FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1966790817> ?p ?o ?g. }

• W1966790817 endingPage "51212" @default.
• W1966790817 startingPage "51203" @default.
• W1966790817 abstract "Leukocyte integrins must rapidly strengthen their binding to target endothelial sites to arrest rolling adhesions under physiological shear flow. We demonstrate that the integrin-associated tetraspanin, CD81, regulates VLA-4 and VLA-5 adhesion strengthening in monocytes and primary murine B cells. CD81 strengthens multivalent VLA-4 contacts within subsecond integrin occupancy without altering intrinsic adhesive properties to low density ligand. CD81 facilitates both VLA-4-mediated leukocyte rolling and arrest on VCAM-1 under shear flow as well as VLA-5-dependent adhesion to fibronectin during short stationary contacts. CD81 also augments VLA-4 avidity enhancement induced by either chemokine-stimulated Gi proteins or by protein kinase C activation, although it is not required for Gi protein or protein kinase C signaling activities. In contrast to other proadhesive integrin-associated proteins, CD81-promoted integrin adhesiveness does not require its own ligand occupancy or ligation. These results provide the first demonstration of an integrin-associated transmembranal protein that facilitates instantaneous multivalent integrin occupancy events that promote leukocyte adhesion to an endothelial ligand under shear flow. Leukocyte integrins must rapidly strengthen their binding to target endothelial sites to arrest rolling adhesions under physiological shear flow. We demonstrate that the integrin-associated tetraspanin, CD81, regulates VLA-4 and VLA-5 adhesion strengthening in monocytes and primary murine B cells. CD81 strengthens multivalent VLA-4 contacts within subsecond integrin occupancy without altering intrinsic adhesive properties to low density ligand. CD81 facilitates both VLA-4-mediated leukocyte rolling and arrest on VCAM-1 under shear flow as well as VLA-5-dependent adhesion to fibronectin during short stationary contacts. CD81 also augments VLA-4 avidity enhancement induced by either chemokine-stimulated Gi proteins or by protein kinase C activation, although it is not required for Gi protein or protein kinase C signaling activities. In contrast to other proadhesive integrin-associated proteins, CD81-promoted integrin adhesiveness does not require its own ligand occupancy or ligation. These results provide the first demonstration of an integrin-associated transmembranal protein that facilitates instantaneous multivalent integrin occupancy events that promote leukocyte adhesion to an endothelial ligand under shear flow. To emigrate from the bloodstream to specific sites of inflammation or antigen presentation, circulating leukocytes must rapidly develop firm adhesion to vessel walls in response to both adhesive and stimulatory endothelial signals (1Springer T.A. Cell. 1994; 76: 301-314Abstract Full Text PDF PubMed Scopus (6373) Google Scholar). These tissue-specific “traffic signals” orchestrate a selective multistep cascade of attachment (tethering), rolling, and arrest of recruited leukocyte subsets under disruptive shear forces (2Alon R. Feigelson S. Semin. Immunol. 2002; 14: 93-104Crossref PubMed Scopus (167) Google Scholar). The firm adhesions are mediated exclusively by subsets of leukocyte integrins, which include α4β7, VLA-4 (α4β1), and LFA-1 (3Berlin C. Bargatze R.F. Campbell J.J. von Andrian U.H. Szabo M.C. Hasslen S.R. Nelson R.D. Berg E.L. Erlandsen S.L. Butcher E.C. Cell. 1995; 80: 413-422Abstract Full Text PDF PubMed Scopus (895) Google Scholar, 4Henderson R.B. Lim L.H. Tessier P.A. Gavins F.N. Mathies M. Perretti M. Hogg N. J. Exp. Med. 2001; 194: 219-226Crossref PubMed Scopus (147) Google Scholar). These integrins exhibit basal recognition of ligand under shear flow and enable leukocyte capture, rolling, and arrest on their respective endothelial ligands when present at sufficiently high densities (5Alon R. Kassner P.D. Carr M.W. Finger E.B. Hemler M.E. Springer T.A. J. Cell Biol. 1995; 128: 1243-1253Crossref PubMed Scopus (627) Google Scholar, 6Sigal A. Bleijs D.A. Grabovsky V. van Vliet S.J. Dwir O. Figdor C.G. van Kooyk Y. Alon R. J. Immunol. 