FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1968222382> ?p ?o ?g. }

• W1968222382 endingPage "27825" @default.
• W1968222382 startingPage "27815" @default.
• W1968222382 abstract "The metabolism of vitamin A is a highly regulated process that generates essential mediators involved in the development, cellular differentiation, immunity, and vision of vertebrates. Retinol saturase converts all-trans-retinol to all-trans-13,14-dihydroretinol (Moise, A. R., Kuksa, V., Imanishi, Y., and Palczewski, K. (2004) J. Biol. Chem. 279, 50230–50242). Here we demonstrate that the enzymes involved in oxidation of retinol to retinoic acid and then to oxidized retinoic acid metabolites are also involved in the synthesis and oxidation of all-trans-13,14-dihydroretinoic acid. All-trans-13,14-dihydroretinoic acid can activate retinoic acid receptor/retinoid X receptor heterodimers but not retinoid X receptor homodimers in reporter cell assays. All-trans-13,14-dihydroretinoic acid was detected in vivo in Lrat-/- mice supplemented with retinyl palmitate. Thus, all-trans-13,14-dihydroretinoic acid is a naturally occurring retinoid and a potential ligand for nuclear receptors. This new metabolite can also be an intermediate in a retinol degradation pathway or it can serve as a precursor for the synthesis of bioactive 13,14-dihydroretinoid metabolites. The metabolism of vitamin A is a highly regulated process that generates essential mediators involved in the development, cellular differentiation, immunity, and vision of vertebrates. Retinol saturase converts all-trans-retinol to all-trans-13,14-dihydroretinol (Moise, A. R., Kuksa, V., Imanishi, Y., and Palczewski, K. (2004) J. Biol. Chem. 279, 50230–50242). Here we demonstrate that the enzymes involved in oxidation of retinol to retinoic acid and then to oxidized retinoic acid metabolites are also involved in the synthesis and oxidation of all-trans-13,14-dihydroretinoic acid. All-trans-13,14-dihydroretinoic acid can activate retinoic acid receptor/retinoid X receptor heterodimers but not retinoid X receptor homodimers in reporter cell assays. All-trans-13,14-dihydroretinoic acid was detected in vivo in Lrat-/- mice supplemented with retinyl palmitate. Thus, all-trans-13,14-dihydroretinoic acid is a naturally occurring retinoid and a potential ligand for nuclear receptors. This new metabolite can also be an intermediate in a retinol degradation pathway or it can serve as a precursor for the synthesis of bioactive 13,14-dihydroretinoid metabolites. Metabolites of vitamin A (all-trans-retinol, all-trans-ROL) 1The abbreviations used are: ROL, retinol; ROL palmitate, retinyl palmitate; ADH, medium-chain alcohol dehydrogenases; 9-cis-DRA, 9-cis-13,14-dihydroretinoic acid; C19-ROL, (3E,5E,7E)-2,6-dimethyl-8-(2,6,6-trimethylcyclohex-1-enyl)octa-3,5,7-trien-1-ol; DRAL, 13,14-dihydroretinaldehyde; DROL, 13,14-dihydroretinol; LRAT, lecithin:retinol acyltransferase; RA, retinoic acid; RAL, retinaldehyde; RALDH, RAL dehydrogenase; RAR, retinoic acid receptor; RetSat, all-trans-ROL:all-trans-DROL saturase; RXR, retinoid X receptor; SDR, short-chain dehydrogenase/reductase; RARE, RAR element; RXRE, RXR element; CMV, cytomegalovirus; HPLC, high pressure liquid chromatography; MGC, Mammalian Gene Collection; DR, direct repeats; X-gal, 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside. play essential roles in vision, immunity, cellular differentiation, control of gene expression, and development in vertebrates. For example, 11-cis-retinaldehyde (11-cis-RAL) is the chromophore of visual pigments in the photoreceptor cells (1Wald G. Science. 1968; 162: 230-239Crossref PubMed Scopus (799) Google Scholar), whereas all-trans-retinoic acid (all-trans-RA) and its 9-cis isomer are important regulators of gene expression via retinoic acid receptors (RAR) and retinoid X receptors (RXR) (2Chambon P. FASEB J. 1996; 10: 940-954Crossref PubMed Scopus (2604) Google Scholar). Other active metabolites of ROL include 14-hydroxy-4,14-retro-ROL (3Buck J. Derguini F. Levi E. Nakanishi K. Hammerling U. Science. 