FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1968865001> ?p ?o ?g. }

• W1968865001 endingPage "14049" @default.
• W1968865001 startingPage "14040" @default.
• W1968865001 abstract "Chromatin assembly factor 1 contains three subunits, p150, p60, and p48. It is essential for coupling nucleosome assembly to newly synthesized DNA. Whether chromatin assembly factor 1 subunits have functions beyond escorting histones, which depends on the complex formation of p150 and p60, has been an issue of great interest. This study reveals a novel role of p150, but not p60, in gene-specific transcriptional activation. We found that p150 transcriptionally activated an essential viral promoter, the major immediate early promoter (MIEP) of the human cytomegalovirus, independently of p60. Knocking down p150 decreased the MIEP function in both transfected and virally infected cells. The chromatin immunoprecipitation analysis and the in vitro protein-DNA binding assay demonstrated that p150 used its KER domain to associate with the MIEP from –593 to –574 bp. The N-terminal 244 residues were also found essential for p150-mediated MIEP activation, likely through recruiting the acetyltransferase p300 to acetylate local histones. Domain swapping experiments further showed that the KER and the N terminus of p150 acted as an independent DNA binding and transcriptional activation domain, respectively. Because p60 did not seem involved in the reaction, together these results indicate for the first time that p150 directly activates transcription, independently of its histone deposition function. Chromatin assembly factor 1 contains three subunits, p150, p60, and p48. It is essential for coupling nucleosome assembly to newly synthesized DNA. Whether chromatin assembly factor 1 subunits have functions beyond escorting histones, which depends on the complex formation of p150 and p60, has been an issue of great interest. This study reveals a novel role of p150, but not p60, in gene-specific transcriptional activation. We found that p150 transcriptionally activated an essential viral promoter, the major immediate early promoter (MIEP) of the human cytomegalovirus, independently of p60. Knocking down p150 decreased the MIEP function in both transfected and virally infected cells. The chromatin immunoprecipitation analysis and the in vitro protein-DNA binding assay demonstrated that p150 used its KER domain to associate with the MIEP from –593 to –574 bp. The N-terminal 244 residues were also found essential for p150-mediated MIEP activation, likely through recruiting the acetyltransferase p300 to acetylate local histones. Domain swapping experiments further showed that the KER and the N terminus of p150 acted as an independent DNA binding and transcriptional activation domain, respectively. Because p60 did not seem involved in the reaction, together these results indicate for the first time that p150 directly activates transcription, independently of its histone deposition function. IntroductionChromatin assembly factor 1 (CAF1) 3The abbreviations used are: CAF1, chromatin assembly factor 1; MIEP, major immediate early promoter; HCMV, human cytomegalovirus; PCNA, proliferating cell nuclear antigen; shRNA, short hairpin RNA; m.o.i., multiplicity of infection; ChIP, chromatin immunoprecipitation; EMSA, electrophoretic mobility shift assay; Ab, antibody; DAPA, DNA affinity protein assay; NLS, nuclear localization sequence; oligo, oligonucleotide; GalDBD, Gal4 DNA binding domain; GalAD, Gal4 activation domain; GFP, green fluorescent protein. is the only histone chaperone known to assemble histones H3 and H4 onto newly synthesized DNA both in vitro and in vivo (1Kaufman P.D. Kobayashi R. Kessler N. Stillman B. Cell. 1995; 81: 1105-1114Abstract Full Text PDF PubMed Scopus (307) Google Scholar, 2Takami Y. Ono T. Fukagawa T. Shibahara K. Nakayama T. Mol. Biol. Cell. 2007; 18: 129-141Crossref PubMed Scopus (68) Google Scholar). It is a three-subunit complex, consisting of p150, p60, and p48. The 938 amino acid multidomain p150 binds via its C-terminal third to p60, which is an essential step for nucleosome assembly because knocking down either subunit disrupts the activity (2Takami Y. Ono T. Fukagawa T. Shibahara K. Nakayama T. Mol. Biol. Cell. 2007; 18: 129-141Crossref PubMed Scopus (68) Google Scholar, 3Nabatiyan A. Krude T. Mol. Cell. Biol. 2004; 24: 2853-2862Crossref PubMed Scopus (94) Google Scholar, 4Hoek M. Stillman B. