FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1968650445> ?p ?o ?g. }

• W1968650445 endingPage "19648" @default.
• W1968650445 startingPage "19641" @default.
• W1968650445 abstract "Naturally occurring variants of the enzyme chorismate mutase are known to exist that exhibit diversity in enzyme structure, regulatory properties, and association with other proteins. Chorismate mutase was not annotated in the initial genome sequence of Mycobacterium tuberculosis (Mtb) because of low sequence similarity between known chorismate mutases. Recombinant protein coded by open reading frame Rv1885c of Mtb exhibited chorismate mutase activity in vitro. Biochemical and biophysical characterization of the recombinant protein suggests its resemblance to the AroQ class of chorismate mutases, prototype examples of which include the Escherichia coli and yeast chorismate mutases. We also demonstrate that unlike the corresponding proteins of E. coli, Mtb chorismate mutase does not have any associated prephenate dehydratase or dehydrogenase activity, indicating its monofunctional nature. The Rv1885c-encoded chorismate mutase showed allosteric regulation by pathway-specific as well as cross-pathway-specific ligands, as evident from proteolytic cleavage protection and enzyme assays. The predicted N-terminal signal sequence of Mtb chorismate mutase was capable of functioning as one in E. coli, suggesting that Mtb chorismate mutase belongs to the AroQ class of chorismate mutases. It was evident that Rv1885c may not be the only enzyme with chorismate mutase enzyme function within Mtb, based on our observation of the presence of chorismate mutase activity displayed by another hypothetical protein coded by open reading frame Rv0948c, a novel instance of the existence of two monofunctional chorismate mutases ever reported in any pathogenic bacterium. Naturally occurring variants of the enzyme chorismate mutase are known to exist that exhibit diversity in enzyme structure, regulatory properties, and association with other proteins. Chorismate mutase was not annotated in the initial genome sequence of Mycobacterium tuberculosis (Mtb) because of low sequence similarity between known chorismate mutases. Recombinant protein coded by open reading frame Rv1885c of Mtb exhibited chorismate mutase activity in vitro. Biochemical and biophysical characterization of the recombinant protein suggests its resemblance to the AroQ class of chorismate mutases, prototype examples of which include the Escherichia coli and yeast chorismate mutases. We also demonstrate that unlike the corresponding proteins of E. coli, Mtb chorismate mutase does not have any associated prephenate dehydratase or dehydrogenase activity, indicating its monofunctional nature. The Rv1885c-encoded chorismate mutase showed allosteric regulation by pathway-specific as well as cross-pathway-specific ligands, as evident from proteolytic cleavage protection and enzyme assays. The predicted N-terminal signal sequence of Mtb chorismate mutase was capable of functioning as one in E. coli, suggesting that Mtb chorismate mutase belongs to the AroQ class of chorismate mutases. It was evident that Rv1885c may not be the only enzyme with chorismate mutase enzyme function within Mtb, based on our observation of the presence of chorismate mutase activity displayed by another hypothetical protein coded by open reading frame Rv0948c, a novel instance of the existence of two monofunctional chorismate mutases ever reported in any pathogenic bacterium. Mycobacterium tuberculosis (Mtb) 1The abbreviations used are: Mtb, Mycobacterium tuberculosis; ORF, open reading frame; ss, signal sequence; aa, amino acid(s); XP, 5-bromo-4-chloro-3-indolyl phosphate; CPB, citrate phosphate buffer; MES, 4-morpholineethanesulfonic acid; CM, chorismate mutase; rRv1885c, recombinant Rv1885c; rRv0948c, recombinant Rv0948c; PDT, prephenate dehydratase; PDH, prephenate dehydrogenase; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. 