FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1968166617> ?p ?o ?g. }

• W1968166617 endingPage "259" @default.
• W1968166617 startingPage "253" @default.
• W1968166617 abstract "Previous association studies that described the effect of an enlarged CAG repeat length in the Androgen Receptor (AR) gene on spermatogenesis could not prove or refute a true association because of methodological weaknesses. Here, we clearly show that there is no association between CAG repeat length variation and semen quality. Previous association studies that described the effect of an enlarged CAG repeat length in the Androgen Receptor (AR) gene on spermatogenesis could not prove or refute a true association because of methodological weaknesses. Here, we clearly show that there is no association between CAG repeat length variation and semen quality. Based on research in men with spinal bulbar muscular atrophy or Kennedy's disease, which is associated with low virilization, reduced sperm production, testicular atrophy, and male infertility, a possible role for the Androgen Receptor (AR) gene in spermatogenic failure was first suggested in 1983 (1La Spada A.R. Wilson E.M. Lubahn D.B. Harding A.E. Fischbeck K.H. Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy.Nature. 1991; 352: 77-79Crossref PubMed Scopus (2363) Google Scholar, 2Arbizu T. Santamaria J. Gomez J.M. Quilez A. Serra J.P. A family with adult spinal and bulbar muscular atrophy, X-linked inheritance and associated testicular failure.J Neurol Sci. 1983; 59: 371-382Abstract Full Text PDF PubMed Scopus (148) Google Scholar). In these men, expansion of the CAG repeat (also known as the polyglutamine tract) in exon 1 of the AR gene above 40 copies was found, and it was hypothesized that expansion of the CAG repeat up to 40 copies could cause spermatogenic failure in otherwise healthy men. In 1997, the first report on CAG repeat length variation in infertile men was published (3Tut T.G. Ghadessy F.J. Trifiro M.A. Pinsky L. Yong E.L. Long polyglutamine tracts in the androgen receptor are associated with reduced trans-activation, impaired sperm production, and male infertility.J Clin Endocrinol Metab. 1997; 82: 3777-3782Crossref PubMed Scopus (477) Google Scholar). This report described a case-control study in which the CAG repeat length of the AR gene in 153 infertile men was compared with the CAG repeat length in 73 proven fertile controls. Men included in that study were predominantly of Chinese origin. Individuals with a polyglutamine tract of 28 or more copies had a fourfold increased risk of being infertile, and, the more severe the spermatogenic defect, the higher was the proportion of patients with a longer repeat. Since that original publication, many association studies have been performed comparing CAG repeat length in the AR gene in patients and controls with conflicting results (Table 1).Table 1Literature review.NumberDefinitionMean CAG repeat (range)First author, year of publication (reference)JournalPatientsControlsPatientsControlsAssociationConclusionPatientsControlsTut TG, 1997 3Tut T.G. Ghadessy F.J. Trifiro M.A. Pinsky L. Yong E.L. Long polyglutamine tracts in the androgen receptor are associated with reduced trans-activation, impaired sperm production, and male infertility.J Clin Endocrinol Metab. 1997; 82: 3777-3782Crossref PubMed Scopus (477) Google ScholarJ Clin Endocrinol Metab15372infertileproven fertileyes≥28 CAG → OR >4NANAGiwercman YL, 1998 14Giwercman Y.L. Xu C. Arver S. Pousette A. Reneland R. No association between the androgen receptor gene CAG repeat and impaired sperm production in Swedish men.Clin Genet. 1998; 54: 435-436PubMed Google ScholarClin Genet33294infertileunselectednono difference in distributionNANAKomori S, 1999 15Komori S. Kasumi H. Kanazawa R. Sakata K. Nakata Y. Kato H. et al.CAG repeat length in the androgen receptor gene of infertile Japanese males with oligozoospermia.Mol Hum Reprod. 