAGATTGGCTGTGGAAGAACTAAC 3′ and antisense primer 5′CGGGATCCTCAGCAATATCTAGTGTCATCAACTGG 3′. The PCR fragment was digested with SpeI andKpn-1 and was subcloned into the compatibleXbaI/KpnI sites of the pCGN vector. To generate the full-length pCGN/HA-PHIP construct, a 2271-bpBstEII/BamHI fragment comprising amino acids 150–902 of PHIP was excised from the cDNA clone 6b26, isolated from a human fetal brain cDNA library, and was subcloned into the pCGN/HA-DN-PHIP vector, which had been cleaved at the BstEII site within PHIP and BamHI within the pCGN vector. The pcDNAI/HA-tagged p44MAPK plasmid was a gift from Dr. J. Avruch. The PH domain from rat IRS-1 (residues 3–133) was fused to the LexA-binding domain within the BTM116 vector and used as a bait in a yeast two hybrid system to screen for interacting clones from a mouse 10.5-day embryonic cDNA library fused with the VP16-activation domain of the yeast pVP16 vector. Transformation of the yeast strain L40 with yeast plasmids and screening for positive colonies by β-galactosidase assays were done essentially as described by Sawka-Verhelle et al. (11Sawka-Verhelle D. Tartare-Deckert S. White M.F. Obberghen E. J. Biol. Chem. 1996; 271: 5980-5983Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). A total of 89 positive clones were identified, most of which were represented at least twice, indicating that the screen was saturated. The clone that displayed the strongest interaction with the IRS-1 PH domain, VP1.32, was representative of 18/89 positive clones. The 612-bp VP1.32 clone insert was subsequently used to screen adult mouse thymus (a gift from Dr. W. J. Muller) and human fetal brain (a gift from Dr. J. Rommans) cDNA libraries to obtain the complete coding region of mouse and human PHIP, respectively. cDNA clones encoding the extreme 5′ end of human PHIP mRNA were never obtained. 5′ RACE was performed as per manufacturer's instructions (Life Technologies, Inc.). Specific mPHIP primer, 5′ GTCAGGCATATCATGGTATTTCATGGT 3′, was used to generate the first strand cDNA. The two 5′ CCTTAGTTCCATCTTATGCCATGGCTG 3′ and 5′ CCAAGCTGAAGGCAACCACTC 3′ mPHIP primers were used as nested primers for first and second rounds of reverse transcription PCR, respectively. Alignment of sequences obtained from a combination of 5′ RACE and cDNA library screens were used to confirm the full PHIP cDNA sequences. Bacterially expressed GST-PHIP fusion proteins containing the PHIP PH-binding region (residues 5–209) were injected into rabbits to raise polyclonal anti-PHIP antibodies. Anti-GST antibodies were removed by passage over a GST affinity column. Anti-IRS-1PCT(generated against a 16-amino acid pre-C-terminal polypeptide sequence) was purchased from Upstate Biotechnology Inc. Anti-MAPK (p42/44) and anti-phosphotyrosine, PY20, antibodies were from New England Biolabs. Anti-HA antibodies were purchased from Babco. Anti-IRS-1PH (generated against the IRS-1 PH domain) and anti-IRS-2 antibodies were gifts from Dr. M. F. White, and anti-IR and anti-Shc antibodies were generously provided by Dr. K. Siddle and Dr. J. McGlade, respectively. Rat-1 fibroblasts, 293 human embryonic kidney cells, and COS monkey kidney epithelial cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum, 2 mm glutamine, 100 IU/ml penicillin-G, and 100 μg of streptomycin. The human multiple myeloma cell line U266 was cultured in RPMI medium 1640 supplemented with the same reagents. In cases of serum starvation, cells were cultured in DMEM alone for 16 to 18 h and then stimulated with the indicated doses of insulin (Sigma) for 5 min at 37 °C. Cells were lysed in PLC lysis buffer containing 50 mm Hepes, pH 7.5, 150 mm NaCl, 10% glycerol, 1% Nonidet P-40, 1.5 mm MgCl2, 1 mm EGTA, 10 mm sodium pyruvate, 10 mm sodium fluoride, 10 μm sodium orthophosphate, 1 mm PMSF, 10 μg/ml aprotinin, 10 μg/ml leupeptin. The extracts were clarified by centrifugation at 11,000 rpm for 10 min at 4 °C. Lysates (500 μg of protein) were immunoprecipitated with the corresponding antibodies for 2 h at 4 °C, separated on SDS polyacrylamide gels, and transferred to polyvinylidene difluoride (PVDF) membranes and immunoblotted with the corresponding antibodies. Whole cell lysates were prepared by harvesting cells 48 h after transfection with hot 2× SDS sample buffer. 