1991; 254: 1654-1656Crossref PubMed Scopus (171) Google Scholar), anhydroretinol (4Buck J. Grun F. Derguini F. Chen Y. Kimura S. Noy N. Hammerling U. J. Exp. Med. 1993; 178: 675-680Crossref PubMed Scopus (89) Google Scholar), and 13,14-dihydroxy-ROL (5Derguini F. Nakanishi K. Hammerling U. Chua R. Eppinger T. Levi E. Buck J. J. Biol. Chem. 1995; 270: 18875-18880Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar), which regulate growth and cellular survival. The ring-oxidized metabolites 4-oxo-ROL, 4-oxo-RAL, and 4-oxo-RA can activate RAR and RXR receptors and have been implicated in the embryonic development of Xenopus (6Achkar C.C. Derguini F. Blumberg B. Langston A. Levin A.A. Speck J. Evans R.M. Bolado Jr., J. Nakanishi K. Buck J. Gudas L.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4879-4884Crossref PubMed Scopus (98) Google Scholar, 7Blumberg B. Bolado Jr., J. Derguini F. Craig A.G. Moreno T.A. Chakravarti D. Heyman R.A. Buck J. Evans R.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4873-4878Crossref PubMed Scopus (100) Google Scholar, 8Pijnappel W.W. Folkers G.E. de Jonge W.J. Verdegem P.J. de Laat S.W. Lugtenburg J. Hendriks H.F. van der Saag P.T. Durston A.J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 15424-15429Crossref PubMed Scopus (25) Google Scholar). Bioactive retinoids continue to be discovered; however, many of the enzymes involved in retinoid metabolism have not been identified. The oxidation of ROL is both a major metabolic pathway for the synthesis of RAL and RA and a catabolic pathway for the clearance of pharmacological doses of ROL by conversion to polar metabolites that are easier to secrete (9Molotkov A. Deltour L. Foglio M.H. Cuenca A.E. Duester G. J. Biol. Chem. 2002; 277: 13804-13811Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). The enzymes involved in the synthesis and degradation of RA have been extensively described. ROL and RAL can be interconverted by microsomal short-chain dehydrogenase/reductase (SDR) (10Duester G. Eur. J. Biochem. 2000; 267: 4315-4324Crossref PubMed Scopus (495) Google Scholar, 11Haeseleer F. Jang G.F. Imanishi Y. Driessen C.A. Matsumura M. Nelson P.S. Palczewski K. J. Biol. Chem. 2002; 277: 45537-45546Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar) and by class I, III, and IV medium-chain alcohol dehydrogenases (ADH) (12Duester G. Mic F.A. Molotkov A. Chem. Biol. Interact. 2003; 143: 201-210Crossref PubMed Scopus (190) Google Scholar). Irreversible oxidation of RAL to RA is carried out by retinal dehydrogenase (RALDH) types 1–4 (13Bhat P.V. Labrecque J. Boutin J.M. Lacroix A. Yoshida A. Gene (Amst.). 1995; 166: 303-306Crossref PubMed Scopus (67) Google Scholar, 14Penzes P. Wang X. Sperkova Z. Napoli J.L. Gene (Amst.). 1997; 191: 167-172Crossref PubMed Scopus (47) Google Scholar, 15Wang X. Penzes P. Napoli J.L. J. Biol. Chem. 1996; 271: 16288-16293Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 16Zhao D. McCaffery P. Ivins K.J. Neve R.L. Hogan P. Chin W.W. Drager U.C. Eur. J. Biochem. 1996; 240: 15-22Crossref PubMed Scopus (256) Google Scholar, 17Mic F.A. Molotkov A. Fan X. Cuenca A.E. Duester G. Mech. Dev. 2000; 97: 227-230Crossref PubMed Scopus (135) Google Scholar, 18Lin M. Zhang M. Abraham M. Smith S.M. Napoli J.L. J. Biol. Chem. 2003; 278: 9856-9861Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Cytochrome P450 enzymes CYP26A1, CYP26B1, and CYP26C1 carry out the catabolism of RA to 4-hydroxy-RA, 4-oxo-RA, and 18-hydroxy-RA (19Fujii H. Sato T. Kaneko S. Gotoh O. Fujii-Kuriyama Y. Osawa K. Kato S. Hamada H. EMBO J. 1997; 16: 4163-4173Crossref PubMed Scopus (304) Google Scholar, 20White J.A. Beckett-Jones B. Guo Y.D. Dilworth F.J. Bonasoro J. Jones G. Petkovich M. J. Biol. Chem. 1997; 272: 18538-18541Abstract Full Text Full Text PDF PubMed Scopus (337) Google Scholar, 21White J.A. Ramshaw H. Taimi M. Stangle W. Zhang A. Everingham S. Creighton S. Tam S.P. Jones G. Petkovich M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6403-6408Crossref PubMed Scopus (204) Google Scholar, 22Taimi M. Helvig C. Wisniewski J. Ramshaw H. White J. Amad M. Korczak B. Petkovich M. J. Biol. Chem. 2004; 279: 77-85Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar). We recently described a novel enzyme that carries out the saturation of the C13–14 bond of all-trans-ROL to generate all-trans-13,14-dihydro-ROL (all-trans-DROL) (23Moise A.R. Kuksa V. Imanishi Y. Palczewski K. J. Biol. Chem. 2004; 279: 50230-50242Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). The enzyme, ROL saturase (RetSat), is found in many tissues, with the highest levels in the liver, kidney, and intestine. RetSat was shown to convert all-trans-ROL to all-trans-DROL, which was detected in several tissues of unsupplemented animals (23Moise A.R. Kuksa V. Imanishi Y. Palczewski K. J. Biol. Chem. 2004; 279: 50230-50242Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). Shirley et al. (24Shirley M.A. Bennani Y.L. Boehm M.F. Breau A.P. Pathirana C. Ulm E.H. Drug Metab. Dispos. 