FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1967495544> ?p ?o ?g. }

• W1967495544 endingPage "307" @default.
• W1967495544 startingPage "300" @default.
• W1967495544 abstract "To augment the detection of clonality in B-cell malignancies, we designed a consensus primer κ light chain gene (Igκ) polymerase chain reaction (PCR) assay in combination with a consensus primer immunoglobulin heavy chain gene (IgH) PCR assay. Its efficacy was then evaluated in a series of 86 paraffin tissue samples comprising neoplastic and reactive lymphoproliferations. Analysis after PCR was accomplished by 10% native polyacrylamide gel electrophoresis after heteroduplex pretreatment of PCR products and by a post-PCR chip-based capillary electrophoresis analytic method. Overall, 49 of 68 (72%) of mature B-cell neoplasms yielded discrete Igκ gel bands within the predicted size range with no clonotypic Igκ products observed among reactive lymphoid or T-cell proliferations. The application of Igκ PCR improved overall sensitivity from 81% with IgH PCR alone to 90% with combined Igκ/IgH PCR, with this effect being most notable in germinal center-related lymphomas. Sequencing of positive Igκ rearrangements revealed that most rearrangements involved members of the Vκ1 (40%) and Vκ2 (34%) gene families along with Jκ1 (26%), Jκ2 (23%), and Jκ4 (51%) gene segments. Involvement of Vκ pseudogenes was identified in 24% of cases with Vκ-KDE rearrangements. Our results demonstrate the efficacy of Igκ PCR in improving the detection rate of clonality in B-cell neoplasms and further introduce a novel post-PCR chip-based capillary electrophoresis analytic method for rapid PCR fragment size evaluation. To augment the detection of clonality in B-cell malignancies, we designed a consensus primer κ light chain gene (Igκ) polymerase chain reaction (PCR) assay in combination with a consensus primer immunoglobulin heavy chain gene (IgH) PCR assay. Its efficacy was then evaluated in a series of 86 paraffin tissue samples comprising neoplastic and reactive lymphoproliferations. Analysis after PCR was accomplished by 10% native polyacrylamide gel electrophoresis after heteroduplex pretreatment of PCR products and by a post-PCR chip-based capillary electrophoresis analytic method. Overall, 49 of 68 (72%) of mature B-cell neoplasms yielded discrete Igκ gel bands within the predicted size range with no clonotypic Igκ products observed among reactive lymphoid or T-cell proliferations. The application of Igκ PCR improved overall sensitivity from 81% with IgH PCR alone to 90% with combined Igκ/IgH PCR, with this effect being most notable in germinal center-related lymphomas. Sequencing of positive Igκ rearrangements revealed that most rearrangements involved members of the Vκ1 (40%) and Vκ2 (34%) gene families along with Jκ1 (26%), Jκ2 (23%), and Jκ4 (51%) gene segments. Involvement of Vκ pseudogenes was identified in 24% of cases with Vκ-KDE rearrangements. Our results demonstrate the efficacy of Igκ PCR in improving the detection rate of clonality in B-cell neoplasms and further introduce a novel post-PCR chip-based capillary electrophoresis analytic method for rapid PCR fragment size evaluation. Consensus primer polymerase chain reaction (PCR) amplification of the immunoglobulin heavy chain (IgH) gene complementary-determining region 3 (CDR3) is a routine ancillary diagnostic technique for evaluating clonality in B-cell lymphoproliferative disorders.1Inghirami G Szalbolcs MJ Yee HT Corradini P Cesarman E Knowles DM Detection of immunoglobulin gene rearrangement of B cell nonHodgkin's lymphomas and leukemias in fresh, unfixed and formalin-fixed, paraffin-embedded tissue by polymerase chain reaction.Lab Invest. 1993; 68: 746-757PubMed Google Scholar, 2Lehman CM Sarago C Nasim S Comerford J Karcher DS Garrett CT Comparison of Southern hybridization for the routine detection of immunoglobulin heavy chain gene rearrangements.Am J Clin Pathol. 1995; 103: 171-176Crossref PubMed Scopus (54) Google Scholar, 3Diaz-Cano S PCR-based alternative for diagnosis of immunoglobulin heavy chain gene rearrangement.Diag Mol Pathol. 