50–200 μg of lysate was resolved by SDS-PAGE and probed with the corresponding antibodies as indicated. COS and 293 cell lines were transfected with the indicated pCGN expression plasmids using the calcium phosphate precipitation method. Rat-1 cells were transfected using GenePorter 2 (Gene Therapy Systems) as per manufacturer's instructions. L40 yeast cells expressing various HA-tagged PH domains (rat IRS-1, mouse SOS1, human RasGAP, and mouse Ect-2) were lysed with acid-washed beads in 1 ml of distilled water containing 0.1 mm PMSF. Clarified cell lysates were incubated with ∼5 μg of GST-PHIP (PBR) proteins for 90 min at 4 °C. For pull-down experiments with IRS-1 PH domain mutants, COS-1 cell lysates transiently transfected with plasmids expressing HA-tagged PHWT, PHNT, PHCT, or PHW106A and were mixed with either GST or GST-PHIP (PBR) proteins. Bound proteins were resolved by SDS-PAGE and analyzed by immunoblotting with anti-HA antibodies. COS cells transiently cotransfected with HA-p44MAPKand either pCGN control vector or pCGN/DN-PHIP were stimulated with or without insulin and lysed in PLC lysis buffer. Anti-HA immunoprecipitates were incubated for 20 min at 30 °C in a reaction mixture (30 μl) containing 10 mm MgCl2, 50 mm Tris, pH 7.4, 2 mm EGTA, 1 mmdithiothreitol, 30 μm cold ATP, and 5 μCi of [γ-32P]ATP. 20 μg of myelin basic protein (MBP) (Sigma) was used as a substrate. The reaction was stopped by 6× SDS sample buffer, and the supernatant was resolved by 12% SDS-PAGE. The top portion of the gel was transferred to a PVDF membrane for immunoblotting with anti-MAPK antibodies (Abs), and the bottom portion containing labeled MBP was detected by autoradiography. In an attempt to identify proteins that bind to the PH domain of IRS-1, we used a yeast two hybrid screen in which the PH domain from rat IRS-1 was used as a bait to screen a murine 10.5-day embryonic cDNA library. Sequence analysis of a cDNA clone, VP1.32, which displayed the strongest interaction with the IRS-1 PH domain, revealed an open reading frame of 204 amino acids with no significant homology to any known proteins. We designated this protein PHIP, for PH-interacting protein. To recapitulate the interaction of PHIP with the IRS-1 PH domain in mammalian cells and to assess the specificity of PH domain binding, the VP1.32 cDNA was subcloned into the pGEX-3X vector and expressed as a GST fusion protein. Bacterially expressed GST-PHIP was used to probe yeast cell lysates expressing HA-tagged derivatives of PH domains from IRS-1 and from unrelated signaling proteins mSos1 (Ras nucleotide exchanger), Ect-2 (Rho/Rac exchanger), and RasGAP (14Bowtell D. Fu P. Simon M. Senior P. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6511-6515Crossref PubMed Scopus (238) Google Scholar, 15Trahey M. McCormick F. Science. 1987; 238: 542-545Crossref PubMed Scopus (832) Google Scholar, 16Miki T. Smith C.L. Long J.E. Eva A. Fleming T.P. Nature. 1993; 362: 462-465Crossref PubMed Scopus (257) Google Scholar). Interacting proteins were analyzed by Western blotting with anti-HA Abs (Fig. 1 A). Whereas GST-PHIP bound to the IRS-1 PH domain, there was no discernable association with PH domains of other proteins, suggesting that PHIP may function as a specific ligand of the IRS-1 PH domain. Next, to examine whether a functional PH domain or a smaller motif within the domain is responsible for PHIP binding, we generated three independent mutants of the IRS-1 PH domain that disrupt the PH fold; PHNT encompasses the first half of the IRS-1 PH domain, spanning residues 3–67, PHCT