1999; 5: 14-16Crossref PubMed Scopus (47) Google ScholarMol Hum Reprod5936conc <20 × 106/mLnormospermica>20 × 106/mL.yes<16 CAG → only in patients21.2 (14–32)21.4 (16–31)Dowsing AT, 1999 16Dowsing A.T. Yong E.L. Clark M. McLachlan R.I. de Kretser D.M. Trounson A.O. Linkage between male infertility and trinucleotide repeat expansion in the androgen-receptor gene.Lancet. 1999; 354: 640-643Abstract Full Text Full Text PDF PubMed Scopus (237) Google ScholarLancet3032conc <20 × 106/mLproven fertileyeslonger CAG repeats in patients23.2 (15–34)20.5 (17–25)Legius E, 1999 17Legius E. Vanderschueren D. Spiessens C. D'Hooghe T. Matthijs G. Association between CAG repeat number in the androgen receptor and male infertility in a Belgian study.Clin Genet. 1999; 56: 166-167Crossref PubMed Scopus (36) Google ScholarClin Genet223181infertile (ICSI)unselectedyes≥27 CAG → OR 3.121.0 (15–30)21.0 (14–29)Hiort O, 1999 18Hiort O. Horter T. Schulze W. Kremke B. Sinnecker G.H. Male infertility and increased risk of diseases in future generations.Lancet. 1999; 354: 1907-1908Abstract Full Text Full Text PDF PubMed Google ScholarLancet18053conc <1 × 106/mLproven fertilenono difference in repeat length23.0 (13–30)24.0 (17–39)Yoshida KI, 1999 19Yoshida K.I. Yano M. Chiba K. Honda M. Kitahara S. CAG repeat length in the androgen receptor gene is enhanced in patients with idiopathic azoospermia.Urology. 1999; 54: 1078-1081Abstract Full Text Full Text PDF PubMed Google ScholarUrology4148azoospermicnormospermica>20 × 106/mL.yes≥31 CAG → only in patients23.9 (17–30)26.5 (20–34)Dadze S, 2000 20Dadze S. Wieland C. Jakubiczka S. Funke K. Schroder E. Royer-Pokora B. et al.The size of the CAG repeat in exon 1 of the androgen receptor gene shows no significant relationship to impaired spermatogenesis in an infertile caucasoid sample of German origin.Mol Hum Reprod. 2000; 6: 207-214Crossref PubMed Scopus (98) Google ScholarMol Hum Reprod11922conc <20 × 106/mLproven fertilenono difference in repeat length22.0 (16–34)20.8 (15–26)Mifsud A, 2001 21Mifsud A. Sim C.K. Boettger-Tong H. Moreira S. Lamb D.J. Lipshultz L.I. et al.Trinucleotide (CAG) repeat polymorphisms in the androgen receptor gene: molecular markers of risk for male infertility.Fertil Steril. 2001; 75: 275-281Abstract Full Text Full Text PDF PubMed Scopus (113) Google ScholarFertil Steril215142conc <20 × 106/mLproven fertileyes≥26 CAG → ↑ risk azoospermia21.7 (8–29)22.6 (14–33)Patrizio P, 2001J Androl6945conc <5 × 106/mLproven fertileyeslonger CAG repeats in patients23.5 (18–39)22.0 (12–30)von Eckardstein S, 2001 22Patrizio P. Leonard D.G. Chen K.L. Hernandez-Ayup S. Trounson A.O. Larger trinucleotide repeat size in the androgen receptor gene of infertile men with extremely severe oligozoospermia.J Androl. 2001; 22: 444-448PubMed Google ScholarJ Clin Endocrinol Metab43131conc <20 × 106/mLnormospermica>20 × 106/mL.nono difference in repeat length20.5 (17–27)20.0 (12–28)Sasagawa I, 2001 23Sasagawa I. Suzuki Y. Ashida J. Nakada T. Muroya K. Ogata T. CAG repeat length analysis and mutation screening of the androgen receptor gene in Japanese men with idiopathic azoospermia.J Androl. 2001; 22: 804-808PubMed Google ScholarJ Androl3051azoospermicnormospermica>20 × 106/mL.nono difference in repeat length23.4 (19–30)23.7 (17–28)Wallerand H, 2001 24Wallerand H. Remy-Martin A. Chabannes E. Bermont L. Adessi G.L. Bittard H. Relationship between expansion of the CAG repeat in exon 1 of the androgen receptor gene and idiopathic male infertility.Fertil Steril. 2001; 76: 769-774Abstract Full Text Full Text PDF PubMed Scopus (62) Google ScholarFertil Steril3750conc <20 × 106/mLproven fertileyeslonger CAG repeats in patients23.9 (13–28)22.2 (17–27)Rajpert- De Meyts E, 2002 25Rajpert-De Meyts E. Leffers H. Petersen J.H. Andersen A.G. Carlsen E. Jorgensen N. et al.CAG repeat length in androgen-receptor gene and reproductive variables in fertile and infertile men.Lancet. 