2000; 165: 442-452Crossref PubMed Scopus (100) Google Scholar). This basal integrin adhesiveness can be dramatically augmented by leukocyte exposure to appropriate endothelial chemokines in situ, which enhance integrin avidity through their respective G-protein-coupled receptors on tethered leukocytes (7Bargatze R.F. Butcher E.C. J. Exp. Med. 1993; 178: 367-372Crossref PubMed Scopus (251) Google Scholar, 8Constantin G. Majeed M. Giagulli C. Piccio L. Kim J.Y. Butcher E.C. Laudanna C. Immunity. 2000; 13: 759-769Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar).The mechanism of cellular regulation of both basal and chemokine-stimulated integrin adhesiveness to endothelial ligands is still obscure. Integrins exist in heterogeneous affinity states, constantly regulated through peripheral inflammatory or survival signals (9Feigelson S.W. Grabovsky V. Winter E. Chen L.L. Pepinsky R.B. Yednock T. Yablonski D. Lobb R. Alon R. J. Biol. Chem. 2001; 276: 13891-13901Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). However, the ability of VLA-4 to tether cells and support their rolling on the endothelial ligand, VCAM-1, 1The abbreviations used are: VCAMvascular cell adhesion moleculeDAGdiacylglycerolPKCprotein kinase CmAbmonoclonal antibodyICAMintercellular adhesion molecule 1PMAphorbol myristate acetateERKextracellular signal-regulated kinaseGFPgreen fluorescent proteinFNfibronectinMHCmajor histocompatibility complexPER-phycoerythrin.1The abbreviations used are: VCAMvascular cell adhesion moleculeDAGdiacylglycerolPKCprotein kinase CmAbmonoclonal antibodyICAMintercellular adhesion molecule 1PMAphorbol myristate acetateERKextracellular signal-regulated kinaseGFPgreen fluorescent proteinFNfibronectinMHCmajor histocompatibility complexPER-phycoerythrin. under shear flow does not require high affinity to soluble ligands (9Feigelson S.W. Grabovsky V. Winter E. Chen L.L. Pepinsky R.B. Yednock T. Yablonski D. Lobb R. Alon R. J. Biol. Chem. 2001; 276: 13891-13901Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). In addition, previous studies suggested that VLA-4 and LFA-1 associations with the intracellular actin-cytoskeleton control integrin adhesiveness to ligand under shear flow and are independent of the intrinsic affinity of these integrins to their respective ligands (5Alon R. Kassner P.D. Carr M.W. Finger E.B. Hemler M.E. Springer T.A. J. Cell Biol. 1995; 128: 1243-1253Crossref PubMed Scopus (627) Google Scholar, 6Sigal A. Bleijs D.A. Grabovsky V. van Vliet S.J. Dwir O. Figdor C.G. van Kooyk Y. Alon R. J. Immunol. 2000; 165: 442-452Crossref PubMed Scopus (100) Google Scholar). Accordingly, the ability of leukocyte integrins to self-cluster upon ligand binding has been predicted to facilitate the generation of high avidity tethers under disruptive shear forces even without acquisition of conformations with high affinity to monovalent ligands (10Grabovsky V. Feigelson S. Chen C. Bleijs R. Peled A. Cinamon G. Baleux F. Arenzana-Seisdedos F. Lapidot T. van Kooyk Y. Lobb R. Alon R. J. Exp. Med. 2000; 192: 495-505Crossref PubMed Scopus (287) Google Scholar).Evidence for specific integrin-associated partners that modulate integrin affinity or integrin clustering in leukocytes encountering endothelial or matrix ligands has been missing (11Porter J.C. Hogg N. Trends Cell Biol. 1998; 8: 390-396Abstract Full Text Full Text PDF PubMed Scopus (209) Google Scholar). Members of the tetraspanin family (transmembrane 4 superfamily (TM4SF)) of proteins, which consist of four highly conserved transmembrane domains (12Maecker H.T. Todd S.C. Levy S. FASEB J. 1997; 11: 428-442Crossref PubMed Scopus (805) Google Scholar), associate with specific integrins on the cell membrane and have been postulated to regulate integrin activities in leukocytes (11Porter J.C. Hogg N. Trends Cell Biol. 1998; 8: 390-396Abstract Full Text Full Text PDF PubMed Scopus (209) Google Scholar, 13Hemler M.E. Curr. Opin. Cell Biol. 1998; 10: 578-585Crossref PubMed Scopus (321) Google Scholar) as well as in other cell types (14Rubinstein E. Le Naour F. Billard M. Prenant M. Boucheix C. Eur. J. Immunol. 