1The abbreviations used are: Mtb, Mycobacterium tuberculosis; ORF, open reading frame; ss, signal sequence; aa, amino acid(s); XP, 5-bromo-4-chloro-3-indolyl phosphate; CPB, citrate phosphate buffer; MES, 4-morpholineethanesulfonic acid; CM, chorismate mutase; rRv1885c, recombinant Rv1885c; rRv0948c, recombinant Rv0948c; PDT, prephenate dehydratase; PDH, prephenate dehydrogenase; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. has developed ingenious mechanisms to survive inside the hostile environment presented by the host and to acquire essential nutrients from this adverse environment (1Wayne L.G. Eur. J. Clin. Microbiol. Infect. Dis. 1994; 43: 908-914Crossref Scopus (318) Google Scholar, 2Betts J.C. Lukey P.T. Robb L.C. McAdam R.A. Duncan K. Mol. Microbiol. 2002; 43: 717-731Crossref PubMed Scopus (1111) Google Scholar, 3Chakhaiyar P. Hasnain S.E. Med. Princ. Pract. 2004; 13: 177-184Crossref PubMed Scopus (16) Google Scholar). The emergence of drug-resistant strains and synergy with the AIDS virus has further aggravated the disease scenario (4Daley C.L. Small P.M. Schecter G.F. Schoolnik G.K. McAdam R.A. Jacobs Jr., W.R. Hopewell P.C. N. Engl. J. Med. 1992; 326: 231-235Crossref PubMed Scopus (880) Google Scholar, 5Siddiqi N. Shamim M. Hussain S. Choudhary R.K. Ahmed N. Prachee Banerjee S. Savithri G.R. Alam M. Pathak N. Amin A. Hanief M. Katoch V.M. Sharma S.K. Hasnain S.E. Antimicrob. Agents Chemother. 2002; 46: 443-450Crossref PubMed Scopus (153) Google Scholar, 6Ahmed N. Caviedes L. Alam M. Rao K.R. Sangal V. Sheen P. Gilman R.H. Hasnain S.E. J. Clin. Microbiol. 2003; 41: 1712-1716Crossref PubMed Scopus (27) Google Scholar). For the development of new therapeutic intervention strategies, there is a need for identification of novel targets that are not only unique to Mtb but blocking of which would either prove lethal to the bacterium or render it extremely susceptible to the host immune response. In this context, understanding the mechanism of action of the aromatic amino acid pathway enzymes of Mtb assumes the utmost importance because most of the corresponding genes have been proven essential for the bacterium and have no human or mammalian counterpart (7Parish T. Stoker N.G. Microbiology. 2002; 148: 3069-3077Crossref PubMed Scopus (167) Google Scholar, 8Sassetti C.M. Boyd D.H. Rubin E.J. Mol. Microbiol. 2003; 48: 77-84Crossref PubMed Scopus (1974) Google Scholar). Moreover, amino acid auxotrophs of Mtb do not survive or multiply in macrophages (9Bange F.C. Brown A.M. Jacobs Jr., W.R. Infect. Immun. 1996; 64: 1794-1799Crossref PubMed Google Scholar, 10Gordhan B.G. Smith D.A. Alderton H. McAdam R.A. Bancroft G.J. Mizrahi V. Infect. Immun. 2002; 70: 3080-3084Crossref PubMed Scopus (68) Google Scholar), suggesting that these amino acids are not available within the compartment of the macrophage in which the bacteria reside.Chorismic acid is the last common precursor in the aromatic amino acid biosynthesis pathway and is a substrate for multiple enzymes (11Gibson F. Jackman L.M. Nature. 1963; 198: 388-389Crossref PubMed Scopus (18) Google Scholar, 12Dosselaere F. Vanderleyden J. Crit. Rev. Microbiol. 2001; 27: 75-131Crossref PubMed Scopus (132) Google Scholar). Hence it has always been of interest to explore how a microbe partitions chorismate into diverse metabolic pathways. Various enzymes that utilize chorismate as a substrate include chorismate mutase (CM), anthranilate synthase, isochorismate synthase, and p-amino benzoate synthase (13Haslam E. Shikimic Acid: Metabolism and Metabolites. Wiley, New York1993Google Scholar). Chorismate mutase is a key regulatory enzyme of the shikimate pathway that catalyzes the Claisen rearrangement of chorismate to prephenate (Fig. 1), a committed step in l-Phe and l-Tyr biosynthesis. Besides being a rare example of an enzyme that catalyzes a pericyclic rearrangement reaction, chorismate mutase has also gathered attention due to the presence of completely different protein folds and ligand binding pockets in different organisms. Members of the AroQ class of chorismate mutases are all helix-bundle proteins, whereas members of the AroH class of chorismate mutases possess a trimeric pseudo-α/β-barrel structure (14Helmstaedt K. Krappmann S. Braus G.H. Microbiol. Mol. Biol. Rev. 2001; 65: 404-421Crossref PubMed Scopus (55) Google Scholar). The chorismate mutases of yeast and E. coli belong to the AroQ class of chorismate mutases (15Christendat D. Saridakis V.C. Turnbull J.L. Biochemistry. 