1996; 5: 3-9Crossref PubMed Scopus (25) Google Scholar, 4Medeiros LJ Carr J Overview of the role of molecular methods in the diagnosis of malignant lymphomas.Arch Pathol Lab Med. 1999; 123: 1189-1207PubMed Google Scholar Although PCR methods have the advantage of rapidity and the requirement for minimal sample material (compared to genomic Southern blot analysis), the potential false-negative rate is a considerable shortcoming. A significant proportion of B-cell lymphomas do not demonstrate clonotypic IgH amplification mainly due to suboptimal primer binding, either from a lack of consensus target sequences or target site alteration as a result of somatic hypermutation. Alternative strategies for detecting IgH clonality using consensus primers directed against IgH framework region 2 (FR2) or framework region 1 (FR1) have been described,5Diss TC Pan L Peng H Wotherspoon AC Isaacson PG Sources of DNA for detecting B cell monoclonality using PCR.J Clin Pathol. 1994; 47: 493-496Crossref PubMed Scopus (120) Google Scholar, 6Segal GH Jorgensen T Masih AS Braylan RC Optimal primer selection for clonality assessment by polymerase chain reaction analysis: I. Low grade B-cell lymphoproliferative disorders of nonfollicular center cell type.Hum Pathol. 1994; 25: 1268-1275Google Scholar, 7Achille A Scarpa A Montresor M Scardoni M Zamboni G Chilosi M Capelli P Franzin G Menstrina F Routine application of polymerase chain reaction in the diagnosis of monoclonality of B-cell lymphoid proliferations.Diagn Mol Pathol. 1995; 4: 14-24Crossref PubMed Scopus (133) Google Scholar but these approaches are also subject to pitfalls. For example, IgH PCR using FR2 consensus primers may be subject to false-negative amplifications due to the lack of highly conserved sequences among many VH-FR2 regions, necessitating the use of highly degenerate consensus primers. The use of multiple IgH FR1 family-specific consensus primers can achieve a high clonal detection rate, but results in larger sized PCR products that are often not well amplified from paraffin-embedded tissue samples.8Deane M McCarthy KP Wiedemann LM Norton JD An improved method for detection of B-lymphoid clonality by polymerase chain reaction.Leukemia. 1991; 5: 726-730PubMed Google Scholar, 9Aubin J Davi F Nguyen-Salomon F Leboeuf D Debert C Taher M Valensi F Canioni D Brousse N Varet B Falndrin G MacIntyre EA Description of a novel FR1 IgH PCR strategy and its comparison with three other strategies for the detection of clonality in B cell malignancies.Leukemia. 1995; 9: 471-479PubMed Google Scholar In light of these issues, the immunoglobulin light chain genes can present attractive alternative targets for B-cell clonality determination. During normal B-cell differentiation, IgH gene rearrangements precede immunoglobulin κ light chain (Igκ) gene rearrangements, which in turn occur before immunoglobulin λ light chain (Igλ) gene rearrangements.10van der Burg M Tumkaya T Boerma M de Bruin-Versteeg S Langerak AW van Dongen JJM Ordered recombination of immunoglobulin light chain genes occurs at the IGK locus but seems less strict at the IGL locus.Blood. 2001; 97: 1001-1008Crossref PubMed Scopus (63) Google Scholar For a particular allele, if the Igκ gene rearrangement produces a nonfunctional Vκ-Jκ product, the locus may undergo segmental deletion via rearrangement with the downstream κ-deleting element (KDE).10van der Burg M Tumkaya T Boerma M de Bruin-Versteeg S Langerak AW van Dongen JJM Ordered recombination of immunoglobulin light chain genes occurs at the IGK locus but seems less strict at the IGL locus.Blood. 2001; 97: 1001-1008Crossref PubMed Scopus (63) Google Scholar, 11Simniovitch KA Bakshi A Goldman P Korsmeyer SJ A uniform deleting element mediates the loss of kappa genes in human B cells.Nature. 1985; 316: 260-262Crossref PubMed Scopus (192) Google Scholar, 12Beishuizen A Verhoeven MJ Mol EJ van Dongen JJM Detection of immunoglobulin kappa light chain gene rearrangement patterns by Southern blot analysis.Leukemia. 