1994; 24: 3005-3013Crossref PubMed Scopus (142) Google Scholar, 15Berditchevski F. Zutter M.M. Hemler M.E. Mol. Biol. Cell. 1996; 7: 193-207Crossref PubMed Scopus (251) Google Scholar, 16Boucheix C. Rubinstein E. Cell. Mol. Life Sci. 2001; 58: 1189-1205Crossref PubMed Scopus (533) Google Scholar). The tetraspanins constitute a growing family of proteins implicated in cell signaling, motility, homotypic aggregation, viral entry, protein folding, and tumor metastasis (17Hemler M.E. J. Cell Biol. 2001; 155: 1103-1107Crossref PubMed Scopus (327) Google Scholar). The tetraspanins can either constitutively or inducibly associate with key signaling effectors of integrin function such as phosphatidylinositol 4-kinase (18Berditchevski F. Tolias K.F. Wong K. Carpenter C.L. Hemler M.E. J. Biol. Chem. 1997; 272: 2595-2598Abstract Full Text Full Text PDF PubMed Scopus (228) Google Scholar) and diacylglycerol (DAG)-dependent PKC isoforms (19Zhang X.A. Bontrager A.L. Hemler M.E. J. Biol. Chem. 2001; 276: 25005-25013Abstract Full Text Full Text PDF PubMed Scopus (297) Google Scholar). Several tetraspanins, including CD81, CD82, and CD151 as well as other integrin partners, augment integrin-dependent cell adhesion (20Behr S. Schriever F. J. Exp. Med. 1995; 182: 1191-1199Crossref PubMed Scopus (49) Google Scholar, 21Fenczik C.A. Sethi T. Ramos J.W. Hughes P.E. Ginsberg M.H. Nature. 1997; 390: 81-85Crossref PubMed Scopus (254) Google Scholar, 22Shibagaki N. Hanada K. Yamashita H. Shimada S. Hamada H. Eur. J. Immunol. 1999; 29: 4081-4091Crossref PubMed Scopus (65) Google Scholar, 23Lammerding J. Kazarov A.R. Huang H. Lee R.T. Hemler M.E. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7616-7621Crossref PubMed Scopus (140) Google Scholar). However, these activities are observed after prolonged contacts that involve cytoskeletal remodeling events downstream to the nascent integrin-dependent contacts. Recently, the β3- and β1-integrin-associated protein pentaspan, CD47, was shown to indirectly augment rapid VLA-4 adhesion strengthening to VCAM-1 under shear flow (24Ticchioni M. Raimondi V. Lamy L. Wijdenes J. Lindberg F.P. Brown E.J. Bernard A. FASEB J. 2001; 15: 341-350Crossref PubMed Scopus (48) Google Scholar). This CD47-mediated augmentation required, however, the co-occupancy of CD47 with its endothelial ligand and did not affect the inherent VLA-4 adhesion to VCAM-1 (24Ticchioni M. Raimondi V. Lamy L. Wijdenes J. Lindberg F.P. Brown E.J. Bernard A. FASEB J. 2001; 15: 341-350Crossref PubMed Scopus (48) Google Scholar). To date, functional evidence that a membranal integrin-associated molecule can directly up-regulate integrin avidity to ligand at rapid adhesive contacts independent of its own occupancy or ligation, has not been demonstrated.We now report that the CD81 tetraspanin is a key regulator of multivalent β1 integrin contacts that are critical for rapid adhesion strengthening in monocytes and primary murine B cells interacting with VCAM-1 under shear flow. This specialized activity does not require ligation or external occupancy of CD81 by ligand. CD81-facilitated VLA-4 adhesiveness results in the potentiation of rolling and arrest of CD81-expressing leukocytes on VCAM-1 as well as on immobilized integrin-binding mAb under shear flow. It also enables CD81-expressing leukocytes to integrate proadhesive inside-out signals from both chemokines and phorbol esters much more efficiently than CD81-null cells. CD81 is a first example of a membranal integrin-associated molecule acting as a facilitator of an exceptionally fast stabilization of multivalent integrin contacts under shear flow.EXPERIMENTAL PROCEDURESReagents and AntibodiesRecombinant 7-domain human VCAM-1, sVCAM-1, was provided by Dr. R. Lobb (Biogen, Cambridge, MA). Affinity purified human full-length ICAM-1 was a gift of Dr. T. Springer (Harvard University, Boston, MA). Affinity purified human VLA-5 binding FN fragment, FN-120, was from Invitrogen (Paisley, UK). The SDF-1 chemokine was purchased from R&D Systems (Minneapolis, MN). MβCD, bovine serum albumin (fraction V), poly-l-lysine, and Ca2+,Mg2+-free Hanks' balanced salt solution were from Sigma. Human serum albumin (fraction V) and PMA were purchased from Calbiochem (San Diego, CA). LY379196 (25Jirousek M.R. Gillig J.R. Gonzalez C.M. Heath W.F. McDonald 3rd, J.H. Neel D.A. Rito C.J. Singh U. Stramm L.E. Melikian-Badalian A. Baevsky M. Ballas L.M. Hall S.E. Winneroski L.L. Faul M.M. J. Med. Chem. 1996; 39: 2664-2671Crossref PubMed Scopus (325) Google Scholar) was a kind gift from Eli Lilly