1998; 37: 15703-15712Crossref PubMed Scopus (25) Google Scholar, 16.Pohnert, G., Zhang, S., Husain, A., Wilson, D. B., and Ganem, B. Biochemistry 38, 12212-12217Google Scholar, 17Zhang S. Pohnert G. Kongsaeree P. Wilson D.B. Clardy J. Ganem B. J. Biol. Chem. 1998; 273: 6248-6253Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 18Zhang S. Wilson D.B. Ganem B. Biochemistry. 2000; 39: 4722-4728Crossref PubMed Scopus (35) Google Scholar, 19Chen S. Vincent S. Wilson D.B. Ganem B. Eur. J. Biochem. 2003; 27: 757-763Crossref Scopus (23) Google Scholar, 20Strater N. Schnappauf G. Braus G. Lipscomb W.N. Structure (Lond.). 1997; 5: 1437-1452Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar, 21Xue Y. Lipscomb W.N. Graf R. Schnappauf G. Braus G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10814-10818Crossref PubMed Scopus (65) Google Scholar) and are allosterically regulated by aromatic amino acids. The monofunctional chorismate mutase of Bacillus subtilis falls under the AroH class and is a feedback insensitive enzyme (22Chook Y.M. Ke H. Lipscomb W.N. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8600-8603Crossref PubMed Scopus (180) Google Scholar, 23Chook Y.M. Gray J.V. Ke H. Lipscomb W.N. J. Mol. Biol. 1994; 240: 476-500Crossref PubMed Scopus (156) Google Scholar).The low similarity at the amino acid sequence level among known chorismate mutases makes the enzyme one of the finest examples of convergent evolution of enzyme reaction mechanisms (24Lee A.Y. Karplus P.A. Ganem B. Clardy J. J. Am. Chem. Soc. 1995; 117: 3627-3628Crossref Scopus (195) Google Scholar). However, this low sequence similarity also accounts for the lack of confidence in the annotation of the enzyme in genome annotation projects. On the other hand, the uniqueness of the enzyme also makes it an attractive target for herbicides and antibacterial compounds (25Kishore G.M. Shah D.M. Annu. Rev. Biochem. 1988; 57: 627-663Crossref PubMed Scopus (351) Google Scholar).Chorismate mutase was not annotated in the initial genome sequence of Mtb. However, the recent Cluster of Orthologous groups (NCBI) annotation of the Mtb genome suggests that chorismate mutase activity can be attributed to two ORFs, Rv1885c and Rv0948c (www.ncbi.nlm.nih.gov/COG/). The ORF Rv1885c has been annotated in the TubercuList web server (genolist.pasteur.fr/TubercuList/), Institute Pasteur, as a conserved hypothetical protein with some similarity to the monofunctional chorismate mutases of Erwinia herbicola (28.6% identity in a 133-aa overlap). Rv0948c has also been annotated as a conserved hypothetical protein, equivalent to a conserved hypothetical protein (105 aa) from M. leprae (NP_301237.1 NC_002677) that is also similar to the N terminus of some chorismate mutase/prephenate dehydratase enzymes.We intended to study whether these two hypothetical proteins indeed show in vitro chorismate mutase activity and, if they do, how they are related to the two known classes of chorismate mutases (AroQ and AroH). Our approach involved expressing the Mtb ORFs Rv1885c and Rv0948c in E. coli and determining the biochemical and biophysical properties of the encoded proteins. Whereas more extensive studies were carried out with the protein coded by ORF Rv1885c, we were also able to demonstrate that Rv0948 also possesses chorismate mutase activity, although with a reduced turnover. Kinetic and regulatory studies of rRv1885c indicate several unique properties of the enzyme that include feedback regulation by pathway-specific as well as cross-pathway-specific ligands in the same manner. We have also used a gene fusion approach for functional characterization of the predicted N-terminal signal sequence of Mtb chorismate mutase. Our study provides sufficient evidence to conclusively place the protein coded by ORF Rv1885c of Mtb in the AroQ class of periplasmic chorismate mutases.EXPERIMENTAL PROCEDURESBacterial Strains/Plasmids—All bacterial strains used in this study are described in Table I. The plasmid vectors (with their sources) and the recombinant plasmids constructed are also described in the same table. Integrity of all the plasmid clones was confirmed by DNA sequencing.Table IBacterial strains and plasmidsStrains/plasmidsDescriptionSource/ref.E. coli strainsBL21 DE3F- ompT hsdSB (rB- mB-) gal lon dcm (ΔDE3)Studier and Moffatt (54Studier F.W. Moffatt B.A. J. Mol. Biol. 1986; 189: 113-130Crossref PubMed Scopus (4790) Google Scholar)DH5αΔ(argF-lac)U169 supE33 hsdR17 recA1 endA1 gyrA96 thi-1 relA1(Φ80 lacZ ΔM15)Hanahan (53Hanahan D. J. Mol. Biol. 1983; 166: 557-580Crossref PubMed Scopus (8126) Google Scholar)AD494F′ lac pro lacIq Δ (ara- leu)7697 araD 139 Δ(lac) X74 galE galK rpsLphoR Δ(phoA) PvuII Δ(malF)3 thi trxB::kanDerman et al. (41Derman A.I. Prinz W.A. Belin D. Beckwith J. Science. 