comprises the C-terminal residues 55–133, and PHW106A defines a mutant where the tryptophan at position 106, a residue conserved in all PH domains, was changed to Ala. As expected, all three PH domain mutants expressed transiently in COS-1 cells did not detectably associate with GST-PHIP, consistent with the notion that an intact PH domain is required for PHIP binding (Fig. 1 B). VP1.32 was subsequently used to screen mouse thymus and human fetal brain cDNA libraries in combination with 5′ RACE analysis, to obtain the complete coding region of mPHIP and hPHIP, respectively. The conceptual translation predicts a 902-amino acid protein of relative molecular mass of 100K (Fig. 2 A). PHIP proteins do not share sequence homology with any known proteins. As shown in Fig. 2 B, the IRS-1 PBR is located at the N terminus of the protein (residues 5–209). The only defined structural motifs within PHIP are two bromodomains, BD1 (residues 230 to 345) and BD2 (387 to 503), located in tandem in the center of the molecule (Fig. 2 B). Bromodomains are conserved sequences of ∼100 amino acids that have been proposed to mediate protein-protein interactions (17Jeanmougin F. Wurtz J.M. Le Douarin B. Chambon P. Losson R. Trends Biochem. Sci. 1997; 22: 151-153Abstract Full Text PDF PubMed Scopus (228) Google Scholar). A homology search revealed that PHIP BD sequences were most homologous (44% identity, 61% homology) to the bromodomain of mouse CREB-binding protein (CBP) (Fig. 2 C), a transcriptional coactivator (18Chrivia J.C. Kwok R.P. Lamb N. Hagiwara M. Montminy M.R. Goodman R.H. Nature. 1993; 365: 855-859Crossref PubMed Scopus (1763) Google Scholar). Northern blot analysis of PHIP mRNA from adult mouse tissues detected a transcript size of ∼7.0 kb whose expression is widespread (data not shown). Western blot analysis with Abs raised against a bacterial GST-PHIP fusion protein identified a 104-kDa protein from U266 cell lysates that was not precipitated by pre-immune sera (Fig. 3 A). Further analysis of PHIP expression in mammalian cell extracts revealed two forms of PHIP protein, the long 104-kDa form and a shorter 97-kDa form (Fig. 3 B). The 97- and 104-kDa polypeptides likely result from alternative usage of two putative translation initiation sites (Met1 and Met41; see Fig. 1) as ectopic expression of full-length hPHIP containing both sites produced a doublet in PHIP immunoblots (data not shown). To investigate the interaction of PHIP and IRS-1 in vivo, lysates from NIH/IR cells (NIH3T3 cells overexpressing the insulinreceptor) were immunoprecipitated with anti-IRS-1 Abs directed against the C terminus of IRS-1. Endogenous PHIP was found to associate with IRS-1 in both unstimulated and insulin-treated cells. (Fig. 4 A, lanes 1and 2). In contrast, when antibodies directed against the IRS-1 PH domain were used in similar coimmunoprecipitation assays, no interaction was detected, confirming that structural determinants within the PH domain of IRS-1 confer binding to PHIP. Based on the observation that IRS-1 and IRS-2 PH domains are highly conserved (60% amino acid identity) and have been shown to be functionally interchangeable in promoting substrate recognition by the insulin receptor (7Burks D.J. Pons S. Towery H. Smith-Hall J. Myers M.G.J. Yenush L. White M.F. J. Biol. Chem. 1997; 272: 27716-27721Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar), we predicted that IRS-2 may also associate with PHIPin vivo. Indeed, PHIP could be readily detected in anti-IRS-2 immunoprecipitates, consistent with the notion that PHIP may have a conserved function in recruiting members of the IRS protein family to activated insulin receptor complexes (Fig. 4 A,lane 7). As there are several potential tyrosine phosphorylation sites in the PHIP sequence we next examined whether PHIP serves as a substrate of the insulin receptor in vivo. Anti-PHIP immunoprecipitates from unstimulated or insulin-stimulated 