2002; 359: 44-46Abstract Full Text Full Text PDF PubMed Scopus (88) Google ScholarLancet119110conc <20 × 106/mLproven fertilenono difference in repeat length21.5 (15–29)21.8 (14–33)van Golde R, 2002 26Van Golde R. Van Houwelingen K. Kiemeney L. Kremer J. Tuerlings J. Schalken J. et al.Is increased CAG repeat length in the androgen receptor gene a risk factor for male subfertility?.J Urol. 2002; 167: 621-623Abstract Full Text Full Text PDF PubMed Google ScholarJ Urol7570conc <1 × 106/mLurology patientsnono difference in repeat length21.7 (13–36)22.2 (15–31)Kukuvitis A, 2002 27Kukuvitis A. Georgiou I. Bouba I. Tsirka A. Giannouli C.H. Yapijakis C. et al.Association of oestrogen receptor alpha polymorphisms and androgen receptor CAG trinucleotide repeats with male infertility: a study in 109 Greek infertile men.Int J Androl. 2002; 25: 149-152Crossref PubMed Scopus (73) Google ScholarInt J Androl10964conc <20 × 106/mLproven fertileyes≥31 CAG → ↑ frequency in patients21.6 (15–33)21.0 (14–31)Madgar I, 2002 28Madgar I. Green L. Kent-First M. Weissenberg R. Gershoni-Baruch R. Goldman B. et al.Genotyping of Israeli infertile men with idiopathic oligozoospermia.Clin Genet. 2002; 62: 203-207Crossref PubMed Scopus (16) Google ScholarClin Genet6150conc <2 × 106/mLproven fertileyeslonger CAG repeats in patients18.6 (13–24)16.6 (11–22)Thangaraj K, 2002 29Thangaraj K. Joshi M.B. Reddy A.G. Gupta N.J. Chakravarty B. Singh L. CAG repeat expansion in the androgen receptor gene is not associated with male infertility in Indian populations.J Androl. 2002; 23: 815-818PubMed Google ScholarJ Androl280201azoospermicproven fertilenono difference in repeat length21.7 (12–32)22.4 (12–32)Casella R, 2003 30Casella R. Maduro M.R. Misfud A. Lipshultz L.I. Yong E.L. Lamb D.J. Androgen receptor gene polyglutamine length is associated with testicular histology in infertile patients.J Urol. 2003; 169: 224-227Abstract Full Text Full Text PDF PubMed Scopus (36) Google ScholarJ Urol7055conc <2 × 106/mLproven fertileyeslonger CAG repeats in patients22.0 (17–33)21.0 (8–27)Erasmuson T, 2003 31Erasmuson T. Sin I.L. Sin F.Y. Absence of association of androgen receptor trinucleotide expansion and poor semen quality.Int J Androl. 2003; 26: 46-51Crossref PubMed Scopus (19) Google ScholarInt J Androl10593conc <20 × 106/mLnormospermica>20 × 106/mL.nono difference in repeat length21.5 (9–26)21.0 (12–30)Lund A, 2003 32Lund A. Tapanainen J.S. Lahdetie J. Savontaus M.L. Aittomaki K. Long CAG repeats in the AR gene are not associated with infertility in Finnish males.Acta Obstet Gynecol Scand. 2003; 82: 162-166Crossref PubMed Scopus (33) Google ScholarActa Obstet Gynecol Scand192149infertileunselectednono difference in repeat length22.2 (16–30)22.4 (15–29)Mengual L, 2003 33Mengual L. Oriola J. Ascaso C. Ballesca J.L. Oliva R. An increased CAG repeat length in the androgen receptor gene in azoospermic ICSI candidates.J Androl. 2003; 24: 279-284Crossref PubMed Scopus (40) Google ScholarJ Androl10296azoospermicproven fertileyeslonger CAG repeats in patients23.3 (18–32)22.4 (15–34)Tse JY, 2003 34Tse J.Y. Liu V.W. Yeung W.S. Lau E.Y. Ng E.H. Ho P.C. Molecular analysis of the androgen receptor gene in Hong Kong Chinese infertile men.J Assist Reprod Genet. 2003; 20: 227-233Crossref PubMed Scopus (25) Google ScholarJ Assist Reprod Genet8545conc <5 × 106/mLproven fertileyes<16 and >30 → ↑ frequency in azoospermia23.1 (14–36)23.0 (16–30)Asatiani K, 2003 35Asatiani K. von Eckardstein S. Simoni M. Gromoll J. Nieschlag E. CAG repeat length in the androgen receptor gene affects the risk of male infertility.Int J Androl. 2003; 26: 255-261Crossref PubMed Scopus (39) Google ScholarInt J Androl217131infertilenormospermica>20 × 106/mL.yeslonger repeats in patients versus fathers21.5 (13–30)20.6 (12–28)Dhillon VS, 2003 36Dhillon V.S. Husain S.A. Cytogenetic and molecular analysis of the Y chromosome: absence of a significant relationship between CAG repeat length in exon 1 of the androgen receptor gene and infertility in Indian men.Int J Androl. 