1993; 262: 1744-1747Crossref PubMed Scopus (370) Google Scholar)GJ1902zbh-900::Tn10dKan(Ts)1 lacZ::Tn10dKan proC259Dr. J. Gowrishankar, lab stockMG1655Wild-type E. coli K-12MGPH1MG1655 Δ phoA lacZ:: Tn10dKanThis workPlasmidspET23aExpression vectorNovagenpETCM1pET23a derivative with Mtb CM1 (Rv1885c) cloned in NdeI/XhoI sitesThis workpETCM2pET23a derivative with Mtb CM2 (Rv0948c) cloned in NdeI/XhoI sitesThis workpGEMTEasyCloning vectorPromegapCDF1pGEMT Easy derivative with ss-less E. coli phoA cloned in vector MCSThis workpCDF2pET23aCM1 derivative with ss-less E. coli phoA cloned in SalI/XhoI sites downstream of Mtb CM1 signal sequenceThis workpBAD 18Expression vectorGuzman et al. (30Guzman L.M. Belin D. Carson M.J. Beckwith J. J. Bacteriol. 1995; 177: 4121-4130Crossref PubMed Scopus (3905) Google Scholar)pCDF3pBAD18 derivative with the putative Mtb CM1 signal sequence appended E. coli phoA cloned in XbaI/HindIII sitesThis workpCDF4pBAD18 derivative with ss-less E. coli phoA containing a 16-aa N-terminal extension cloned in XbaI/HindIII sitesThis work Open table in a new tab Cloning, Overexpression, and Purification of Recombinant Proteins in E. coli—The Mtb ORFs Rv1885c and Rv0948c were amplified from Mtb H37Rv genomic DNA using primer pairs with specific restriction enzyme sites (Rv1885c, ATCATATGTTGCTTACCCGTCCACGTGA (forward) and ATCTCGAGGGCCGGCGGTAGG (reverse); Rv0948c, AATCATATGAGACCAGAACCCCCACATCACGA (forward) and ATAAAGCTTGTGACCGAGGCGGCCCCT (reverse)). The PCR products were cloned into the corresponding sites of pET23a expression vector (Novagen). In this way, plasmids pETCM1 and pETCM2 capable of encoding C-terminal His6-tagged versions of the two putative Mtb chorismate mutases were generated (Table I).E. coli BL21(DE3) cells transformed with pETCM1 and pETCM2 were grown in 1 liter of LB medium supplemented with 100 μg/ml ampicillin and 10% glycerol. Isopropyl 1-thio-β-d-galactopyranoside was added to the mid-log phase culture at a final concentration of 0.1 mm. The cells were kept in an incubator shaker for another 5 h at 27 °C/150 rpm to allow protein expression. A low temperature was used to allow the protein to enter the soluble phase. After induction, the cells were harvested by centrifugation and resuspended in 20 ml of lysis buffer (10 mm Tris-HCl, 100 mm NaCl, and 10% glycerol, pH 7.5) with 0.1 mm phenylmethylsulfonyl fluoride and disrupted using a sonicator. After another round of centrifugation for 10 min at 10,000 × g, the supernatant was applied to a Talon cobalt affinity resin (Clontech).Affinity Chromatography—The supernatant was allowed to bind to Talon resin (Clontech) packed in a polypropylene column. The recombinant protein was purified to near homogeneity after washing the column with 5 bed volumes of lysis buffer containing 30 mm imidazole and elution with 250 mm imidazole. The eluates were analyzed by SDS-PAGE and dialyzed against Tris buffer to remove salts and imidazole. The purity of the enzyme was checked by SDS-PAGE followed by Coomassie Blue staining.Enzyme Assays and Kinetic Studies—Chorismate mutase activity assays were carried out as described by Davidson and Hudson (26Davidson B.E. Hudson G.S. Methods Enzymol. 1987; 142: 440-450Crossref PubMed Scopus (35) Google Scholar), with a few modifications. This assay is based on enzymatic conversion of chorismate to prephenate, which is terminated by the addition of HCl. Prephenate can be further converted to phenylpyruvate under acidic conditions that can be measured spectrophotometrically at an alkaline pH (27Krappmann S. Helmstaedt K. Gerstberger T. Eckert S. Hoffmann B. Hoppert M. Schnappauf G. Braus G.H. J. Biol. Chem. 1999; 274: 22275-22282Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Reaction volumes of 100 μl contained 10 mm Tris-HCl, pH 7.5, chorismic acid (0.5-5 mm), and, optionally, tyrosine, phenylalanine, or tryptophan (50 μm to 3 mm). The pH of the reaction was maintained by varying the ionic strength of the buffer. The reaction was started by adding 10-200 pmol of the purified