and Co. (Indianapolis, IN).The α4 integrin function blocking HP1/2 mAb, anti-CXCR4 12G5 (Pharmingen, San Diego, CA), α4-specific non-blocking B5G10 mAb, β1 integrin activating TS2/16, anti-αL TS2/4, a nonblocking anti-LFA-1 mAb, anti-β2 TS1/18, anti-human CD81 5A6, anti-mouse CD81 Eat-1, anti-mouse α4 (R1-2, Pharmingen), β1 integrin subunit mAb 15/7, anti-α4β7 Act-1 (a kind gift from Dr. M. J. Briskin), and the anti-L-selectin mAb DREG-200, were all used as purified Ig. The anti-human PKC isoform polyclonal Abs and anti-Lyn antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-phosphospecific ERK1/2 and polyclonal anti-ERK1/2 were kind gifts from Dr. Rony Seger, Weizmann Institute.CellsU937 cells were transfected with the mouse ecotropic viral receptor as described (26Baker B.W. Boettiger D. Spooncer E. Norton J.D. Nucleic Acids Res. 1992; 20: 5234Crossref PubMed Scopus (43) Google Scholar) and a single cell clone was isolated for subsequent infection by retroviral vectors. Human CD81 DNA was amplified by PCR using the forward primer GGTATGAATTCGCCGCCATGGGAGTGGAGGG and the reverse primer GGTACTCGAGCTCAGTACACGGAGCTGTTC (italized residues are the EcoRI and XhoI sites, and underlined are the start and stop codons). The amplified CD81 DNA was digested with EcoRI and XhoI and inserted into respective sites in the multicloning region of the retroviral vector pBMN-IRES-GFP. This retroviral vector encodes an IRES downstream of the multicloning region, followed by the green fluorescent protein (GFP), and was kindly provided by Dr. G. Nolan (Stanford University). Production of high titer ecotropic retrovirus in the θNX-Eco cells and infection by the retroviruses encoding the GFP alone or CD81 and GFP was performed as detailed. 2www.stanford.edu/group/nolan/retroviral_systems/phx.html. U937 cells-expressing CD81 and GFP or GFP alone were subcloned and cells were maintained in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum, 2 mml-glutamine, and antibiotics. Murine B and T splenocytes were prepared and cultured from wild type and CD81 knockout Balb/c mice, as described (27Maecker H.T. Levy S. J. Exp. Med. 1997; 185: 1505-1510Crossref PubMed Scopus (207) Google Scholar).Immunoprecipitation and Western Blot AnalysisFor immunoprecipitation studies, 5 × 107 cells were solubilized in 1 ml of lysis buffer (25 mm Tris, pH 7.5, 2 mm vanadate, 0.5 mm EGTA, 10 mm NaF, 10 mm Nappi, 80 mm β-glycerol phosphate, 25 mm NaCl, 10 mm MgCl2, 1% Brij 58, and one “protease inhibitor mixture” tablet (Roche Diagnostics)) and precleared with human serum albumin-conjugated Protein G-Sepharose (Danyel Biotech Ltd., Uppsala, Sweden). Lysates were immunoprecipitated with antibodies (10 μg/ml) for 60 min followed by the addition of Protein G beads overnight at 4 °C. Proteins were electrotransferred to nitrocellulose membranes and reacted with appropriate antibodies followed by peroxidase-labeled secondary antibodies. For Western blot studies, 1 × 107 cells (treated or untreated) were solubilized in 100 μl of lysis buffer (as above, but with 1% Nonidet P-40 instead of Brij 58) and 10 μl of lysates were separated by SDS-PAGE in reducing buffer. Blots were developed using enhanced chemiluminescence (ECL, Sigma).Antibody-coated Microbeads AssaySheep anti-mouse IgG magnetic M-280 Dynabeads (Dynal Biotech Inc., Lake Success, NY) were coated with various concentrations (0.004-1 μg/ml) of HP1/2 or isotope matched control mAb, according to the manufacturer's instructions. Cells and antibody-coated beads were mixed for 30 s in binding medium, consisting of H/H medium (Hanks' balanced salt solution containing 2 mg/ml bovine serum albumin and 10 mm Hepes, pH 7.4) supplemented with 1 mm CaCl2 and 1 mm MgCl2, at a concentration of 1 × 107 cells/ml at a 1 cell:8 beads ratio, followed by a 3-fold dilution in binding medium. The cellular side scatter, distinguishing between bead-bound and bead-free cells, was then analyzed immediately in a FACScan flow cytometer (BD Pharmingen). Binding specificity was confirmed by the complete absence of cell binding by control mAb-coated beads.Flow Cytometry and Immunofluorescence Cell StainingStaining and fluorescence activated cell sorter analysis were performed as previously described (9Feigelson S.W. Grabovsky V. Winter E. Chen L.L. Pepinsky