293 cell lysates failed to show any discernable PHIP phosphorylation on anti-phosphotyrosine immunoblots (Fig. 4 B). PHIP however inducibly associated with a prominent 103-kDa phosphoprotein whose identity remains unknown. To establish the biochemical significance of IRS-1-PHIP interactions in insulin signaling, we designed PHIP constructs that encoded the PHIP PBR region alone (residues 5–209) and predicted that it should function in a dominant inhibitory fashion by competing with the endogenous PHIP for the IRS-1 PH domain. Indeed, ectopically expressed DN/PHIP binds to endogenous IRS-1 in both untreated and insulin-stimulated cell lysates (Fig. 5 A, panel 3). To analyze whether DN/PHIP interaction with endogenous IRS-1 leads to disruption of IRS-1 phosphorylation in response to insulin, we transiently transfected DN/PHIP in two different cell lines, COS-7 and Rat-1 cells. Transient expression of DN/PHIP, but not full-length PHIP, significantly impaired IRS-1 tyrosine phosphorylation (>5-fold) in insulin-treated cells (Fig. 5, A and B). To ascertain whether the reduction in IRS-1 phosphorylation occurred through interference with receptor function, we looked for changes in phosphotyrosine levels of immunoprecipitated IR and Shc, a direct substrate of the activated IR. Our results demonstrate that diminution of IRS-1 tyrosine phosphorylation levels was not attributable to inhibition of IR kinase activity in at least two cell backgrounds (Fig. 5, A and C). One of the early signaling events initiated by the IR is activation of MAP kinase. Moreover, in many cells, IRS-1 has been shown to be an upstream mediator of MAP kinase activation during insulin stimulation (19Myers M.G.J. Wang L.M. Sun X.J. Zhang Y. Yenush L. Schlessinger J. Pierce J.H. White M.F. Mol. Cell. Biol. 1994; 14: 3577-3587Crossref PubMed Scopus (196) Google Scholar, 20Skolnik E.Y. Batzer A. Li N. Lee C.H. Lowenstein E. Mohammadi M. Margolis B. Schlessinger J. Science. 1993; 260: 1953-1955Crossref PubMed Scopus (503) Google Scholar, 21Pruett W. Yuan Y. Rose E. Batzer A.G. Harada N. Skolnik E.Y. Mol. Cell. Biol. 1995; 15: 1778-1785Crossref PubMed Google Scholar). To evaluate the effect of DN/PHIP on IRS-1-mediated MAP kinase activation, COS cells were cotransfected with DN/PHIP and HA-tagged p44MAPK, and anti-HA immune complexes from serum-starved and insulin-stimulated cell lysates were subjected to an in vitro kinase assay using MBP substrate. As shown in Fig. 5 D, insulin-stimulated MAP kinase activation was reduced to basal levels by DN/PHIP expression. As expected, Shc phosphorylation remained refractile to the effects of DN/PHIP, suggesting that in these cells the PHIP/IRS-1 signaling pathway is essential for promoting MAP kinase activation during insulin stimulation. We next sought to establish whether PHIP directly interacts with the IR. Coimmunoprecipitation assays failed to reveal a direct interaction (data not shown). Similar results have previously been reported for the association of the IR with either IRS-1 or the Shc adaptor, suggesting that IR/effector interactions are weak or transient in nature and not detected in receptor immune complexes (22Pronk G.J. McGlade J. Pelicci G. Pawson T. Bos J.L. J. Biol. Chem. 1993; 268: 5748-5753Abstract Full Text PDF PubMed Google Scholar, 23Backer J.M. Myers M.G.J. Sun X.J. Chin D.J. Shoelson S.E. Miralpeix M. White M.F. J. Biol. Chem. 1993; 268: 8204-8212Abstract Full Text PDF PubMed Google Scholar, 24Yenush L. Fernandez R. Myers M.G.J. Grammer T.C. Sun X.J. Blenis J. Pierce J.H. Schlessinger J. White M.F. Mol. Cell. Biol. 1996; 16: 2509-2517Crossref PubMed Scopus (81) Google Scholar). Our data indicate that PHIP is a novel protein ligand of the IRS-1 PH domain that can modulate insulin signaling. Although it is generally accepted that most PH domains bind to phosphoinositides there are some reports of PH domains associating with protein ligands as illustrated by the β-adrenergic receptor kinase PH domain, which binds to the βγ subunits of G heterotrimeric proteins (25Lemmon M.A. Ferguson K.M. Curr. Top. Microbiol. Immunol. 