protein to the pre-warmed chorismate solution (at 30 °C), and it was stopped by the addition of 10 μl of 1.6 N HCl. After a second incubation of the mixture at 37 °C for 15 min, 890 μl of 1.58 N NaOH was added, and the absorbance was recorded at 320 nm. To exclude the absorbance caused by the uncatalyzed arrangement of chorismate, blanks of increasing chorismate concentrations without enzyme were prepared, and their absorbance was also recorded. These readings were then subtracted from the absorbance measured for enzyme activities at different concentrations of the substrate.For determination of the optimum enzyme and substrate concentrations, 10-800 pmol of enzyme and 0.5-3 mm chorismic acid were used. Buffers of different pH values (CPB, pH 4; CPB, pH 4.5; MES, pH 6; HEPES, pH 7; Tris-HCl, pH 7.5; Tris-HCl, pH 8) were used to determine the optimum pH for enzyme activity. Chorismate mutase activity was also assessed at different temperatures (15 °C to 80 °C). One unit of enzyme was defined as the amount of enzyme required to form 1 μmol product/min at 37 °C.Prephenate dehydratase and prephenate dehydrogenase assays were carried out as previously described (26Davidson B.E. Hudson G.S. Methods Enzymol. 1987; 142: 440-450Crossref PubMed Scopus (35) Google Scholar, 28Gething M.J. Davidson B.E. Eur. J. Biochem. 1977; 78: 111-117Crossref PubMed Scopus (25) Google Scholar).Phe, Tyr, and Trp Feedback Inhibition Assays—Allosteric regulation of chorismate mutase activity by l-Phe, l-Tyr, and l-Trp was measured at 100-800 μm concentrations of the effectors.Western Blot—Western blot with the cytosolic and periplasmic fractions of E. coli BL21 cells expressing Mtb chorismate mutase (Rv1885c) was carried out with monoclonal anti-His antibody using the manufacturer's instructions (Santa Cruz Biotechnology). The E. coli periplasmic fraction was isolated using a modified osmotic shock procedure described by Qiagen Inc.Limited Proteolysis—To study the effects of various ligands on enzyme stability, integrity, and accessibility of active sites, limited proteolysis of Mtb chorismate mutase was carried out. Trypsin was taken as the protease of choice. Ten μg of recombinant protein (1 μg/μl concentration) was taken, to which different concentrations of the ligand (tyrosine, phenylalanine, tryptophan, salicylate) were added. The reaction buffer contained 50 mm Tris, pH 7.5, and 100 mm NaCl. Trypsin was added at a 1:1000 ratio, and the reaction was incubated at 25 °C for 30 min, following which trypsin was inactivated by the addition of 0.5 mm phenylmethylsulfonyl fluoride. The reaction was mixed with an equal volume of 2× Tris-Tricine loading dye and loaded on a 10% Tris-Tricine gel.CD Spectrometry—The CD spectrum of the recombinant protein (Rv1885c) was recorded in a wavelength range of 190-250 nm in steps of 1 nm, with four accumulations at each step. The spectral baseline was corrected by subtracting the respective blanks. Ellipticity, represented in millidegrees, was plotted as a function of wavelength (in nm). The percentage of helicity for secondary structure determination was calculated using the K2D software available on-line (www.embl-heidelberg.de/~andrade/k2d/)Determination of the Quaternary Structure of Mtb Chorismate Mutase—The oligomeric state of recombinant proteins was determined using analytical size exclusion chromatography using a Superdex 200 (HP 10/30) fast protein liquid chromatography column from Amersham Biosciences. Chromatography was performed at room temperature with 10 mm Tris, 100 mm NaCl, and 1 mm dithiothoreitol as the running buffer, the same buffer in which the recombinant protein was eluted. A standard curve was prepared according to the instruction manual using the Low Molecular Weight Gel Filtration calibration kit from Amersham Biosciences. The void volume was determined using blue dextran 2000. The elution parameter Kav was calculated as follows: Kav = Ve - Vo/Vt - Vo, where Ve = elution volume for the protein, Vo = column void volume, and Vt = total bed volume. Kav was plotted against log Molecular Weight. The protein sample was chromatographed on the gel filtration column at a concentration of 4 mg/ml in the presence of dithiothreitol, and the elution volume was recorded.Construction of an E. coli Strain Lacking Endogenous Alkaline Phosphatase