1994; 8: 2228-2236PubMed Google Scholar In fact, the vast majority of phenotypic λ-expressing B cells and a subset of κ-expressing B cells have rearrangements involving the KDE. Similar to Vκ-Jκ joinings, KDE-mediated Igκ gene rearrangements occur via recombination signal sequences located in either the Jκ-Cκ intron (ie, intron recombination signal sequences) or immediately 3′ to the Vκ gene segments, and these often exhibit junctional diversity with the addition of nontemplated (N) nucleotides. Both Vκ-Jκ and KDE rearrangements thus offer additional targets for detection of B-cell clonality by PCR. To further augment the ability to detect clonal B-cell populations in formalin-fixed, paraffin-embedded diagnostic tissue biopsies, we developed and applied a multiplex PCR approach to detect Vκ-Jκ and Vκ-KDE rearrangements in 68 cases of diverse types of mature B-cell neoplasms, as well as 18 other lymphoid proliferations. We demonstrate that a comprehensive Igκ PCR approach to identify both Vκ-Jκ and Vκ-KDE gene rearrangements significantly augments consensus primer IgH PCR for the detection of B-cell clonality and is suitable for paraffin-embedded tissue sources. This study further provides preliminary data regarding the utility of a post-PCR chip-based capillary electrophoresis (CBCE) analytic method that is capable of superior resolution for amplicon detection and sizing compared to standard gel analysis. Paraffin blocks from 68 cases of B-cell neoplasms (25 diffuse large B-cell lymphomas, 13 follicular lymphomas, 10 small lymphocytic lymphomas, 9 mantle cell lymphomas, 8 marginal zone lymphomas, and 3 multiple myelomas), along with 7 Hodgkin lymphomas, 2 peripheral T-cell lymphomas, and 9 reactive lymphoid proliferations were retrieved from the Pathology Departments of the University of New Mexico and William Beaumont Hospitals. All of the samples were clinical diagnostic cases obtained between 2001 to 2003 and were classified using conventional histopathological and clinical criteria in accordance with the World Health Organization classification of hematopoietic neoplasms.13Jaffe ES Harris NL Stein H Vardiman JW World Health Organization Classification of Tumors: Pathology and Genetics of Tumors of Haematopoietic and Lymphoid Tissues. IARC Press, Lyon2001Google Scholar The histological diagnosis was reviewed in each case by two of the investigators (R.P., D.V.), along with details of available flow cytometry data. This study was approved by the University of New Mexico Human Research Review Committee. Genomic DNA from all cases was extracted from formalin-fixed, paraffin-embedded tissue sections, according to the manufacturer's directions (DNEasy kit; Qiagen, Santa Clarita, CA) and quantitated by UV absorbance spectrophotometry. Three consensus family-specific VκFR3 region primers (designed to target the Vκ1 through Vκ6 gene families of Igκ), one consensus Jκ primer, and one KDE primer were used based on slight modifications of reported Vκ-FR3, Jκ, and KDE sequences.14van der Velden VHJ Willemse MJ van der Schoot CE Hahlen K van Wering ER van Dongen JJM Immunoglobulin kappa deleting element rearrangements in precursor-B acute B lymphoblastic leukemia are stable targets for detection of minimal residual disease.Leukemia. 2002; 16: 928-936Crossref PubMed Scopus (108) Google Scholar, 15Gong JZ Zheng S Chiarle R De Wolf-Peeters C Palestro G Frizzera G Inghirami G Detection of immunoglobulin κ light chain rearrangements by polymerase chain reaction.Am J Pathol. 1999; 155: 355-363Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 16Diss TC Liu HX Du MQ Isaacson PG Improvements to B cell clonality analysis using PCR amplification of immunoglobulin light chain genes.J Clin Pathol Mol Pathol. 2002; 55: 98-101Crossref PubMed Scopus (38) Google Scholar Less degeneracy was used in the family-specific Vκ-FR3 and Jκ primers at the 3′ end compared to previous studies.14van der Velden VHJ Willemse MJ van der Schoot CE Hahlen K van Wering ER van Dongen JJM Immunoglobulin kappa deleting element rearrangements in precursor-B acute B lymphoblastic leukemia are stable targets for detection of minimal residual disease.Leukemia. 2002; 16: 928-936Crossref PubMed Scopus (108) Google Scholar, 15Gong JZ Zheng S Chiarle R De Wolf-Peeters C Palestro G Frizzera G Inghirami G Detection of immunoglobulin κ light chain rearrangements by polymerase chain reaction.Am J Pathol. 1999; 155: 355-363Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 16Diss TC Liu HX Du MQ Isaacson PG Improvements to B cell clonality analysis using PCR amplification of immunoglobulin light chain genes.J Clin Pathol Mol Pathol. 