1998; 228: 39-74PubMed Google Scholar). Given that the majority of PH domain-containing proteins have a functional requirement for membrane association, it has been postulated that the lipid-binding function of PH domains serves to recruit these signaling proteins to membrane compartments. However, recent studies demonstrating that PH domains are not functionally interchangeable argue for the existence of specific PH domain cellular ligands (7Burks D.J. Pons S. Towery H. Smith-Hall J. Myers M.G.J. Yenush L. White M.F. J. Biol. Chem. 1997; 272: 27716-27721Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 26Artalejo C.R. Lemmon M.A. Schlessinger J. Palfrey H.C. EMBO J. 1997; 16: 1565-1574Crossref PubMed Scopus (70) Google Scholar, 27Ma A.D. Brass L.F. Abrams C.S. J. Cell Biol. 1997; 136: 1071-1079Crossref PubMed Scopus (65) Google Scholar). Our findings that PHIP selectively associates with the IRS-1 PH domain not only buttresses the notion of PH domains as protein-binding modules but also provides support for the specificity of PH domain interactions. The observation that inhibitory mutants of PHIP cause perturbation of IR-dependent IRS-1 phosphorylation suggests that PHIP may serve to couple IR to IRS-1. The molecular basis for PHIP-IRS-1 interaction has yet to be defined. Although recent data indicate that the IRS-1 PH domain binds to short stretches of acidic residues such as KVAEEEDDEE found in nucleolin I (12Burks D.J. Wang J. Towery H. Ishibashi O. Lowe D. Riedel H. White M.F. J. Biol. Chem. 1998; 273: 31061-31067Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar), these acidic motifs are not present in the PBR region of PHIP. Functional analysis of PHIP-IRS interactions may provide insights into the structural basis for PH ligand-binding specificity. As PHIP associates stably with both IRS-1 and IRS-2, it may fulfill a common function in regulating both signaling pathways. PHIP proteins also contain additional protein interaction domains, which may allow for the formation of multisubunit signaling complexes in response to insulin. In this regard, PHIP may serve as an adaptor that integrates IRS-1-mediated signals with signals from other cellular effectors of the activated insulin receptor. We are grateful to M. F. White, K. Siddle, and J. McGlade for antibodies, S. Hollenberg for yeast two hybrid reagents, and W. J. Muller and J. Rommans for cDNA libraries. We also thank John A. Hassell and Jonathan Lee for critical reading of the manuscript." @default.
• W1966691296 created "2016-06-24" @default.
• W1966691296 creator A5052143983 @default.
• W1966691296 creator A5062068275 @default.
• W1966691296 creator A5062271907 @default.
• W1966691296 creator A5078047793 @default.
• W1966691296 creator A5082955456 @default.
• W1966691296 date "2000-12-01" @default.
• W1966691296 modified "2023-10-16" @default.
• W1966691296 title "Cloning and Characterization of PHIP, a Novel Insulin Receptor Substrate-1 Pleckstrin Homology DomainInteracting Protein" @default.
• W1966691296 cites W1508994506 @default.
• W1966691296 cites W1630763432 @default.
• W1966691296 cites W1776073377 @default.
• W1966691296 cites W1906478988 @default.
• W1966691296 cites W1991246265 @default.
• W1966691296 cites W1993056875 @default.
• W1966691296 cites W2019258251 @default.
• W1966691296 cites W2031513892 @default.
• W1966691296 cites W2033529039 @default.
• W1966691296 cites W2038973974 @default.
• W1966691296 cites W2040291517 @default.
• W1966691296 cites W2050751458 @default.
• W1966691296 cites W2051758765 @default.
• W1966691296 cites W2058511768 @default.
• W1966691296 cites W2063904948 @default.
• W1966691296 cites W2064801081 @default.
• W1966691296 cites W2072279725 @default.
• W1966691296 cites W2089889881 @default.