R.B. Yednock T. Yablonski D. Lobb R. Alon R. J. Biol. Chem. 2001; 276: 13891-13901Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). For α4 integrin immunostaining, U937 monocytic cells were washed in PBS, fixed in 3% paraformaldehyde in PBS (30 min, room temperature), and incubated with anti-α4 B5G10 mAb for 30 min at 4 °C. Cells were then washed once with PBS + 5 mm EDTA and twice with PBS, 0.1% bovine serum albumin and then stained with Alexa Fluor-546-conjugated anti-mouse Ab (Molecular Probes). Cells were attached to poly-l-lysine-coated glass slides and coverslips were mounted with elvanol overnight. Fluorescence microscopy was performed with a confocal microscope (Nikon Eclipse TE300 with the Laser scanning system 2000, Bio-Rad).Laminar Flow Adhesion AssaysPreparation of Adhesive Substrates—Purified ligands or mAbs were dissolved in PBS buffered with 20 mm bicarbonate, pH 8.5, and incubated on a polystyrene plate (60 × 15-mm Petri dish; BD Biosciences) for 2 h at 37 °C or overnight at 4 °C. The plate was then washed three times with PBS and blocked with human serum albumin (20 mg/ml in PBS) for 2 h at 4 °C. For SDF-1 co-immobilization on the adhesive substrate, ligands were coated in the presence of normal or heat-denatured chemokine (R&D Systems) (2 μg/ml) and a carrier protein (human serum albumin, 2 μg/ml) as previously described (10Grabovsky V. Feigelson S. Chen C. Bleijs R. Peled A. Cinamon G. Baleux F. Arenzana-Seisdedos F. Lapidot T. van Kooyk Y. Lobb R. Alon R. J. Exp. Med. 2000; 192: 495-505Crossref PubMed Scopus (287) Google Scholar).Analysis of Cell Tethers and Adhesion Strength—A polystyrene plate on which purified ligand or integrin-specific mAb had been adsorbed was assembled on the lower wall of the flow chamber (260-μm gap) as previously described (9Feigelson S.W. Grabovsky V. Winter E. Chen L.L. Pepinsky R.B. Yednock T. Yablonski D. Lobb R. Alon R. J. Biol. Chem. 2001; 276: 13891-13901Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 28Dwir O. Kansas G.S. Alon R. J. Biol. Chem. 2000; 275: 18682-18691Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). Cells were washed with cation-free H/H medium, resuspended in binding medium (described above), and perfused through the flow chamber at the desired shear stress. All experiments were conducted at 37 °C and the entire period of cell perfusion was recorded with a long integration LIS-700 CCD video camera (Applitech, Holon, Israel). All cellular interactions with the adhesive substrates were manually quantified as previously described (10Grabovsky V. Feigelson S. Chen C. Bleijs R. Peled A. Cinamon G. Baleux F. Arenzana-Seisdedos F. Lapidot T. van Kooyk Y. Lobb R. Alon R. J. Exp. Med. 2000; 192: 495-505Crossref PubMed Scopus (287) Google Scholar). Tethers were defined as transient if cells attached briefly (<2 s) to the substrate, rolling if cells displayed a rolling motion for >5 s, and as arrests if immediately arrested and remaining stationary for at least 5 s of continuous flow. Frequencies of adhesive categories within differently pretreated cells were determined as a percentage of cells flowing immediately over the substrates, as previously described (10Grabovsky V. Feigelson S. Chen C. Bleijs R. Peled A. Cinamon G. Baleux F. Arenzana-Seisdedos F. Lapidot T. van Kooyk Y. Lobb R. Alon R. J. Exp. Med. 2000; 192: 495-505Crossref PubMed Scopus (287) Google Scholar). To assess rapid development of integrin avidity to ligand at stationary contacts, cells were allowed to settle onto the substrate for 1 min at stasis. Flow was then initiated and increased stepwise every 5 s by a programmed set of rates. At the indicated shear stresses, the number of cells that remained bound was expressed relative to the number of cells originally settled on the substrate.RESULTSCD81 Enhances the Avidity of α4Integrin Measured during Rapid Contact of Mouse B Lymphocyte and Human U937 Cells with Immobilized VCAM-1—To directly address the role of CD81 in integrin adhesion strengthening, we compared the ability of B splenocytes derived from normal and cd81-/- mice to develop integrin-dependent adhesion to the endothelial VLA-4 ligand, VCAM-1. CD81-expressing B splenocytes, although expressing slightly lower levels of α4 integrins (Fig. 1A, top left) generated much higher VLA-4 avidity to VCAM-1 than their CD81-null counterparts (Fig. 1A, right). In contrast, resting mouse wild type T splenocytes, which lack surface CD81 (Fig. 1B, bottom left), exhibited comparable VLA-4 avidity to VCAM-1 as that developed by T splenocytes derived from cd81-/- mice (Fig. 1B, right). This finding suggests that in B splenocytes, the CD81 tetraspanin enhances VLA-4 adhesion strengthening to VCAM-1 at rapid contact sites.The female infertility of cd81-/- mice (29Deng J. Yeung V.P. Tsitoura D. DeKruyff R.H. Umetsu D.T. Levy S. J. Immunol. 