1996; 24: 293-302PubMed Google Scholar) have described the conversion of 9-cis-RA to 9-cis-13,14-dihydro-RA (9-cis-DRA) in rats, and others have described 9-cis-4-oxo-13,14-dihydroretinoic acid as a major metabolite in the liver of mice supplemented with ROL palmitate (25Schmidt C.K. Brouwer A. Nau H. Anal. Biochem. 2003; 315: 36-48Crossref PubMed Scopus (109) Google Scholar). The metabolic pathway responsible for the production of 13,14-dihydroretinoids has not been investigated. In the current study, we used lecithin:ROL acyltransferase (LRAT)-deficient mice to examine the metabolism of ROL palmitate, all-trans-RA, and all-trans-DROL in vivo, with special attention to the formation of C13–14-saturated retinoids. The pathway was reconstituted in vitro using recombinant enzymes and cells transfected with individual retinoid processing enzymes. Finally, we demonstrated that all-trans-DRA can activate transcription in reporter cell assays through RAR/RXR heterodimers but not RXR homodimers. Metabolism of Retinoids in Vivo—All animal experiments employed procedures approved by the University of Washington and conformed to recommendations of the American Veterinary Medical Association Panel on Euthanasia and recommendations of the Association of Research for Vision and Ophthalmology. Animals were maintained on a 12-h light and 12-h dark cycle. All manipulations were done under dim red or infrared light (>560 nm). Most experiments used 6–12-week-old mice. Lrat-/- mice were genotyped as described previously (26Batten M.L. Imanishi Y. Maeda T. Tu D.C. Moise A.R. Bronson D. Possin D. Van Gelder R.N. Baehr W. Palczewski K. J. Biol. Chem. 2004; 279: 10422-10432Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar). Animals were maintained on a control chow diet up to 1 h prior to oral gavage. The appropriate amount of all-trans-ROL palmitate, all-trans-DROL, or all-trans-RA was dissolved in vegetable oil and administered by oral gavage 3 h prior to analysis. Analysis of Retinoids—Liver (1 g) from retinoid gavaged or naive mice was homogenized in 2 ml of 137 mm NaCl, 2.7 mm KCl, and 10 mm sodium phosphate (pH 7.4) for 30 s using a Polytron homogenizer. 10 μl of 5 m NaOH was added to 3 ml of the ethanolic extract, and the nonpolar retinoids were extracted using 5 ml of hexane. The extraction was repeated, and the organic phases were combined, dried under vacuum, resuspended in hexane, and examined by normal phase HPLC using a normal phase column (Beckman Ultrasphere Si 5μ, 4.6 × 250 mm). The elution condition was an isocratic solvent system of 10% ethyl acetate in hexane (v/v) for 25 min at a flow rate of 1.4 ml/min at 20 °C with detection at 325 and 290 nm for the detection of nonpolar retinoids and 13,14-dihydroretinoids, respectively. The aqueous phase was acidified with 40 μl of 12 n HCl, and polar retinoids were extracted with 5 ml of hexane. The extraction was repeated, and the organic phases of the polar retinoid extractions were combined, dried, resuspended in solvent composed of 80% CH3CN, 10 mm ammonium acetate, 1% acetic acid, and examined by reverse phase HPLC. Analysis of polar retinoids from tissues was done by reverse phase HPLC using a narrowbore, 120-Å, 5-μm, 2.1 × 250 mm, Denali C18 column (Grace-Vydac, Hesperia, CA). The solvent system was composed of buffer A, 80% methanol, 20% 36 mm ammonium acetate (pH 4.7 adjusted with acetic acid), and buffer B, 100% methanol. The HPLC elution conditions were 0.3 ml/min, 100% buffer A for 40 min, 100% buffer B for 10 min, and 10 min equilibration in buffer A. The elution profiles of RA and DRA were monitored using an online diode array detector set at 350 and 290 nm, respectively. The peaks were identified based on their UV-visible spectra and/or coelution with synthetic or commercially available standards. The measured area of absorbance