2002; 55: 98-101Crossref PubMed Scopus (38) Google Scholar The three forward Vκ primers were designated as follows: VκI/VI targeting the VκI and VκVI gene families; VκIII/IV targeting the VκIII and VκIV gene families; and VκII targeting the VκII gene family. One consensus Jκ reverse primer was designed to target JκI, JκII, JκIII, and JκIV genes, and one reverse primer was designed to target the KDE locus. Nucleotide sequences for Vκ, Jκ, and KDE primers, as well as the schematics of the Igκ PCR strategy, are depicted in Figure 1. The Igκ PCR approach consisted of three different reaction tubes per sample (Figure 1). In tube 1, two Vκ primers (VκI/VI at 10 pmol/reaction and VκII at 20 pmol/reaction) were combined with the Jκ primer (at 10 pmol/reaction). In tube 2, one Vκ primer (VκIII/IV at 30 pmol/reaction) was combined with the Jκ primer (at 20 pmol/reaction). In tube 3, two Vκ primers (VκI/VI at 10 pmol/reaction and VκIII/IV at 30 pmol/reaction) were combined with the KDE primer (at 10 pmol/reaction). The primer combinations were arrived at based on preliminary experiments to optimize amplification efficiency and minimize primer interference and nonspecific product generation. For the Igκ PCR tubes, 200 ng of genomic DNA were subjected to amplification in a reaction mixture containing 1× GeneAmp PCR buffer (Applied Biosystems, Foster City, CA), 1.5 mmol/L MgCl2, 200 μmol/L of each dNTP, 2.5 U of Taq polymerase (Applied Biosystems), and the Vκ, Jκ, and KDE primer combinations as designated above, and shown in Figure 1. A touchdown PCR was used involving a denaturing period of 95°C for 5 minutes followed by eight cycles of 95°C for 30 seconds, 1 minute at 64°C, then decreasing the annealing temperature by 0.5°C each subsequent cycle, and 1 minute extension at 72°C. This was followed by 32 cycles of 95°C for 30 seconds, 60°C for 1 minute, and 72°C for 1 minute, with a final primer extension at 72°C for 5 minutes. Immunoglobulin heavy chain (IgH) gene rearrangements were amplified by PCR, using consensus oligonucleotide primers for VH-FR3 and JH regions, as previously described.17Beaubier NT Hart AP Bartolo C Willman CL Viswanatha DS Comparison of capillary electrophoresis and polyacrylamide gel electrophoresis for the evaluation of T and B cell clonality by polymerase chain reaction.Diagn Mol Pathol. 2000; 9: 121-131Crossref PubMed Scopus (43) Google Scholar For IgH PCR, 400 ng of genomic DNA were subjected to amplification in reaction mixtures containing 1× GeneAmp PCR buffer (Applied Biosystems), 1.5 mmol/L MgCl2, 200 μmol/L of each dNTP, 10 pmol of each primer, and 2.5 U of Taq polymerase (Applied Biosystems). PCR amplification was performed by denaturation at 95°C for 5 minutes followed by 40 cycles of 95°C for 30 seconds, 1 minute at 58°C, and 1 minute at 72°C. This was followed by a final primer extension at 72°C for 5 minutes. In all PCR experiments, genomic DNA from known monoclonal neoplastic B cells and reactive tonsil tissue were included as positive and negative controls, respectively. In addition, no DNA template (blank) controls were included with each sample run to exclude potential contamination. Amplification of a 165-bp segment of the β-globin gene (forward primer, 5′ACACAACTGTGTTCACTAGC3′; and reverse primer, 5′TGGTCTCCTTAAACCTGTCTTG3′) was performed in every sample as an internal control for DNA integrity. An additional larger fragment size β-globin gene amplification (325 bp) was subsequently performed (same forward primer with reverse primer 5′ATCAGGAGT GGACAGATCC3′) in a subset of cases found to be negative for Vκ-KDE amplification, to verify DNA integrity in this larger amplicon range. For Igκ PCR assay sensitivity determination, serial 10-fold dilutions of DNA from a patient sample positive for an Igκ Vκ-Jκ clonal rearrangement were made into tonsil DNA (polyclonal B-cell background). Each dilution was kept at 200 ng of total DNA. PCR amplification was performed as described for standard Igκ PCR. All Igκ PCR products were subjected to a heteroduplex (HDX) procedure, which involved heating the reaction for 5 minutes at 94°C followed by immediate immersion on ice for 60 minutes.18Ranheim EA Jones C Zehnder JL Sensitive detection of clonal immunoglobulin rearrangements in frozen and paraffin embedded tissues by polymerase chain reaction heteroduplex analysis.Diag Mol Path. 2000; 9: 177-183Crossref PubMed Scopus (11) Google Scholar Ten μl of the Igκ PCR products were then analyzed by 10% nondenaturing polyacrylamide gel electrophoresis (PAGE) in 