Activity—Strain MGPH1 lacking endogenous alkaline phosphatase (PhoA) activity was constructed via bacteriophage P1-mediated transduction in a two-step process. In the first step, a lysate prepared on strain GJ1902 was used to transduce wild-type E. coli strain MG1655 to lacZ::Kan, and the transductants were screened for inheritance of the linked proC mutation conferring proline auxotrophy. This transductant was used as a recipient in the second transduction involving strain AD494 as a donor, and selection was employed for proline protrophy. Co-inheritance of the linked phoA deletion was assessed by screening for transductants lacking PhoA activity on low phosphate plates containing the PhoA chromogenic substrate XP (29Miller J. A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1992Google Scholar).Characterization of the Putative N-terminal Signal Sequence of Mtb Chorismate Mutase in the Heterologous Host E. coli—To validate the prediction that the N terminus of Mtb chorismate mutase comprising the first 33 amino acids was capable of functioning as a signal sequence, we appended this sequence to PhoA, a heterologous protein, and studied its export in E. coli. Using standard methodologies, a chimeric protein was generated in which the first 33 amino acids of Mtb chorismate mutase were fused to the E. coli PhoA lacking its natural signal sequence of the first 21 amino acids (ΔssPhoA). Briefly, ΔssphoA was PCR-amplified from E. coli genomic DNA using primer pairs ATGTCGACACACCAGAAATGCCTGTTCTG and ATCTCGAGAAGCTTTTATTTCAGCCCCAGAGC and cloned into the SalI and XhoI sites of the pGEMTEasy vector (Promega), generating plasmid pCDF1. The cloned PCR product was excised using the enzymes SalI and XhoI and cloned into the corresponding sites of the pETCM1 plasmid abutting the first 33 amino acids of chorimate mutase to the signal sequence-less PhoA. This construct was designated as pCDF2. In the next step, pCDF2 was digested with XbaI and HindIII and cloned into the corresponding sites of plasmid pBAD18 (30Guzman L.M. Belin D. Carson M.J. Beckwith J. J. Bacteriol. 1995; 177: 4121-4130Crossref PubMed Scopus (3905) Google Scholar), and the resulting construct was designated as pCDF3. In this configuration, the expression of the gene encoding the chimeric protein (CM1ssPhoA) is induced by arabinose, and translation initiating from the initiation codon of CM would terminate at the stop codon of ΔssphoA. A chimeric protein is thereby produced with the first 33 amino acids of Mtb chorismate mutase at its N terminus, and the remainder is alkaline phosphatase lacking its native signal sequence. Using similar methods, we constructed plasmid pCDF4, expressing from the arabinose-inducible promoter a ΔssPhoA with a 16-aa N-terminal extension not expected to function as a signal sequence. An E. coli strain designated MGPH1, bearing a deletion of the gene for alkaline phosphatase, was constructed in two steps using bacteriophage P1-mediated transduction. Plasmids pCDF3 and pCDF4 were transformed into MGPH1. E. coli PhoA is known to be active only after export to the periplasmic space (31Brickman E. Beckwith J. J. Mol. Biol. 1975; 96: 307-316Crossref PubMed Scopus (319) Google Scholar). Hence, blue-colored transformants on LB plates supplemented with the PhoA chromogenic substrate XP (40 μg/ml) and the inducer l-arabinose (0.2%) were expected only if the putative Mtb chorismate mutase 1 signal sequence mediated the export of the appended PhoA variant to the periplasm.RESULTSThe Hypothetical ORF Rv1885c of Mtb Encodes a Functional Chorismate Mutase Enzyme—The gene corresponding to the ORF Rv1885c of Mtb was PCR-amplified, cloned, and expressed in E. coli BL21 cells, and recombinant protein was purified to near homogeneity (Fig. 2A). The kinetic properties of the purified protein were studied using chorismate mutase activity assays. The substrate saturation curves were hyperbolic for the enzyme, i.e. the enzyme followed Michaelis-Menten kinetics. There was no indication of positive homotropic cooperativity of Mtb chorismate mutase toward chorismate. Km for the enzyme was calculated as 1.2 mm, and Vmax was calculated as 74 μmol min-1 mg-1 (Fig. 2B). The molar catalytic activity (kcat) was 26 s-1. The effects of temperature and pH on enzyme kinetics were also studied. Because spontaneous arrangement