was converted to picomoles based on a calibration of the HPLC columns using a known amount of all-trans-RA or all-trans-ROL (Sigma) and all-trans-DROL or all-trans-DRA (synthetic standards). The extraction efficiency was monitored by spiking a tissue sample with [3H]RA (PerkinElmer Life Sciences) and monitoring the radioactivity recovered from the HPLC column. In the case of liver samples the extraction efficiency was 95% or better. Mass spectrometry analyses of synthesized retinoids and of natural retinoids purified by HPLC were performed using a Kratos profile HV-3 direct probe mass spectrometer. Synthesis and Analysis of 13,14-Dihydroretinoids—The synthetic scheme is depicted in supplemental Fig. 7. β-Ionone (I) was first brominated with N-bromosuccinimide in CCl4 followed by substitution of bromine with an acetoxyl group in hexamethylphosphoramide. The acetate ester of ionone was hydrolyzed with K2CO3 in methanol:water, and then the hydroxyl group was protected with tetra-butyldimethylsilyl group. The silylated 4-hydroxy-β-ionone (II) was then condensed under Horner-Emmons conditions with triethylphosphonoacetate, and the ester of silyl-protected ethyl 4-hydroxy-β-ionylidene acetate was reduced to alcohol with LiAlH4. The alcohol was acetylated with acetic anhydride in the presence of N,N-dimethylaminopyridine (DMAP); the silyl group was removed by tetrabutylammonium fluoride, and the alcohol was oxidized to a ketone group with MnO2 to give 15-acetoxy-4-oxo-β-ionylidene ethanol (III). Next, ester (III) was hydrolyzed, and the hydroxyl group was brominated with PBr3 in ether. The bromide was reacted with PPh3 to give Wittig salt (IV), which was further condensed with ethyl 4-oxo-3-methylbutyrate under conditions described previously (23Moise A.R. Kuksa V. Imanishi Y. Palczewski K. J. Biol. Chem. 2004; 279: 50230-50242Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar) to obtain a mixture of ethyl 13,14-dihydro-4-oxoretinoate isomers (V) with all-trans- as a major compound. The isomers were separated by normal phase HPLC (HP1100, Beckman Ultrasphere Si 5μ, 10 × 250 mm, 5% ethyl acetate:hexane, and detection at 325 nm) and characterized by their UV, mass, and NMR spectra. NMR data were recorded on a Bruker 500-MHz spectrometer using CDCl3 as an internal standard, and their chemical shift values are listed in supplemental Table II. The order of elution was as follows: 9,11-di-cis-, all-trans-, 9-cis, 11-cis-13,14-dihydro-4-oxoretinoate. To obtain free retinoic acid (VI), the ethyl ester was hydrolyzed with NaOH in ethanol:H2O. To obtain 13,14-dihydro-RAL (DRAL), previously prepared ethyl 13,14-dihydroretinoate was reduced with diisobutyl aluminum hydride at -78 °C. All-trans-4-oxo-DRA has the following UV-visible absorbance spectrum in ethanol, λmax = 328 nm and shoulder at λ = 256 nm, and in hexane, λmax = 314 nm and shoulder at λ = 252 nm. Cloning and Expression Constructs—Total embryo and liver RNA was obtained from Ambion (Austin, TX) and reverse-transcribed using SuperScript II reverse transcriptase (Invitrogen) and oligo(dT) primers according to manufacturer's protocol. Embryo cDNA was used to amplify the cDNAs of specific genes using Hotstart Turbo Pfu polymerase (Stratagene, La Jolla, CA) and the following primers: RALDH1, forward 5′-CACCGCAATGTCTTCGCCTGCACAAC and reverse 5′-GCTGGCTTCTTTAGGAGTTCTTC; RALDH3 forward CACCTGCGAACCAGTTATGGCTACC and reverse 5′-GCCTGTTCCTCAGGGGTTCTT; CYP26B1, forward 5′-CACCAAGCGGCTGCCAACATGC and reverse 5′-GCTGAGACCAGAGTGAGGCTA; and CYP26C1 forward 5′-CACCCATTCTCGCCATGATTTCCT and reverse 5′-CCAAGGCTAGAGAAGCAACG. The full-length cDNA of RALDH2 (MGC:76772, IMAGE: 30471325), RALDH4 (MGC:46977, IMAGE:4223059), and CYP26A1 (MGC:13860, IMAGE:4210893) mRNA was obtained from the Mammalian Gene Collection (MGC). These clones were used as templates to amplify the respective cDNAs using Hotstart Turbo Pfu polymerase (Stratagene) and the following primers: RALDH2, forward 5′-CACCATGGCCTCGCTGCAGCTCCTGC and reverse 5′-GGAGTTCTTCTGGGGGATCTTCA; RALDH4, forward 5′-CACCTGTACACAGAGGGCACTTTCC and reverse 5′-GTATTTAATGGTAATGGTTTTTATTTCAGTAAAG; and CYP26A1, forward 5′-CACCATGGGGCTCCCGGCGCTGCT and 5′-GATATCTCCCTGGAAGTGGGTAAAT. The cDNAs for RALDH1, -2, -3, and -4 and CYP26A1, -B1, and -C1 were cloned in the pcDNA3.1 Directional