2000; 165: 5054-5061Crossref PubMed Scopus (47) Google Scholar) 3S. Levy, unpublished data. limited the availability of cells and thus the extensive molecular characterization of the role of CD81 in regulating VLA-4 properties in murine leukocytes. To extend these results to an in vitro human system, we utilized U937 promonocytic leukemia cells, which do not express endogenous CD81. The human monocyte line was reconstituted with CD81 by stable retroviral infection with a vector encoding CD81 and a GFP reporter (herein CD81), or with GFP alone (herein null). Clones identical in α4 integrin expression (Fig. 2A) were used for further characterization. Notably, both cells lacked α4β7 (Fig. 2A) indicating that all α4 expression in these cells is exclusively associated VLA-4 (α4β1).Fig. 2CD81 facilitates multivalent VLA-4 tethers to VCAM-1.A, flow cytometry of cell surface expression of VLA-4 (upper panel) or CD81 (lower panel) on CD81-deficient U937 cells transfected with CD81 and GFP reporter (CD81; black) or GFP reporter alone (Null; gray). Cells were stained with anti-α4-specific HP1/2 or anti-human CD81 5A6 mAbs, followed by secondary PE-labeled anti-mouse Ig. There was no detectable expression of α4β7 in both cells using the α4β7-specific mAb Act-I.4B, spontaneous adhesion of CD81-expressing or -null cells to high and low density VCAM-1 at stasis. Strength of adhesion was analyzed as described in the legend to Fig. 1. Antibody blocking of CD81-expressing cells with the anti-α4 HP1/2 mAb (10 μg/ml) completely eliminated all cell adhesion to both VCAM-1 densities, as depicted by the open triangle. The mean ± range of two independent fields is shown. C, mAb-induced CD81 ligation does not increases VLA-4 avidity to VCAM-1. CD81-expressing U937 cells were left untreated or incubated with mAb (5 μg/ml for 15 min at 37 °C) specific for CD81 (5A6) or L-selectin (DREG-200) or treated with activating mAb to β1 (TS2/16) and their strength of VLA-4-dependent adhesion to VCAM-1 (0.75 μg/ml) was analyzed. The mean ± range of two independent fields is depicted. D, tethering, rolling, and spontaneous arrest of CD81-null and CD81-expressing U937 cells interacting with VCAM-1 under continuous shear flow. Tethered cells, determined in two fields at 1 dyn/cm2, were grouped into three categories, as described under “Experimental Procedures.” Inset depicts enlarged bars for tether categories of both cell types on the lowest tested density VCAM-1. Results in B and D are representative of four experiments. Results in C are of three independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Reminiscent of B splenocytes (Fig. 1A), CD81-expressing monocytes developed greater shear-resistant VLA-4-dependent adhesion to high density VCAM-1 than their CD81-null counterparts after a 1-min static contact with the integrin ligand (Fig. 2B). Interestingly, CD81 did not contribute to VLA-4-dependent adhesion strengthening to low density VCAM-1 (Fig. 2B). CD81-augmented VLA-4 adhesiveness to VCAM-1 was α4-specific as it was entirely blocked by preincubation of the cells with either an α4 blocking mAb (Fig. 2B) or the VLA-4-specific ligand, Bio1211 (30Lin K. Ateeq H.S. Hsiung S.H. Chong L.T. Zimmerman C.N. Castro A. Lee W.C. Hammond C.E. Kalkunte S. Chen L.L. Pepinsky R.B. Leone D.R. Sprague A.G. Abraham W.M. Gill A. Lobb R.R. Adams S.P. J. Med. Chem. 1999; 42: 920-934Crossref PubMed Scopus (205) Google Scholar). 