2003; 26: 286-295Crossref PubMed Scopus (16) Google ScholarInt J Androl18359conc <5 × 106/mLproven fertilenono difference in repeat length22.2 (13–33)21.5 (12–33)Milatiner D, 2004 37Milatiner D. Halle D. Huerta M. Margalioth E.J. Cohen Y. Ben Chetrit A. et al.Associations between androgen receptor CAG repeat length and sperm morphology.Hum Reprod. 2004; 19: 1426-1430Crossref PubMed Scopus (34) Google ScholarHum Reprod11458infertilenormospermica>20 × 106/mL.yeslonger repeats in teratozoospermia21.6 (13–30)21.5 (13–32)Ferlin A, 2004 38Ferlin A. Bartoloni L. Rizzo G. Roverato A. Garolla A. Foresta C. Androgen receptor gene CAG and GGC repeat lengths in idiopathic male infertility.Mol Hum Reprod. 2004; 10: 417-421Crossref PubMed Scopus (93) Google ScholarMol Hum Reprod163115conc <20 × 106/mLnormospermica>20 × 106/mL.yestwo CAG/CCG haplotypes → ↑ risk infertility21.7 (9–29)21.6 (9–31)Hadjkacem L, 2004 39Hadjkacem L. Hadj-Kacem H. Boulila A. Bahloul A. Ayadi H. Ammar-Keskes L. Androgen receptor gene CAG repeats length in fertile and infertile Tunisian men.Ann Genet. 2004; 47: 217-224Crossref PubMed Scopus (18) Google ScholarAnn Genet12998infertileproven fertilenono difference in repeat length20.8 (12–28)21.1 (14–29)Ruhayel Y, 2004 40Ruhayel Y. Lundin K. Giwercman Y. Hallden C. Willen M. Giwercman A. Androgen receptor gene GGN and CAG polymorphisms among severely oligozoospermic and azoospermic Swedish men.Hum Reprod. 2004; 19: 2076-2083Crossref PubMed Scopus (61) Google ScholarHum Reprod99223conc <5 × 106/mLproven fertileyes<21CAG/ GGN=23 → ↓ risk infertility22.0 (14–29)20.0 (12–30)Lavery R, 2005 41Lavery R. Houghton J.A. Nolan A. Glennon M. Egan D. Maher M. CAG repeat length in an infertile male population of Irish origin.Genetica. 2005; 123: 295-302Crossref PubMed Scopus (18) Google ScholarGenetica6677conc <20 × 106/mLproven fertilenono difference in repeat length23.3 (19–30)23.1 (19–30)Li ZX, 2005 42Li Z.X. Tang W.H. Wang Z.H. Wang L. Wang Y.Y. Ma L.L. et al.[(CAG) n polymorphism of androgen receptor gene in idiopathic azoospermic and oligospermic Chinese men.].Zhonghua Nan Ke Xue. 2005; 11 (342. Chinese): 335-338PubMed Google ScholarZhonghua Nan Ke Xue5231azoospermicoligozoospermicnono difference in repeat length22.222.1Tufan AC, 2005 43Tufan A.C. Satiroglu-Tufan N.L. Aydinuraz B. Satiroglu M.H. Aydos K. Bagci H. No association of the CAG repeat length in exon 1 of the androgen receptor gene with idiopathic infertility in Turkish men: implications and literature review.Tohoku J Exp Med. 2005; 206: 105-115Crossref PubMed Scopus (20) Google ScholarTohoku J Exp Med4732infertileproven fertilenono difference in repeat length22.3 (18–29)22.4 (16–29)Canale C, 2005 44Canale D. Caglieresi C. Moschini C. Liberati C.D. Macchia E. Pinchera A. et al.Androgen receptor polymorphism (CAG repeats) and androgenicity.Clin Endocrinol (Oxf). 2005; 63: 356-361Crossref PubMed Scopus (61) Google ScholarClin Endocrinol2991infertilenormoandrogenicnono difference in repeat length21.521.4Dakouane-Giudicelli, 2006 45Dakouane-Giudicelli M. Legrand B. Bergere M. Giudicelli Y. Cussenot O. Selva J. Association between androgen receptor gene CAG trinucleotide repeat length and testicular histology in older men.Fertil Steril. 2006; 86: 873-877Abstract Full Text Full Text PDF PubMed Scopus (9) Google ScholarFertil Steril1513arrested spermatogenesisnormospermica>20 × 106/mL.nono difference in repeat length21.9 (18–25)22.8 (15–27)Note: conc = concentration; NA = not available.a >20 × 106/mL. Open table in a new tab Note: conc = concentration; NA = not available. Despite the large body of literature on this subject, nearly all studies have methodologic concerns. First, most studies have small sample sizes (<200 patients) although obviously large sample sizes are needed, in particular when a genetic variant is incompletely penetrant and thus will have a small effect on the parameter under investigation (4Hattersley A.T. McCarthy M.I. What makes a good genetic association study?.Lancet. 