1× TBE buffer for 40 minutes (Bio-Rad Mini-Protean II system; Bio-Rad, Hercules CA) at room temperature, stained with ethidium bromide, and visualized under UV light. The Vκ-Jκ PCR is predicted to amplify rearranged products of ∼130 to 150 bp, whereas the Vκ-KDE PCR was expected to amplify products of ∼250 to 300 bp. IgH PCR products (predicted size range ∼70 to 140 bp) were analyzed by 10% PAGE, but without HDX pretreatment. Samples with an unequivocal dominant band in the expected size ranges were interpreted as monoclonal, and those with a minimal smear pattern or absence of products were interpreted as polyclonal or negative, respectively. β-Globin controls were assessed concurrently with Igκ and IgH PCR product gel electrophoresis. To confirm the specificity of amplified Igκ gene rearrangements and determine patterns of gene segment usage, the clonal bands from all positive Igκ PCR cases were sequenced. PCR products were gel purified from 4% agarose gels using the Qiagen gel extraction kit, (Qiagen). The extracted PCR products were directly sequenced in one or both directions with Vκ, Jκ, or KDE primers, using the dye terminator method on an ABI 3100 capillary sequencer (Applied Biosystems). The derived sequences were compared to known germline DNA sequences of the IgκV- and J-regions using the V-BASE (CPE Cambridge, UK; http://www.mrc-cpe.cam.ac.uk/vbase-ok) and BLAST (NCBI/GenBank; http://www.ncbi.nlm.nih.gov/blast) computer programs. Individual positive cases, particularly with similar Vκ region use, were further compared to each other by pair-wise BLAST nucleotide alignment, to ensure unique sequence identity. From the nucleotide sequence information, data regarding Vκ and Jκ gene segment usage in each Igκ-positive case were obtained. These results were compared to established germline frequencies for Vκ and Jκ gene segments using χ2 statistical analysis. Analysis after PCR was also performed by a CBCE analytic method in 29 cases comprising a subset of Vκ-Jκ (21 cases) and Vκ-KDE (8 cases) clonal-positive cases, as well as several PCR-negative cases. For CBCE, the previously heteroduplexed PCR products were analyzed on a model 2100 bioanalyzer using DNA 500 chips (Agilent Technologies, Palo Alto, CA). The 16-well chips were prepared for analysis according to the manufacturer's directions and using 1 μl of PCR product per sample. A run time of ∼40 minutes was required for one complete chip (12 samples total), with real-time software rendering and display of the data. A clonal population was defined in this study as a single peak of greater than 15 relative fluorescence units on the y axis (for a 1-μl PCR product amount), falling in the expected product size range for Igκ amplicons. A low-intensity bell-shaped pattern or lack of products indicated polyclonal or negative results, respectively. The CBCE criteria were derived from our preliminary experience with this platform.19Avery AK Chakerian AE Magotra A Bononcini I Viswanatha DS Post-PCR chip-based capillary electrophoresis technique for B and T-cell clonality determination.Mod Pathol. 2004; 17: 350AGoogle Scholar The fragment size and relative intensity of each Igκ amplicon was compared with HDX-PAGE results. The Igκ PCR approach consisted of three different reaction tubes (Figure 1) to detect both Vκ-Jκ and Vκ-KDE rearrangements. Using this PCR strategy and post-PCR HDX-PAGE analysis, Igκ clonal products could be detected in 72% of mature B-cell non-Hodgkin lymphomas (Table 1). In each positive (clonal) case, a discrete band was identified by HDX-PAGE within the expected size range of 130 to 150 bp for Vκ-Jκ rearrangements and 250 to 300 bp for Vκ-KDE rearrangements (Figure 2). Larger sized, nonspecific HDX bands were also noted in the Vκ-Jκ PCR.Table 1Frequencies of IgH and Igκ Rearrangements in B-Cell NeoplasmsLymphoma typeIgH PCRVκ-Jκ PCRVκ-KDE PCRIgκ PCR*A case is defined as being positive for Igκ PCR overall if either a Vκ-Jκ or Vκ-KDE rearrangement was identified. overallIgH/Igκ overallDiffuse large B-cell lymphoma21/25 (84%)15/25 (60%)6/25 (24%)19/25 (76%)25/25 (100%)Follicular lymphoma6/13 (46%)4/13 (31%)4/13 (31%)8/13 (62%)8/13 (62%)Small lymphocytic lymphoma10/10 (100%)7/10 (70%)1/10 (10%)8/10 (80%)10/10 (100%)Mantle cell lymphoma9/9 (100%)6/9 (67%)2/9 (22%)6/9 (67%)9/9 (100%)Marginal zone lymphoma7/8 (88%)6/8 (75%)3/8 (38%)7/8 (88%)7/8 (88%)Multiple myeloma2/3 (67%)0/3 (0%)1/3 (33%)1/3 (33%)2/3 (67%)Hodgkin lymphoma1/7 (14%)0/7 (0%)2/7 (29%)2/7 (29%)2/7 (29%)†Positive Hodgkin lymphoma cases with syncytial histology.Reactive hyperplasias and T-cell neoplasms0/11 (0%)0/11 (0%)0/11 (0%)0/11 (0%)0/11 (0%)Overall B-cell non-Hodgkin lymphoma cases55/68 (81%)38/68 (56%)17/68 (25%)49/68 (72%)61/68 (90%)* A case is defined as being positive for Igκ PCR overall if either a Vκ-Jκ or Vκ-KDE rearrangement was identified.