of chorismate to prephenate is strongly dependent on temperature, blanks of the same reaction without the enzyme were also kept at different temperatures, and the readings were subtracted from those obtained in the presence of the enzyme. Mtb chorismate mutase was found to be maximally active in the temperature range of 37 °C to 50 °C. An increase in temperature did increase enzyme activity (as expected), and complete denaturation of the enzyme occurred at a temperature close to 60 °C.Fig. 2Mtb chorismate mutase encoded by ORF Rv1885c follows Michaelis-Menten kinetics. A, purification of the chorismate mutase enzyme (Rv1885c) of Mtb as a recombinant protein in E. coli. The ORF corresponding to Rv1885c was cloned in the NdeI and XhoI sites of pET23a vector with a C-terminal His tag and expressed in E. coli BL21 cells. Affinity purification of recombinant protein was carried out using Talon resin (Clontech). The purified protein was resolved on 10% Tris-tricine gel, and the gel was stained with Coomassie Brilliant Blue dye. M represents the protein molecular size marker (Broad range, Genei, India). E1-E7 show the successive eluted fractions of the recombinant protein. Arrowhead indicates the position of the 22-kDa protein, which is the predicted mass of Mtb chorismate mutase. B, the purified recombinant protein corresponding to ORF Rv1885c was assayed for chorismate mutase activity in the absence of any effector molecule. The data were fitted to functions describing Michaelis-Menten-type saturation to calculate Km and Vmax.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The pH value also has a significant role in determining the activity of chorismate mutase. Mtb chorismate mutase was found to be active between pH 6 and pH 8.5, with a pH optimum of 7.5. The pH optimum is similar to that of E. coli chorismate mutase, for which maximum activity is at pH 7.3. Chorismate mutase activity of rRv1885 was greatly inhibited at acidic pH. Whereas fungal chorismate mutases are reported to be more active at acidic pH, bacterial chorismate mutases (E. coli P protein and Salmonella typhimurium CM) are reported to be active at alkaline pH (14Helmstaedt K. Krappmann S. Braus G.H. Microbiol. Mol. Biol. Rev. 2001; 65: 404-421Crossref PubMed Scopus (55) Google Scholar, 32Schnappauf G. Strater N. Lipscomb W.N. Braus G.H. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8491-8496Crossref PubMed Scopus (35) Google Scholar). Bacillus chorismate mutase has maximum activity in the range of pH 5 to pH 9 (33Gray J.V. Golinelli-Pimpaneau B. Knowles J.R. Biochemistry. 1990; 29: 376-383Crossref PubMed Scopus (44) Google Scholar). Hence, the pH range at which Mtb chorismate mutase works efficiently is similar to that of B. subtilis, with the optimum pH being closer to that of E. coli chorismate mutase.Mtb Chorismate Mutase (Rv1885c) Does Not Display Prephenate Dehydratase (PDT) or Prephenate Dehydrogenase (PDH) Activity—Although PDT or PDH domains have not been predicted to be present in the ORF Rv1885c, on account of several examples of divergent evolution of enzymes involved in aromatic amino acid biosynthesis (12Dosselaere F. Vanderleyden J. Crit. Rev. Microbiol. 2001; 27: 75-131Crossref PubMed Scopus (132) Google Scholar), we decided to test whether Mtb chorismate mutase displays PDT or PDH activities. PDT and PDH assays were accordingly carried out with the recombinant protein. Our results show that the PDT/PDH activity of rRv1885c is only 0.01% of its CM activity, which suggests that the protein does not possess any intrinsic PDT or PDH activity (data not shown). This is unlike the chorismate mutases of many other enteric bacteria, in which chorismate mutase and PDT/PDH" @default.
• W1968650445 created "2016-06-24" @default.
• W1968650445 creator A5005971403 @default.
• W1968650445 creator A5012186776 @default.
• W1968650445 creator A5052935835 @default.
• W1968650445 creator A5071117504 @default.
• W1968650445 date "2005-05-01" @default.
• W1968650445 modified "2023-09-28" @default.
• W1968650445 title "Purified Recombinant Hypothetical Protein Coded by Open Reading Frame Rv1885c of Mycobacterium tuberculosis Exhibits a Monofunctional AroQ Class of Periplasmic Chorismate Mutase Activity" @default.
• W1968650445 cites W1485645722 @default.
• W1968650445 cites W1489620726 @default.