2005; 366: 1315-1323Abstract Full Text Full Text PDF PubMed Scopus (387) Google Scholar). Second, most studies are unmatched case-control studies leaving open the possibility of confounding factors. Third, and most importantly, most studies compare men with low sperm counts to fertile control men with unknown sperm counts. These controls are inappropriate when studying spermatogenesis, because nonpaternity can act as a confounder and the ability to father children is not the same as having normal sperm counts, i.e., men with low sperm counts can easily conceive naturally (5Almagor M. Dan-Goor M. Hovav Y. Yaffe H. Spontaneous pregnancies in severe oligoasthenozoospermia.Hum Reprod. 2001; 16: 1780-1781Crossref PubMed Google Scholar, 6Macintyre S. Sooman A. Non-paternity and prenatal genetic screening.Lancet. 1991; 338: 869-871Abstract PubMed Scopus (95) Google Scholar). Because of the conflicting results and methodologic concerns of previous studies, we set out to investigate the effect of CAG repeat length variation in the AR gene on semen quality in a large cohort of consecutively included men with varying semen quality. All men who attended the Center for Reproductive Medicine from the Academic Medical Center from January 2000 until September 2005 as part of a subfertile couple and gave informed consent were included in our study. During the first visit a medical history was taken to check for possible exclusion criteria. Primary exclusion criteria were a history of surgery of the vasa deferentia, bilateral orchidectomy, chemo- or radiotherapy, and bilateral cryptorchidism. Men were also excluded if the fertility workup had identified obstructive azoospermia, retrograde ejaculation, numerical or structural chromosome abnormalities, or Y-chromosome deletions. At least two semen analyses were performed for each patient according to World Health Organization guidelines (7World Health Organization WHO laboratory manual for the examination of human semen and sperm-cervical mucus interaction.4th ed. Cambridge University Press, Cambridge1999Google Scholar) as part of standard patient care, and retrospectively linked to each included patient. The Institutional Review Board of the Academic Medical Center approved this study. DNA was extracted from peripheral blood leucocytes according to standard procedures. The CAG repeat in exon 1 of the AR gene was amplified by using sense (5′- AGATTCAGCCAAGCTCAAGG) and antisense (5′- CTCATCCAGGACCAGGTAGC) primers, using the available AR genomic sequence information from NCBI (NM_000044). Polymerase chain reaction (PCR) was carried out in a total volume of 25 μL and contained 50 ng DNA, 2.5 μL 10× buffer B (Solis Biodyne, Tartu, Estonia), 0.2 mmol/L dNTPs, 20 pmol forward and reverse primer, 3 mmol/L MgCl2, and 1 U HOT FIREPol DNA polymerase (Solis Biodyne). We used a touchdown PCR program with a temperature range of 69°C–62°C, with a 1°C decrement per cycle and 1 cycle increment per temperature step, and a final amplification for 20 cycles at 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 30 seconds with a final extension at 72°C for 5 minutes. To determine the CAG repeat length we used direct sequencing methods, using the same primers as those used for PCR, on an automated ABI Prism 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA). All sequences were analyzed with the CodonCode Aligner software (CodonCode Corporation, Dedham, MA). The average of all semen analyses for each individual patient was used in the statistical analyses. CAG repeat length and semen parameters were tested for normal distribution using the Shapiro-Wilk test. Data are presented as either