• W1966691296 cites W2104955563 @default.
• W1966691296 cites W2106329420 @default.
• W1966691296 cites W2107155498 @default.
• W1966691296 cites W2122393978 @default.
• W1966691296 cites W2136400536 @default.
• W1966691296 cites W2155827586 @default.
• W1966691296 cites W89133559 @default.
• W1966691296 doi "https://doi.org/10.1074/jbc.c000611200" @default.
• W1966691296 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11018022" @default.
• W1966691296 hasPublicationYear "2000" @default.
• W1966691296 type Work @default.
• W1966691296 sameAs 1966691296 @default.
• W1966691296 citedByCount "52" @default.
• W1966691296 countsByYear W19666912962013 @default.
• W1966691296 countsByYear W19666912962014 @default.
• W1966691296 countsByYear W19666912962015 @default.
• W1966691296 countsByYear W19666912962016 @default.
• W1966691296 countsByYear W19666912962017 @default.
• W1966691296 countsByYear W19666912962018 @default.
• W1966691296 countsByYear W19666912962019 @default.
• W1966691296 countsByYear W19666912962020 @default.
• W1966691296 countsByYear W19666912962021 @default.
• W1966691296 countsByYear W19666912962022 @default.
• W1966691296 countsByYear W19666912962023 @default.
• W1966691296 crossrefType "journal-article" @default.
• W1966691296 hasAuthorship W1966691296A5052143983 @default.
• W1966691296 hasAuthorship W1966691296A5062068275 @default.
• W1966691296 hasAuthorship W1966691296A5062271907 @default.
• W1966691296 hasAuthorship W1966691296A5078047793 @default.
• W1966691296 hasAuthorship W1966691296A5082955456 @default.
• W1966691296 hasBestOaLocation W19666912961 @default.
• W1966691296 hasConcept C112446052 @default.
• W1966691296 hasConcept C121050878 @default.
• W1966691296 hasConcept C134018914 @default.
• W1966691296 hasConcept C165525559 @default.
• W1966691296 hasConcept C169627665 @default.
• W1966691296 hasConcept C181199279 @default.
• W1966691296 hasConcept C185592680 @default.
• W1966691296 hasConcept C18903297 @default.
• W1966691296 hasConcept C199360897 @default.
• W1966691296 hasConcept C201624660 @default.
• W1966691296 hasConcept C2777289219 @default.
• W1966691296 hasConcept C2777391703 @default.
• W1966691296 hasConcept C2779306644 @default.
• W1966691296 hasConcept C2994592520 @default.
• W1966691296 hasConcept C41008148 @default.
• W1966691296 hasConcept C49658373 @default.
• W1966691296 hasConcept C515207424 @default.
• W1966691296 hasConcept C55493867 @default.
• W1966691296 hasConcept C62478195 @default.
• W1966691296 hasConcept C86803240 @default.
• W1966691296 hasConceptScore W1966691296C112446052 @default.
• W1966691296 hasConceptScore W1966691296C121050878 @default.
• W1966691296 hasConceptScore W1966691296C134018914 @default.
• W1966691296 hasConceptScore W1966691296C165525559 @default.
• W1966691296 hasConceptScore W1966691296C169627665 @default.
• W1966691296 hasConceptScore W1966691296C181199279 @default.
• W1966691296 hasConceptScore W1966691296C185592680 @default.
• W1966691296 hasConceptScore W1966691296C18903297 @default.
• W1966691296 hasConceptScore W1966691296C199360897 @default.
• W1966691296 hasConceptScore W1966691296C201624660 @default.
• W1966691296 hasConceptScore W1966691296C2777289219 @default.
• W1966691296 hasConceptScore W1966691296C2777391703 @default.
• W1966691296 hasConceptScore W1966691296C2779306644 @default.
• W1966691296 hasConceptScore W1966691296C2994592520 @default.
• W1966691296 hasConceptScore W1966691296C41008148 @default.
• W1966691296 hasConceptScore W1966691296C49658373 @default.
• W1966691296 hasConceptScore W1966691296C515207424 @default.
• W1966691296 hasConceptScore W1966691296C55493867 @default.
• W1966691296 hasConceptScore W1966691296C62478195 @default.

• next