TOPO vector under the control of the CMV promoter to express a recombinant protein fused with a C-terminal V5 epitope peptide (GKPIPNPLLGLDST) and a His6 tag (Invitrogen). Both strands of the expression constructs were sequenced to ensure no mutations were present. Mouse RXR-α was cloned using the primers 5′-GGGCATGAGTTAGTCGCAGA and 5′-AGCTGAGCAGCTGTGTCCA from reverse-transcribed mouse liver cDNA. The RXR-α open reading frame was then subcloned into the pcDNA3.1 Directional TOPO vector (Invitrogen) using the primers 5′-CACCATGGACACCAAACATTTCCT and 5′-AGCTGAGCAGCTGTGTCCA under the control of the CMV promoter. The RXRE from the vector RXR (2Chambon P. FASEB J. 1996; 10: 940-954Crossref PubMed Scopus (2604) Google Scholar) translucent reporter vector (Panomics, Redwood City, CA) was amplified using the primers 5′-CTCAACCCTATCTCGGTCTATTCT and 5′-ATGCCAGCTTCATTATATACCCA and cloned upstream of the minimal promoter and β-galactosidase open reading frame of pBLUE-TOPO (Invitrogen) to create the pRXRE-BLUE expression construct. This construct places five consecutive DR1 elements upstream of β-galactosidase, the expression of which becomes dependent on activation of RXR and formation of RXR homodimers. Both strands of all constructs were sequenced to ensure no mutations were present. Oxidation of All-trans-ROL and All-trans-DROL Using Liver Alcohol Dehydrogenase—Equine liver ADH (EC 1.1.1.1) was obtained from Sigma and dissolved in 50 mm Tris (pH 8.8) to a concentration of 5 units/ml (8.6 mg/ml). NAD and NADP were mixed together (1:1) at a concentration of 10 mm each. A substrate solution, 2 μl of 2 mm stock of all-trans-ROL or all-trans-DROL in N,N-dimethylformamide, was added to a 1.5-ml Eppendorf tube containing 20 μl of 10% bovine serum albumin, 20 μl of ADH, 2 μl of cofactor mixture, and 50 mm Tris (pH 8.8) to a total volume of 200 μl. The solutions were incubated at 37 °C for 60 min, after which 50 μl of 0.8 m NH2OH solution (pH 7.0) was added, followed by addition of 300 μl of methanol, 15 min at room temperature, and extraction with 300 μl of hexane. The organic phase was dried and analyzed by normal phase HPLC as described in the analysis of nonpolar retinoids extracted from tissue samples. As a control for the nonenzymatic reaction, boiled protein (90 °C for 5 min) was used with or without addition of cofactors. RALDH Oxidation Assay—N-Acetylglucosaminyltransferase I-negative HEK-293S cells, obtained from Dr. G. Khorana (Massachusetts Institute of Technology, Boston) (27Reeves P.J. Callewaert N. Contreras R. Khorana H.G. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 13419-13424Crossref PubMed Scopus (512) Google Scholar) were cultured in Dulbecco's modified Eagle's medium, 10% fetal calf serum and maintained at 37 °C, 5% CO2, and 100% humidity. For RALDH enzyme assays, cells were transiently transfected with RALDH1, -2, -3, or -4 expression constructs using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. After 48 h post-transfection, the cells were collected by scraping and were centrifuged. The cell pellet was washed in 137 mm NaCl, 2.7 mm KCl, and 10 mm phosphate (pH 7.4), resuspended in 50 mm Tris (pH 8.0) containing 250 mm sucrose, and homogenized with the aid of a Dounce homogenizer. Cofactors were added to a final concentration of 5 mm NAD, 5 mm NADP, and 1 mm ATP. An aliquot of the cell lysate was boiled for 10 min at 95 °C to provide the control for the nonenzymatic reaction. Substrates in the form of all-trans-RAL or a mixture of isomers of DRAL were added to the cell lysates at a final concentration of 60 μm. The reactions were allowed to proceed for 2 h at 37 °C with shaking and were stopped by the addition of 2 volumes of CH3CN. Samples were treated for 30 min at room temperature with 100 mm NH2OH (final concentration from a freshly made stock of 1 m (pH 7.0)) followed by centrifugation at 12,000 × g for 10 min. The clear supernatant was acidified with 0.1 volume of 0.5 m ammonium acetate (pH 4.0) and examined by reverse phase HPLC system (Zorbax ODS, 5 μm, 4.6 × 250 mm; Agilent, Foster City, CA) with an isocratic mobile phase A of 80% CH3CN, 10 mm ammonium acetate, 1% acetic acid, and a flow rate of 1.6 ml/min held for 15 min. After each run, the column was washed with mixture B (60% tert-butylmethyl ether, 40% methanol) for 