mean ± SD in case of normally distributed variables (CAG repeat length, volume, and morphology) or as median with 25th and 75th percentiles (concentration, motility, total count, and total motile count). Associations between CAG repeat length and semen parameters were expressed using Spearman correlation coefficients. To investigate the possible effect of genetic heterogeneity on the association between CAG repeat length and semen quality, all semen characteristics were analyzed using a (nonparametric) analysis of variance (ANOVA) model that included CAG repeat length, ethnicity, and their interaction as predictors. All statistical analyses were carried out using SPSS (version 14.0), and P values of <.05 were considered to be significant. We consecutively included 700 men that attended the Center for Reproductive Medicine for fertility workup. Their mean age was 39.2 (±6.3) years. Mean semen volume was 3.4 (±1.5) mL, median sperm concentration was 48.5 (15.0–87.6) × 106/mL, median progressive motility was 33.5% (19.6%–43.5%), mean normal morphology was 37.2% (±15.7%), median total sperm count (TC) was 144.2 (42.4–281.3) × 106, and median total motile sperm count (TMC) was 46.9 (5.5–108.4) × 106. Sixty-five percent of the men were of Dutch origin, 13% of Central African origin, 6% of Asian origin, 5% of Northern African origin, and 11% of another origin. The mean CAG repeat length in the entire cohort was 21.5 ± 3.1 (range 9–35), with a mean CAG repeat length of 19.9 ± 3.0 (11–27) in men from Central Africa, 20.9 ± 2.7 (15–28) in men from Northern Africa, 21.9 ± 2.9 (15–27) in Asian men, and 21.9 ± 3.0 (12–34) in Dutch men. The correlation between CAG repeat length variation and semen quality is shown in Figure 1. The Spearman correlation coefficient was low and not significant for any of the semen parameters. The ANOVA model predicted a possible interaction between CAG repeat length and ethnicity on total sperm count (TC) (P=.033) and total motile sperm count (TMC) (P=.024). However, subgroup analysis of the two largest ethnic groups showed no correlation between CAG repeat length variation and semen quality (data not shown). The strength of the present study is that we have investigated the effect of CAG repeat length variation in the AR gene on spermatogenesis in a large consecutively included cohort of subfertile men with varying degrees of semen quality. All previous studies had an unmatched case-control design, and most studies compared the mean CAG repeat length of men with low sperm counts with that of fertile control subjects with unknown sperm counts. Those studies could therefore never prove or refute a true association between CAG repeat length variation and semen quality. A weakness of the present study is that we did not take into account environmental factors that may influence semen quality. Therefore, we cannot exclude possible confounding by such factors. However, it is still unclear whether and which environmental factors truly affect semen quality, and a link between CAG repeat length and such factors seems unlikely (8Giwercman A. Rylander L. Hagmar L. Giwercman Y.L. Ethnic differences in occurrence of TDS— genetics and/or environment?.Int J Androl. 2006; 29: 291-297Crossref PubMed Scopus (34) Google Scholar, 9Skakkebaek N.E. Rajpert-De Meyts E. Main K.M. Testicular dysgenesis syndrome: an increasingly common developmental disorder with environmental aspects.Hum Reprod. 2001; 16: 972-978Crossref PubMed Scopus (1742) Google Scholar). Several functional studies support the results of the present study that CAG repeat length variation in the AR gene does not have any effect on spermatogenesis. Although those studies showed an inverse relationship between AR repeat length and transactivation capacity, i.e., an enlarged CAG repeat length reduced AR activity (10Mhatre A.N. Trifiro M.A. Kaufman M. Kazemi-Esfarjani P. Figlewicz D. Rouleau G. et al.Reduced transcriptional regulatory competence of the androgen receptor in X-linked spinal and bulbar muscular atrophy.Nat Genet. 