† Positive Hodgkin lymphoma cases with syncytial histology. Open table in a new tab For Igκ PCR, the highest detection rates were found in diffuse large B-cell lymphomas (76%), small lymphocytic lymphomas (80%), and marginal zone lymphomas (88%). The lowest detection rates were obtained in follicular lymphomas (62%), mantle cell lymphomas (67%), and myelomas (33%) (Table 1). The addition of Igκ PCR significantly increased the overall detection of clonality in mature B-cell tumors from 81% (IgH PCR alone) to 90% (combined Igκ/IgH PCR). This effect was most notable in the germinal center-associated lymphomas. For diffuse large B-cell lymphomas, the additional analysis of Igκ rearrangements improved the overall detection rate from 84% with IgH PCR alone to 100% with combined IgH/Igκ PCR (Table 1, Table 2). For follicular lymphomas, the additional analysis of Igκ rearrangements improved the overall detection of clonality from 46% with IgH PCR alone to 62% with combined IgH/Igκ PCR (Table 1, Table 2). For small lymphocytic lymphoma/chronic lymphocytic leukemia, marginal zone lymphoma, and mantle cell lymphoma, additional analysis by Igκ PCR did not significantly impact the overall detection rate of clonality. Igκ PCR also detected clonal rearrangements in two of seven cases of classical Hodgkin lymphoma, with one of these cases also demonstrating monoclonality by IgH PCR (Table 1); these cases were notable for syncytial histological features. No clonal Igκ products were observed in any of the 11 reactive lymphoid proliferations or T-cell lymphomas. The dilutional sensitivity of Igκ PCR was found to be 10%, using DNA from a Vκ-Jκ clonal lymphoma case diluted into a polyclonal B-cell background (Figure 3).Table 2Comparison of IgH and Igκ PCR for Diffuse Large B-Cell Lymphoma and Follicular LymphomaIgH/IgκDLBCL (n = 25)FL (n = 13)IgH+/Igκ+156IgH−/Igκ+42IgH+/Igκ−60IgH−/Igκ−05 Open table in a new tab Examination of the positive Igκ cases revealed that Vκ-Jκ rearrangements generally predominated over Vκ-KDE joinings, with the exception of an equal Vκ-KDE frequency in follicular lymphomas, and only Vκ-KDE use in the positive Hodgkin lymphoma and myeloma samples (Table 1). The surface light chain expression of 36 mature B-cell lymphomas was known by prior flow cytometric analysis. Of the 23 κ-expressing B-cell lymphomas, 10 cases (44%) had only a Vκ-Jκ rearrangement, 4 cases (17%) had a Vκ-KDE rearrangement only, 1 case (4%) had both Vκ-Jκ and Vκ-KDE rearrangements, and 8 cases (35%) had no rearrangements detected by Igκ PCR. Of the 13 λ-expressing B-cell lymphomas, 5 cases (39%) had only a Vκ-Jκ rearrangement, 3 cases (23%) had a Vκ-KDE rearrangement only, 3 cases (23%) had both Vκ-Jκ and Vκ-KDE rearrangements, and 2 cases (15%) had no rearrangements detected by Igκ PCR. These findings are summarized in Table 3. Of note, DNA samples from Vk-KDE-negative cases were successfully reamplified with primers encompassing a larger segment of the β-globin gene (325 bp), to ensure that insufficient DNA integrity was not the cause for the negative PCR results (data not shown).Table 3Igκ Rearrangement Frequencies by Light-Chain ExpressionIgκ rearrangement typeκ (n = 23)λ (n = 13)Vκ-Jκ only105Vκ-KDE only43Both Vκ-Jκ and Vκ-KDE13None82 Open table in a new tab A total of 56 Igκ PCR clonotypic alleles were sequenced. Vκ and Jκ gene use was assigned by comparison with known germline sequences using the V-BASE and BLAST computer programs. The prevalence of Vκ gene families in Vκ-Jκ gene rearrangements generally reflected the number of available germline Vκ gene segments within each family (Figure 4). Most Vκ-Jκ rearrangements involved members of the Vκ1 (40%) and Vκ2 (34%) gene families. There was a significant relative overrepresentation of Vκ4 gene family usage (14%) when compared to