10 min at 1.6 ml/min, followed by re-equilibration in phase A. The elution of RA and DRA isomers was monitored at 340 and 290 nm, respectively. The peaks were identified based on their spectra and coelution with standards. The cell lysate was examined for expression of RALDH1–4 by SDS-PAGE and immunoblotting of the V5 epitope-tagged recombinant protein using an anti-V5 epitope monoclonal antibody (Invitrogen). CYP26A1 Oxidation Assay—N-Acetylglucosaminyltransferase I-negative HEK-293S cells were transiently transfected with cDNAs of CYP26A1, -B1, and -C1 under the control of CMV promoter using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. After 24 h, the transfected cells were split into 12-well plates to ensure an equal number of transfected cells in each assay well. All-trans-RA or all-trans-DRA was added to the cell monolayer at 0.1 mm final concentration in complete media and incubated for 4 h. Media and cells were collected by scraping, and proteins were precipitated with an equal amount of CH3CN by vigorous vortexing followed by centrifugation at 12,000 × g for 10 min. For RA analysis the clear supernatant was acidified with 0.1 volume of 0.5 m ammonium acetate (pH 4.0) and examined by reverse phase HPLC as described for the RALDH assays. The elution of all-trans-RA, all-trans-DRA, and their oxidized metabolites was monitored at 340 and 290 nm. The peaks were identified based on their spectra and coelution with standards. The cell lysate was examined for expression of CYP26A1, -B1, and -C1 by SDS-PAGE and immunoblotting of the V5 epitope-tagged recombinant protein using an anti-V5 epitope monoclonal antibody (Invitrogen). Conversion of DROL to DRA in RPE—UV-treated RPE microsomes were prepared as described previously (28Stecher H. Gelb M.H. Saari J.C. Palczewski K. J. Biol. Chem. 1999; 274: 8577-8585Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar). Twenty μl of UV-treated RPE microsomes (3 mg/ml) were mixed with 20 μm DROL or ROL substrates, 1% bovine serum albumin, and 50 mm Tris (pH 8.8) and were incubated at 37 °C for 60 min in the presence or absence of NAD NADP cofactor mixture at 50 μm each. In order to stop the reaction, proteins were precipitated by mixing with an equal volume of CH3CN followed by high speed centrifugation. The clear supernatant was acidified with 0.1 volume of 0.5 m ammonium acetate (pH 4.0) and examined by reverse phase HPLC as described for the RALDH assays. A boiled RPE membrane control was used to assay nonenzymatic conversion of DROL. The elution of all-trans-DROL metabolites was monitored at 290 nm. RARE and RXRE Activation Assay—The RARE reporter cell line F9-RARE-lacZ (SIL15-RA) was a kind gift from Dr. Michael Wagner (State University of New York Downstate Medical Center) and Dr. Peter McCaffery (University of Massachusetts Medical School, E. K. Shriver Center). The RA-responsive F9 cell line was transfected with a reporter construct of an RARE derived from the human retinoic acid receptor-β gene (RARβ) placed upstream of the Escherichia coli lacZ gene (29Wagner M. Han B. Jessell T.M. Development (Camb.). 1992; 116: 55-66Crossref PubMed Google Scholar). Cells were grown in L15-CO2 media containing N-3 supplements and antibiotics. Cells were stimulated for 24 h in the dark at 37 °C and 100% humidity with all-trans-RA or all-trans-DRA dissolved in ethanol at the indicated concentrations, lysed, and assayed for the expression of β-galactosidase using the β-galactosidase enzyme assay system (Promega, Madison WI). For RXRE activation assays N-acetylglucosaminyltransferase I-negative HEK-293S cells were transfected with the pRXRE-BLUE reporter construct with or without the RXRα-expression construct using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. After 24 h, cells were split into 24-well plates to ensure an equal number of transfected cells in each assay well. Cells were stimulated with appropriate concentrations of all-trans-RA, 9-cis-RA, or all-trans-DRA. After 48 h, the expression of β-galactosidase was assayed as described above. Identification of All-trans-DROL and Its Metabolites in the Liver of Lrat-/- Mice Gavaged with All-trans-ROL Palmitate—ROL absorption in mammals is an active process driven by esterification and hydrolysis cycles. Esterification of ROL is carried out mainly