4S. W. Feigelson, V. Grabovsky, and R. Alon, unpublished data. This result ruled out a contribution of a direct co-adhesive interaction between CD81 and VCAM-1 to the VLA-4-dependent adhesion to VCAM-1. Pretreatment of CD81-expressing or null U937 cells with pharmacological inhibitors of PKC, protein-tyrosine kinase, and phosphatidylinositol 3-kinase did not affect the ability of their VLA-4 to develop adhesion strengthening at these rapid static contacts.4 Thus, the proadhesive effects of CD81 on VLA-4 adhesiveness did not involve activities of these kinases shortly prior to or within the time frame of the integrin contact with ligand. Furthermore, external ligation of CD81 with a stimulatory mAb (31Todd S.C. Lipps S.G. Crisa L. Salomon D.R. Tsoukas C.D. J. Exp. Med. 1996; 184: 2055-2060Crossref PubMed Scopus (82) Google Scholar) did not enhance VLA-4-dependent U937 adhesion VCAM-1 developed at 1-min static contacts at any ligand density tested (Fig. 2C).4 This result rules out the possibility that external CD81 ligation could, on its own, induce rapid generation of high VLA-4 avidity to VCAM-1.Strikingly, CD81 also dramatically up-regulated the ability of VLA-4 in U937 cells to support cell capture and rolling on VCAM-1 under persistent physiological shear flow (Fig. 2D). Reminiscent of its proadhesive role at stationary VLA-4/VCAM-1 contacts, the contribution of CD81 to enhanced VLA-4 adhesiveness to low density VCAM-1 was diminished (Fig. 2D). The ability of VLA-4 to capture cells and mediate their successive rolling adhesions on VCAM-1 under shear flow involves generation of critical avidity to VCAM-1 within adhesive contacts lasting fractions of seconds (9Feigelson S.W. Grabovsky V. Winter E. Chen L.L. Pepinsky R.B. Yednock T. Yablonski D. Lobb R. Alon R. J. Biol. Chem. 2001; 276: 13891-13901Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Thus, CD81 appeared to augment the ability of VLA-4 to generate critical binding avidity to high and medium density VCAM-1 at subsecond contacts without affecting the capacity of the integrin to recognize and transiently adhere to low density VCAM-1 (Fig. 2D, inset). As observed at stationary contacts, CD81 ligation with a stimulatory mAb failed to up-regulate VLA-4 mediated capture, rolling, or arrest on VCAM-1 under shear flow,4 suggesting that CD81 promotes VLA-4 avidity to high density ligand independent of its own ligation.CD81 Up-regulates Rapid VLA-4 Adhesion Strengthening without Altering Integrin Ligand Binding Properties or Preformed Clustering—Artificial stimulation of integrin affinity to ligand often rescues adhesive defects caused by impaired inside-out integrin signaling (9Feigelson S.W. Grabovsky V. Winter E. Chen L.L. Pepinsky R.B. Yednock T. Yablonski D. Lobb R. Alon R. J. Biol. Chem. 2001; 276: 13891-13901Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Suspension of CD81-null U937 cells in Mg2+ to artificially activate VLA-4 affinity did not rescue, however, the inability of VLA-4 to support high avidity adhesion to VCAM-1 at stasis.4 These results suggested that the major defect in VLA-4 function in CD81-null cells is affinity-independent. Consistent with this conclusion, direct binding to a monovalent VLA-4 binding peptide, the LDV derivative Bio1211 (30Lin K. Ateeq H.S. Hsiung S.H. Chong L.T. Zimmerman C.N. Castro A. Lee W.C. Hammond C.E. Kalkunte S. Chen L.L. Pepinsky R.B. Leone D.R. Sprague A.G. Abraham W.M. Gill A. Lobb R.R. Adams S.P. J. Med. Chem. 1999; 42: 920-934Crossref PubMed Scopus (205) Google Scholar), was identical in CD81-expressing and -null U937 cells,4 as was VLA-4-mediated adhesion to low density VCAM-1 (Fig. 2, B and C).We next considered that CD81 might promote VLA-4 avidity by enriching pre-existent high affinity VLA-4 subsets within the nascent contact site (9Feigelson S.W. Grabovsky V. Winter E. Chen L.L. Pepinsky R.B. Yednock T. Yablonski D. Lobb R. Alon R. J. Biol. Chem. 2001; 276: 13891-13901Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Recent ultrastructural and crystallographic studies conducted on isolated integrins and integrin-ligand complexes suggest that integrins of the β2 and β3 subfamilies can also regulate their adhesive bonds through rapid post-ligand stabilization events even witho" @default.
• W1966790817 created "2016-06-24" @default.
• W1966790817 creator A5002080116 @default.
• W1966790817 creator A5057266167 @default.
• W1966790817 creator A5061402018 @default.
• W1966790817 creator A5078591456 @default.
• W1966790817 creator A5084727753 @default.
• W1966790817 date "2003-12-01" @default.
• W1966790817 modified "2023-10-03" @default.