1993; 5: 184-188Crossref PubMed Scopus (320) Google Scholar, 11Chamberlain N.L. Driver E.D. Miesfeld R.L. The length and location of CAG trinucleotide repeats in the androgen receptor N-terminal domain affect transactivation function.Nucleic Acids Res. 1994; 22: 3181-3186Crossref PubMed Scopus (957) Google Scholar, 12Kazemi-Esfarjani P. Trifiro M.A. Pinsky L. Evidence for a repressive function of the long polyglutamine tract in the human androgen receptor: possible pathogenetic relevance for the (CAG)n-expanded neuronopathies.Hum Mol Genet. 1995; 4: 523-527Crossref PubMed Scopus (380) Google Scholar), alterations in the range of 9–35 copies did not affect the level of mRNA expression in transfected cells (13Buchanan G. Yang M. Cheong A. Harris J.M. Irvine R.A. Lambert P.F. et al.Structural and functional consequences of glutamine tract variation in the androgen receptor.Hum Mol Genet. 2004; 13: 1677-1692Crossref PubMed Scopus (164) Google Scholar). Thus, within this range there appears to be no effect on the functionality of the AR gene. Only when the CAG repeat in the AR gene rises above 40 repeats, as is the case in Kennedy's disease, a mild androgen insensitivity syndrome with spermatogenic failure seems part of the phenotype (1La Spada A.R. Wilson E.M. Lubahn D.B. Harding A.E. Fischbeck K.H. Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy.Nature. 1991; 352: 77-79Crossref PubMed Scopus (2363) Google Scholar, 2Arbizu T. Santamaria J. Gomez J.M. Quilez A. Serra J.P. A family with adult spinal and bulbar muscular atrophy, X-linked inheritance and associated testicular failure.J Neurol Sci. 1983; 59: 371-382Abstract Full Text PDF PubMed Scopus (148) Google Scholar). In general, the results of the present study highlight the importance of appropriate study design when performing genetic association studies in the field of spermatogenic failure. Sperm production is a quantitative trait and should be studied as such. Thus, in an association study, semen parameters must be analyzed as continuous variables rather than dichotomous variables as has been done in all studies published to date. Consequently, the most appropriate design to study the effect of a genetic variant on spermatogenesis in subfertile men is screening of a large cohort of men with all degrees of semen quality and comparing the mean semen parameters of men with and men without the genetic variant under study, as we have done in the current study. In conclusion, we have shown, using a cohort-based approach, that there is no correlation between CAG repeat length expansion in the AR gene and semen quality. Thus, screening of the CAG repeat in men with low semen quality is of no clinical value." @default.
• W1968166617 created "2016-06-24" @default.
• W1968166617 creator A5002367526 @default.
• W1968166617 creator A5015849613 @default.
• W1968166617 creator A5047756279 @default.
• W1968166617 creator A5069842223 @default.
• W1968166617 creator A5075584588 @default.
• W1968166617 date "2008-01-01" @default.
• W1968166617 modified "2023-10-13" @default.
• W1968166617 title "CAG repeat length variation in the Androgen Receptor gene is not associated with spermatogenic failure" @default.
• W1968166617 cites W1520680152 @default.
• W1968166617 cites W1600968738 @default.
• W1968166617 cites W1685186645 @default.
• W1968166617 cites W1817657541 @default.
• W1968166617 cites W1965004732 @default.
• W1968166617 cites W1965902692 @default.
• W1968166617 cites W1976163803 @default.
• W1968166617 cites W1991660197 @default.
• W1968166617 cites W1993019294 @default.
• W1968166617 cites W1998476721 @default.
• W1968166617 cites W2000731870 @default.
• W1968166617 cites W2015451669 @default.
• W1968166617 cites W2019199131 @default.
• W1968166617 cites W2030437301 @default.