by the LRAT enzyme (30Ruiz A. Winston A. Lim Y.H. Gilbert B.A. Rando R.R. Bok D. J. Biol. Chem. 1999; 274: 3834-3841Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar). In the absence of LRAT, the equilibrium between ROL and ROL esters is shifted in favor of free ROL. Mice deficient in LRAT expression (Lrat-/-) mice are severely impaired in their ROL uptake and storage capacity (26Batten M.L. Imanishi Y. Maeda T. Tu D.C. Moise A.R. Bronson D. Possin D. Van Gelder R.N. Baehr W. Palczewski K. J. Biol. Chem. 2004; 279: 10422-10432Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar). Wild type mice, on the other hand, convert most of the ingested ROL to esters, which sequester ROL from circulation and metabolism. Thus, we chose to study the saturation and oxidation of all-trans-ROL to 13,14-dihydroretinoid metabolites in Lrat-/- mice. Given their similar chemical properties, it is not surprising that all-trans-DROL and all-trans-ROL follow parallel metabolic pathways. Two different groups of Lrat-/- mice were dosed with either 106 units of all-trans-ROL palmitate/kg body weight or 105 units of all-trans-ROL palmitate/kg body weight, and their livers were examined for polar and nonpolar retinoid metabolites at 3 h post-gavage. Reverse phase HPLC analysis of polar hepatic retinoids indicated the presence of all-trans-RA (Fig. 1, A and B, peak 5) and all-trans-DRA (Fig. 1, A and B, peak 4), as well as a cis-DRA isomer (Fig. 1, A and B, peak 2). We also observed another polar DROL metabolite, which eluted earlier than all-trans-DRA, on reverse phase HPLC (Fig. 1, A and B, peak 1) and had the same absorbance spectrum as all-trans-DRA standard (Fig. 1E). This metabolite was not chemically characterized; however, based on its polar character, it could represent a taurine or glucuronide DRA conjugate. The spectra and elution profiles of synthetic all-trans-DRA and all-trans-DRA isolated from liver matched (Fig. 1E). All-trans-DRA was synthesized according to procedures published previously (23Moise A.R. Kuksa V. Imanishi Y. Palczewski K. J. Biol. Chem. 2004; 279: 50230-50242Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar) and was characterized by 1H NMR (supplemental Table II). We examined the nonpolar hepatic retinoid metabolites by normal phase HPLC. At 3 h post-gavage with ROL palmitate, the livers of the examined mice contained high levels of all-trans-ROL (Fig. 1, C and D, peak 11), whereas all-trans-DROL (Fig. 1, C and D, peak 8) was found at 280–330-fold lower levels (Table I). The absorbance spectra and elution profile of all-trans-DROL matched the synthetic standard prepared according to published procedures (23Moise A.R. Kuksa V. Imanishi Y. Palczewski K. J. Biol. Chem. 2004; 279: 50230-50242Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar) and characterized by 1H NMR (Fig. 1, C, D, and G, and supplemental Table II).Table ILevel of liver retinoids 3 h following gavage with ROL palmitate The analysis was carried out as described under “Materials and Methods.”Compound identified106 IU/kg body weight-dose level of all-trans-ROL palmitate105 IU/kg body weight-dose level of all-trans-ROL palmitatepmol/g tissueAll-trans-RA9,400 ± 300320 ± 240All-trans-DRA190 ± 1710 ± 2cis-DRA180 ± 5322 ± 4Fig. 1, A and B, peak 1460 ± 5037 ± 9All-trans-ROL28,000 ± 3007,000 ± 1,200All-trans-DROL100 ± 1821 ± 4Fig. 1, C and D, peak 61,800 ± 370200 ± 8 Open table in a new tab Another nonpolar 13,14-dihydroretinoid metabolite (Fig. 1, C and D, peak 6) that was present at higher levels than DROL was identified in the liver of mice gavaged with all-trans-ROL palmitate. The spectra of this compound also matched that of all-trans-DROL (Fig. 1G). The compound does not coelute with cis-DROL isomers and has a different UV-visible absorbance maximum than cis-DROL isomers (not shown). We were able to esterify the compound, whereas NH2OH treatment had no effect on its elution profile (not shown). Thus, we c" @default.
• W1968222382 created "2016-06-24" @default.
• W1968222382 creator A5044954870 @default.
• W1968222382 creator A5045657649 @default.
• W1968222382 creator A5059469814 @default.
• W1968222382 creator A5063424342 @default.
• W1968222382 creator A5069241630 @default.
• W1968222382 date "2005-07-01" @default.
• W1968222382 modified "2023-10-12" @default.