• W1968650445 cites W1514764269 @default.
• W1968650445 cites W1553324085 @default.
• W1968650445 cites W1568288844 @default.
• W1968650445 cites W1752483440 @default.
• W1968650445 cites W1846680989 @default.
• W1968650445 cites W1948880364 @default.
• W1968650445 cites W1966307757 @default.
• W1968650445 cites W1972745877 @default.
• W1968650445 cites W1974071568 @default.
• W1968650445 cites W1975993749 @default.
• W1968650445 cites W1979581724 @default.
• W1968650445 cites W1984213404 @default.
• W1968650445 cites W1985889708 @default.
• W1968650445 cites W1987895760 @default.
• W1968650445 cites W1993082390 @default.
• W1968650445 cites W1996376414 @default.
• W1968650445 cites W2008321700 @default.
• W1968650445 cites W2016380870 @default.
• W1968650445 cites W2019023077 @default.
• W1968650445 cites W2022570131 @default.
• W1968650445 cites W2024077365 @default.
• W1968650445 cites W2026395595 @default.
• W1968650445 cites W2029684104 @default.
• W1968650445 cites W2031971013 @default.
• W1968650445 cites W2046232520 @default.
• W1968650445 cites W2057733669 @default.
• W1968650445 cites W2063873155 @default.
• W1968650445 cites W2070617869 @default.
• W1968650445 cites W2072619761 @default.
• W1968650445 cites W2080575265 @default.
• W1968650445 cites W2094502799 @default.
• W1968650445 cites W2100138502 @default.
• W1968650445 cites W2105274638 @default.
• W1968650445 cites W2111997224 @default.
• W1968650445 cites W2113981405 @default.
• W1968650445 cites W2114093543 @default.
• W1968650445 cites W2114902148 @default.
• W1968650445 cites W2121749642 @default.
• W1968650445 cites W2125112523 @default.
• W1968650445 cites W2127776703 @default.
• W1968650445 cites W2128482141 @default.
• W1968650445 cites W2132417094 @default.
• W1968650445 cites W2141242826 @default.
• W1968650445 cites W2147045968 @default.
• W1968650445 cites W2160084442 @default.
• W1968650445 cites W2161715109 @default.
• W1968650445 cites W2317523791 @default.
• W1968650445 cites W2462176620 @default.
• W1968650445 cites W4245335048 @default.
• W1968650445 doi "https://doi.org/10.1074/jbc.m413026200" @default.
• W1968650445 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15737998" @default.
• W1968650445 hasPublicationYear "2005" @default.
• W1968650445 type Work @default.
• W1968650445 sameAs 1968650445 @default.
• W1968650445 citedByCount "30" @default.
• W1968650445 countsByYear W19686504452015 @default.
• W1968650445 countsByYear W19686504452016 @default.
• W1968650445 countsByYear W19686504452017 @default.
• W1968650445 countsByYear W19686504452018 @default.
• W1968650445 countsByYear W19686504452019 @default.
• W1968650445 countsByYear W19686504452020 @default.
• W1968650445 countsByYear W19686504452021 @default.
• W1968650445 countsByYear W19686504452022 @default.
• W1968650445 countsByYear W19686504452023 @default.
• W1968650445 crossrefType "journal-article" @default.
• W1968650445 hasAuthorship W1968650445A5005971403 @default.
• W1968650445 hasAuthorship W1968650445A5012186776 @default.
• W1968650445 hasAuthorship W1968650445A5052935835 @default.
• W1968650445 hasAuthorship W1968650445A5071117504 @default.
• W1968650445 hasBestOaLocation W19686504451 @default.
• W1968650445 hasConcept C104317684 @default.
• W1968650445 hasConcept C142724271 @default.
• W1968650445 hasConcept C167625842 @default.
• W1968650445 hasConcept C185592680 @default.
• W1968650445 hasConcept C201663137 @default.
• W1968650445 hasConcept C2777975735 @default.
• W1968650445 hasConcept C2778526059 @default.
• W1968650445 hasConcept C2781069245 @default.
• W1968650445 hasConcept C40767141 @default.
• W1968650445 hasConcept C47289529 @default.
• W1968650445 hasConcept C547475151 @default.
• W1968650445 hasConcept C553450214 @default.
• W1968650445 hasConcept C55493867 @default.
• W1968650445 hasConcept C71924100 @default.
• W1968650445 hasConcept C86803240 @default.
• W1968650445 hasConceptScore W1968650445C104317684 @default.
• W1968650445 hasConceptScore W1968650445C142724271 @default.

• next