the number of available germline Vκ4 genes using χ2 statistical analysis (P = 0.015, χ2 = 5.92). Rearrangements involving Vκ pseudogenes were not identified in any of the Vκ-Jκ rearrangements. For Vκ-KDE rearrangements, members of the Vκ1 (35%) and Vκ2 (29%) gene families were most often used (Figure 4). Rearrangements involving Vκ pseudogenes were identified in 4 of 17 (24%) of the Vκ-KDE-positive cases and primarily involved Vκ2 and Vκ7 pseudogenes. Concerning the Jκ region, Jκ1 (26%), Jκ2 (23%), and Jκ4 (51%) gene segments were used most frequently (Figure 5). However, no involvement of the Jκ3 segment was observed.Figure 5Observed relative frequencies of Jκ gene segments in clonal Vκ-Jκ rearrangements. The relative frequencies were derived from sequence analysis of Vκ-Jκ PCR amplicons. Jκ3 segments were not detected among these cases.View Large Image Figure ViewerDownload Hi-res image Download (PPT) CBCE provided highly accurate PCR amplicon sizing in 29 clonal Igκ-positive samples tested, with representative results shown in Figure 6 A to C. By CBCE, the size range for Vκ-Jκ rearrangements was between 120 to 145 bp. An additional nonspecific peak was sometimes identified with Vκ-Jκ PCR at ∼210 bp. By CBCE, the size range for Vκ-KDE rearrangements was between 260 to 290 bp. PCR-negative samples showed either a minimal polyclonal pattern in the expected size ranges, or no deviation from baseline. The data from CBCE agreed well with HDX-PAGE results. CBCE was also more rapid and provided highly resolved histogram data for clonal results. Dilutional sensitivity of CBCE using the same clonal Vκ-Jκ lymphoma sample as in Figure 3 was comparable to HDX-PAGE at 10% detection in a polyclonal B-cell background (Figure 6; D to F). The recent publication of the European BIOMED-2 consortium underscores the value of using comprehensive PCR primers and multiple antigen receptor gene targets to establish the presence of a clonal lymphoid proliferation.20van Dongen JJ Langerak AW Bruggemann M Evans PA Hummel M Lavender FL Delabesse E Davi F Schuuring E Garcia-Sanz R van Krieken JH Droese J Gonzalez D Bastard C White HE Spaargaren M Gonzalez M Parreira A Smith JL Morgan GJ Kneba M Macintyre EA Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT98-3936.Leukemia. 2003; 17: 2257-2317Crossref PubMed Scopus (2444) Google Scholar Igκ gene rearrangements have been previously studied as additional markers of B-cell clonality.14van der Velden VHJ Willemse MJ van der Schoot CE Hahlen K van Wering ER van Dongen JJM Immunoglobulin kappa deleting element rearrangements in precursor-B acute B lymphoblastic leukemia are stable targets for detection of minimal residual disease.Leukemia. 2002; 16: 928-936Crossref PubMed Scopus (108) Google Scholar, 15Gong JZ Zheng S Chiarle R De Wolf-Peeters C Palestro G Frizzera G Inghirami G Detection of immunoglobulin κ light chain rearrangements by polymerase chain reaction.Am J Pathol. 1999; 155: 355-363Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 16Diss TC Liu HX Du MQ Isaacson PG Improvements to B cell clonality analysis using PCR amplification of immunoglobulin light chain genes.J Clin Pathol Mol Pathol. 2002; 55: 98-101Crossref PubMed Scopus (38) Google Scholar, 21Beishuizen A de Bruijn MAC Pongers-Willemse MJ Verhoeven MAJ van Wering ER Hahlen K Breit TM de Bruin-Versteeg S Hooijkaas H van Dongen JJM Heterogeneity in junctional regions of immunoglobulin kappa deleting element rearrangements in B cell leukemias: a new molecular target for detection of minimal residual di" @default.
• W1967495544 created "2016-06-24" @default.
• W1967495544 creator A5000964953 @default.
• W1967495544 creator A5005419037 @default.
• W1967495544 creator A5040612375 @default.
• W1967495544 creator A5070475666 @default.
• W1967495544 creator A5089255532 @default.
• W1967495544 date "2005-05-01" @default.
• W1967495544 modified "2023-10-14" @default.
• W1967495544 title "B-Cell Clonality Determination Using an Immunoglobulin κ Light Chain Polymerase Chain Reaction Method" @default.
• W1967495544 cites W1014423683 @default.
• W1967495544 cites W118906383 @default.
• W1967495544 cites W1480842845 @default.
• W1967495544 cites W17455494 @default.
• W1967495544 cites W1952075956 @default.
• W1967495544 cites W1980505087 @default.
• W1967495544 cites W1997313825 @default.