• W1968222382 title "Metabolism and Transactivation Activity of 13,14-Dihydroretinoic Acid" @default.
• W1968222382 cites W1495595158 @default.
• W1968222382 cites W1573546761 @default.
• W1968222382 cites W1748464360 @default.
• W1968222382 cites W1927684145 @default.
• W1968222382 cites W1977568863 @default.
• W1968222382 cites W1977623509 @default.
• W1968222382 cites W1983077273 @default.
• W1968222382 cites W1987269203 @default.
• W1968222382 cites W1988041938 @default.
• W1968222382 cites W1988722953 @default.
• W1968222382 cites W1990895444 @default.
• W1968222382 cites W1991848239 @default.
• W1968222382 cites W2002529271 @default.
• W1968222382 cites W2003366894 @default.
• W1968222382 cites W2003877984 @default.
• W1968222382 cites W2004778844 @default.
• W1968222382 cites W2008917724 @default.
• W1968222382 cites W2016237688 @default.
• W1968222382 cites W2016392505 @default.
• W1968222382 cites W2019631619 @default.
• W1968222382 cites W2021906644 @default.
• W1968222382 cites W2034927169 @default.
• W1968222382 cites W2035246287 @default.
• W1968222382 cites W2041270901 @default.
• W1968222382 cites W2041710680 @default.
• W1968222382 cites W2047508855 @default.
• W1968222382 cites W2050724322 @default.
• W1968222382 cites W2052745304 @default.
• W1968222382 cites W2062278718 @default.
• W1968222382 cites W2067884021 @default.
• W1968222382 cites W2073020869 @default.
• W1968222382 cites W2074038170 @default.
• W1968222382 cites W2076045216 @default.
• W1968222382 cites W2078808189 @default.
• W1968222382 cites W2084305450 @default.
• W1968222382 cites W2084893672 @default.
• W1968222382 cites W2085511966 @default.
• W1968222382 cites W2089379875 @default.
• W1968222382 cites W2089785158 @default.
• W1968222382 cites W2093814700 @default.
• W1968222382 cites W2094063119 @default.
• W1968222382 cites W2122581088 @default.
• W1968222382 cites W2125161058 @default.
• W1968222382 cites W2138860259 @default.
• W1968222382 cites W2141234587 @default.
• W1968222382 cites W2151164511 @default.
• W1968222382 cites W2164648160 @default.
• W1968222382 cites W2165108884 @default.
• W1968222382 cites W2167269900 @default.
• W1968222382 cites W2415619454 @default.
• W1968222382 doi "https://doi.org/10.1074/jbc.m503520200" @default.
• W1968222382 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1352314" @default.
• W1968222382 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15911617" @default.
• W1968222382 hasPublicationYear "2005" @default.
• W1968222382 type Work @default.
• W1968222382 sameAs 1968222382 @default.
• W1968222382 citedByCount "52" @default.
• W1968222382 countsByYear W19682223822012 @default.
• W1968222382 countsByYear W19682223822013 @default.
• W1968222382 countsByYear W19682223822014 @default.
• W1968222382 countsByYear W19682223822015 @default.
• W1968222382 countsByYear W19682223822016 @default.
• W1968222382 countsByYear W19682223822017 @default.
• W1968222382 countsByYear W19682223822018 @default.
• W1968222382 countsByYear W19682223822019 @default.
• W1968222382 countsByYear W19682223822020 @default.
• W1968222382 countsByYear W19682223822021 @default.
• W1968222382 countsByYear W19682223822022 @default.
• W1968222382 countsByYear W19682223822023 @default.
• W1968222382 crossrefType "journal-article" @default.
• W1968222382 hasAuthorship W1968222382A5044954870 @default.
• W1968222382 hasAuthorship W1968222382A5045657649 @default.
• W1968222382 hasAuthorship W1968222382A5059469814 @default.
• W1968222382 hasAuthorship W1968222382A5063424342 @default.
• W1968222382 hasAuthorship W1968222382A5069241630 @default.
• W1968222382 hasBestOaLocation W19682223821 @default.
• W1968222382 hasConcept C104317684 @default.
• W1968222382 hasConcept C1292079 @default.
• W1968222382 hasConcept C185592680 @default.
• W1968222382 hasConcept C55493867 @default.
• W1968222382 hasConcept C62231903 @default.
• W1968222382 hasConcept C86339819 @default.
• W1968222382 hasConceptScore W1968222382C104317684 @default.
• W1968222382 hasConceptScore W1968222382C1292079 @default.
• W1968222382 hasConceptScore W1968222382C185592680 @default.
• W1968222382 hasConceptScore W1968222382C55493867 @default.
• W1968222382 hasConceptScore W1968222382C62231903 @default.
• W1968222382 hasConceptScore W1968222382C86339819 @default.

• next