• W1966790817 title "The CD81 Tetraspanin Facilitates Instantaneous Leukocyte VLA-4 Adhesion Strengthening to Vascular Cell Adhesion Molecule 1 (VCAM-1) under Shear Flow" @default.
• W1966790817 cites W1502871643 @default.
• W1966790817 cites W1515952044 @default.
• W1966790817 cites W1557239654 @default.
• W1966790817 cites W1611220303 @default.
• W1966790817 cites W1651672993 @default.
• W1966790817 cites W1966475130 @default.
• W1966790817 cites W1971793612 @default.
• W1966790817 cites W1973532630 @default.
• W1966790817 cites W1981865792 @default.
• W1966790817 cites W1985106556 @default.
• W1966790817 cites W1989046246 @default.
• W1966790817 cites W1997926000 @default.
• W1966790817 cites W2001044562 @default.
• W1966790817 cites W2001269534 @default.
• W1966790817 cites W2001640037 @default.
• W1966790817 cites W2013867315 @default.
• W1966790817 cites W2019784233 @default.
• W1966790817 cites W2021119493 @default.
• W1966790817 cites W2023972740 @default.
• W1966790817 cites W2029218137 @default.
• W1966790817 cites W2031628629 @default.
• W1966790817 cites W2042397395 @default.
• W1966790817 cites W2051488333 @default.
• W1966790817 cites W2053947462 @default.
• W1966790817 cites W2061834380 @default.
• W1966790817 cites W2062306025 @default.
• W1966790817 cites W2063559096 @default.
• W1966790817 cites W2080352750 @default.
• W1966790817 cites W2080586428 @default.
• W1966790817 cites W2085629694 @default.
• W1966790817 cites W2088883508 @default.
• W1966790817 cites W2091305574 @default.
• W1966790817 cites W2094469836 @default.
• W1966790817 cites W2098438673 @default.
• W1966790817 cites W2099675490 @default.
• W1966790817 cites W2103062633 @default.
• W1966790817 cites W2103888948 @default.
• W1966790817 cites W2122360544 @default.
• W1966790817 cites W2126037485 @default.
• W1966790817 cites W2128509983 @default.
• W1966790817 cites W2128667409 @default.
• W1966790817 cites W2136059362 @default.
• W1966790817 cites W2139674076 @default.
• W1966790817 cites W2146038516 @default.
• W1966790817 cites W2147767883 @default.
• W1966790817 cites W2153005017 @default.
• W1966790817 cites W2157650875 @default.
• W1966790817 cites W2158362769 @default.
• W1966790817 cites W2159345463 @default.
• W1966790817 cites W2164774156 @default.
• W1966790817 cites W2165352885 @default.
• W1966790817 cites W2170262191 @default.
• W1966790817 cites W2217582891 @default.
• W1966790817 cites W2944147705 @default.
• W1966790817 cites W4231644493 @default.
• W1966790817 doi "https://doi.org/10.1074/jbc.m303601200" @default.
• W1966790817 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14532283" @default.
• W1966790817 hasPublicationYear "2003" @default.
• W1966790817 type Work @default.
• W1966790817 sameAs 1966790817 @default.
• W1966790817 citedByCount "92" @default.
• W1966790817 countsByYear W19667908172012 @default.
• W1966790817 countsByYear W19667908172013 @default.
• W1966790817 countsByYear W19667908172014 @default.
• W1966790817 countsByYear W19667908172015 @default.
• W1966790817 countsByYear W19667908172016 @default.
• W1966790817 countsByYear W19667908172017 @default.
• W1966790817 countsByYear W19667908172018 @default.
• W1966790817 countsByYear W19667908172020 @default.
• W1966790817 countsByYear W19667908172021 @default.
• W1966790817 countsByYear W19667908172022 @default.
• W1966790817 countsByYear W19667908172023 @default.
• W1966790817 crossrefType "journal-article" @default.
• W1966790817 hasAuthorship W1966790817A5002080116 @default.
• W1966790817 hasAuthorship W1966790817A5057266167 @default.
• W1966790817 hasAuthorship W1966790817A5061402018 @default.
• W1966790817 hasAuthorship W1966790817A5078591456 @default.
• W1966790817 hasAuthorship W1966790817A5084727753 @default.
• W1966790817 hasBestOaLocation W19667908171 @default.
• W1966790817 hasConcept C121332964 @default.
• W1966790817 hasConcept C135768490 @default.
• W1966790817 hasConcept C1491633281 @default.
• W1966790817 hasConcept C159985019 @default.
• W1966790817 hasConcept C16224149 @default.
• W1966790817 hasConcept C185592680 @default.
• W1966790817 hasConcept C192562407 @default.
• W1966790817 hasConcept C203014093 @default.
• W1966790817 hasConcept C2522874641 @default.

• next