• W1967495544 cites W2004552493 @default.
• W1967495544 cites W2020094108 @default.
• W1967495544 cites W2022486030 @default.
• W1967495544 cites W2037129537 @default.
• W1967495544 cites W2043673311 @default.
• W1967495544 cites W2050056264 @default.
• W1967495544 cites W2054629719 @default.
• W1967495544 cites W2076976507 @default.
• W1967495544 cites W2102366445 @default.
• W1967495544 cites W2113670242 @default.
• W1967495544 cites W2150740393 @default.
• W1967495544 cites W2167540350 @default.
• W1967495544 cites W2287701780 @default.
• W1967495544 cites W2331095366 @default.
• W1967495544 cites W2397505074 @default.
• W1967495544 cites W2415375510 @default.
• W1967495544 cites W2415913309 @default.
• W1967495544 cites W2416260206 @default.
• W1967495544 cites W4244203476 @default.
• W1967495544 cites W4322388507 @default.
• W1967495544 cites W44817469 @default.
• W1967495544 doi "https://doi.org/10.1016/s1525-1578(10)60558-2" @default.
• W1967495544 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1867515" @default.
• W1967495544 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15858155" @default.
• W1967495544 hasPublicationYear "2005" @default.
• W1967495544 type Work @default.
• W1967495544 sameAs 1967495544 @default.
• W1967495544 citedByCount "25" @default.
• W1967495544 countsByYear W19674955442012 @default.
• W1967495544 countsByYear W19674955442014 @default.
• W1967495544 countsByYear W19674955442015 @default.
• W1967495544 countsByYear W19674955442016 @default.
• W1967495544 countsByYear W19674955442017 @default.
• W1967495544 countsByYear W19674955442019 @default.
• W1967495544 countsByYear W19674955442021 @default.
• W1967495544 crossrefType "journal-article" @default.
• W1967495544 hasAuthorship W1967495544A5000964953 @default.
• W1967495544 hasAuthorship W1967495544A5005419037 @default.
• W1967495544 hasAuthorship W1967495544A5040612375 @default.
• W1967495544 hasAuthorship W1967495544A5070475666 @default.
• W1967495544 hasAuthorship W1967495544A5089255532 @default.
• W1967495544 hasBestOaLocation W19674955441 @default.
• W1967495544 hasConcept C104317684 @default.
• W1967495544 hasConcept C121332964 @default.
• W1967495544 hasConcept C1276947 @default.
• W1967495544 hasConcept C153911025 @default.
• W1967495544 hasConcept C159654299 @default.
• W1967495544 hasConcept C199185054 @default.
• W1967495544 hasConcept C36394416 @default.
• W1967495544 hasConcept C49105822 @default.
• W1967495544 hasConcept C54355233 @default.
• W1967495544 hasConcept C70721500 @default.
• W1967495544 hasConcept C86803240 @default.
• W1967495544 hasConcept C96007430 @default.
• W1967495544 hasConceptScore W1967495544C104317684 @default.
• W1967495544 hasConceptScore W1967495544C121332964 @default.
• W1967495544 hasConceptScore W1967495544C1276947 @default.
• W1967495544 hasConceptScore W1967495544C153911025 @default.
• W1967495544 hasConceptScore W1967495544C159654299 @default.
• W1967495544 hasConceptScore W1967495544C199185054 @default.
• W1967495544 hasConceptScore W1967495544C36394416 @default.
• W1967495544 hasConceptScore W1967495544C49105822 @default.
• W1967495544 hasConceptScore W1967495544C54355233 @default.
• W1967495544 hasConceptScore W1967495544C70721500 @default.
• W1967495544 hasConceptScore W1967495544C86803240 @default.
• W1967495544 hasConceptScore W1967495544C96007430 @default.
• W1967495544 hasIssue "2" @default.
• W1967495544 hasLocation W19674955441 @default.
• W1967495544 hasLocation W19674955442 @default.
• W1967495544 hasLocation W19674955443 @default.
• W1967495544 hasLocation W19674955444 @default.
• W1967495544 hasOpenAccess W1967495544 @default.
• W1967495544 hasPrimaryLocation W19674955441 @default.
• W1967495544 hasRelatedWork W1658725198 @default.
• W1967495544 hasRelatedWork W1979609371 @default.
• W1967495544 hasRelatedWork W2023401925 @default.
• W1967495544 hasRelatedWork W2041818704 @default.
• W1967495544 hasRelatedWork W2047382476 @default.
• W1967495544 hasRelatedWork W2091394389 @default.
• W1967495544 hasRelatedWork W2117287173 @default.
• W1967495544 hasRelatedWork W2486080515 @default.

• next