• W1968166617 cites W2036103100 @default.
• W1968166617 cites W2042606922 @default.
• W1968166617 cites W2045173966 @default.
• W1968166617 cites W2056545208 @default.
• W1968166617 cites W2058048168 @default.
• W1968166617 cites W2067765249 @default.
• W1968166617 cites W2101065984 @default.
• W1968166617 cites W2107738667 @default.
• W1968166617 cites W2111541375 @default.
• W1968166617 cites W2112320299 @default.
• W1968166617 cites W2113333419 @default.
• W1968166617 cites W2117390359 @default.
• W1968166617 cites W2125684589 @default.
• W1968166617 cites W2128544336 @default.
• W1968166617 cites W2131000799 @default.
• W1968166617 cites W2131173898 @default.
• W1968166617 cites W2137097936 @default.
• W1968166617 cites W2139494740 @default.
• W1968166617 cites W2141785141 @default.
• W1968166617 cites W2143322087 @default.
• W1968166617 cites W2160549243 @default.
• W1968166617 cites W2166976418 @default.
• W1968166617 cites W2168512066 @default.
• W1968166617 cites W2171423639 @default.
• W1968166617 doi "https://doi.org/10.1016/j.fertnstert.2007.02.001" @default.
• W1968166617 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17889867" @default.
• W1968166617 hasPublicationYear "2008" @default.
• W1968166617 type Work @default.
• W1968166617 sameAs 1968166617 @default.
• W1968166617 citedByCount "19" @default.
• W1968166617 countsByYear W19681666172012 @default.
• W1968166617 countsByYear W19681666172013 @default.
• W1968166617 countsByYear W19681666172016 @default.
• W1968166617 countsByYear W19681666172018 @default.
• W1968166617 countsByYear W19681666172020 @default.
• W1968166617 crossrefType "journal-article" @default.
• W1968166617 hasAuthorship W1968166617A5002367526 @default.
• W1968166617 hasAuthorship W1968166617A5015849613 @default.
• W1968166617 hasAuthorship W1968166617A5047756279 @default.
• W1968166617 hasAuthorship W1968166617A5069842223 @default.
• W1968166617 hasAuthorship W1968166617A5075584588 @default.
• W1968166617 hasBestOaLocation W19681666171 @default.
• W1968166617 hasConcept C104317684 @default.
• W1968166617 hasConcept C121332964 @default.
• W1968166617 hasConcept C121608353 @default.
• W1968166617 hasConcept C134018914 @default.
• W1968166617 hasConcept C2777911890 @default.
• W1968166617 hasConcept C2778334786 @default.
• W1968166617 hasConcept C2780192828 @default.
• W1968166617 hasConcept C44870925 @default.
• W1968166617 hasConcept C54355233 @default.
• W1968166617 hasConcept C61367390 @default.
• W1968166617 hasConcept C71315377 @default.
• W1968166617 hasConcept C86803240 @default.
• W1968166617 hasConceptScore W1968166617C104317684 @default.
• W1968166617 hasConceptScore W1968166617C121332964 @default.
• W1968166617 hasConceptScore W1968166617C121608353 @default.
• W1968166617 hasConceptScore W1968166617C134018914 @default.
• W1968166617 hasConceptScore W1968166617C2777911890 @default.
• W1968166617 hasConceptScore W1968166617C2778334786 @default.
• W1968166617 hasConceptScore W1968166617C2780192828 @default.
• W1968166617 hasConceptScore W1968166617C44870925 @default.
• W1968166617 hasConceptScore W1968166617C54355233 @default.
• W1968166617 hasConceptScore W1968166617C61367390 @default.
• W1968166617 hasConceptScore W1968166617C71315377 @default.
• W1968166617 hasConceptScore W1968166617C86803240 @default.
• W1968166617 hasIssue "1" @default.
• W1968166617 hasLocation W19681666171 @default.
• W1968166617 hasLocation W19681666172 @default.
• W1968166617 hasOpenAccess W1968166617 @default.
• W1968166617 hasPrimaryLocation W19681666171 @default.
• W1968166617 hasRelatedWork W1967664125 @default.
• W1968166617 hasRelatedWork W2012986564 @default.
• W1968166617 hasRelatedWork W2033566079 @default.

• next