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 12183-12188Crossref PubMed Scopus (189) Google Scholar). In addition, CAF1 facilitates DNA synthesis depending on the binding of the N-terminal 31 residues of p150 to the proliferating cell nuclear antigen (PCNA), which acts as a sliding clamp to stimulate the processivity of DNA polymerase (5Shibahara K. Stillman B. Cell. 1999; 96: 575-585Abstract Full Text Full Text PDF PubMed Scopus (535) Google Scholar, 6Moggs J.G. Grandi P. Quivy J.P. Jonsson Z.O. Hubscher U. Becker P.B. Almouzni G. Mol. Cell. Biol. 2000; 20: 1206-1218Crossref PubMed Scopus (253) Google Scholar). The internal region of p150 contains two large bunches of charge residues called KER (a region enriched in lysine, glutamic acid, and arginine) and ED (a region enriched in glutamic acid and aspartic acid) domains, which are thought to be the binding sites for acetylated histones H3 and H4 (1Kaufman P.D. Kobayashi R. Kessler N. Stillman B. Cell. 1995; 81: 1105-1114Abstract Full Text PDF PubMed Scopus (307) Google Scholar, 7Verreault A. Kaufman P.D. Kobayashi R. Stillman B. Cell. 1996; 87: 95-104Abstract Full Text Full Text PDF PubMed Scopus (521) Google Scholar). Both p150 and p60 contain a PEST domain, which is believed to mediate the degradation of these two proteins (8Rogers S. Wells R. Rechsteiner M. Science. 1986; 234: 364-368Crossref PubMed Scopus (1946) Google Scholar, 9Belizario J.E. Alves J. Garay-Malpartida M. Occhiucci J.M. Curr. Protein Pept. Sci. 2008; 9: 210-220Crossref PubMed Scopus (46) Google Scholar). Knocking down p150, in some cases, causes a concomitant loss of p60 protein, presumably due to the rapid turnover of the free subunit (4Hoek M. Stillman B. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 12183-12188Crossref PubMed Scopus (189) Google Scholar).CAF1 is involved in transcriptional regulation. The loss of the p150 homolog CAC1 in yeast impairs the constitutive gene silencing at telomeres and mating-type loci (10Enomoto S. Berman J. Genes Dev. 1998; 12: 219-232Crossref PubMed Scopus (169) Google Scholar, 11Monson E.K. de Bruin D. Zakian V.A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 13081-13086Crossref PubMed Scopus (113) Google Scholar, 12Huang S. Zhou H. Tarara J. Zhang Z. EMBO J. 2007; 26: 2274-2283Crossref PubMed Scopus (62) Google Scholar). p150 regulates the formation of heterochromatin in mammalian cells during replication (Refs. 13Ramirez-Parra E. Gutierrez C. Trends Plant Sci. 2007; 12: 570-576Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 14Quivy J.P. Roche D. Kirschner D. Tagami H. Nakatani Y. Almouzni G. EMBO J. 2004; 23: 3516-3526Crossref PubMed Scopus (148) Google Scholar and references therein) and in plants it maintains the transcription of certain subsets of genes (15Zabaronick S.R. Tyler J.K. Mol. Cell. Biol. 2005; 25: 652-660Crossref PubMed Scopus (45) Google Scholar, 16Schonrock N. Exner V. Probst A. Gruissem W. Hennig L. J. Biol. Chem. 2006; 281: 9560-9568Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). Furthermore, p150 exists in a chromatin-remodeling complex WINAC, which coactivates ligand-induced transactivation function of the vitamin D receptor (17Kitagawa H. Fujiki R. Yoshimura K. Mezaki Y. Uematsu Y. Matsui D. Ogawa S. Unno K. Okubo M. Tokita A. Nakagawa T. Ito T. Ishimi Y. Nagasawa H. Matsumoto T. Yanagisawa J. Kato S. Cell. 2003; 113: 905-917Abstract Full Text PDF PubMed Scopus (240) Google Scholar). Currently, these effects are thought to be controlled by the global chromatin structure that requires CAF1-mediated nucleosome assembly.Although p150, p60, and p48 cosediment in the fraction that exhibits the nucleosome assembly activity (7Verreault A. Kaufman P.D. Kobayashi R. Stillman B. Cell. 1996; 87: 95-104Abstract Full Text Full Text PDF PubMed Scopus (521) Google Scholar), each of the CAF1 subunits also displays its unique distribution pattern, especially during S phase of the cell cycle (18Marheineke K. Krude T. J. Biol. Chem. 1998; 273: 15279-15286Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). This implicates that each subunit may have additional roles beyond chromatin assembly, and the additional functions may not require them to complex with one another. In mouse cells, p150, but not p60, regulates progression of the middle-to-late S phase and promotes the replication of pericentric heterochromatin via interacting with the HP1 (heterochromatin protein 1) (19Quivy J.P. Gerard A. Cook A.J. Roche D. Almouzni G. Nat. Struct. Mol. Biol. 2008; 15: 972-979Crossref PubMed Scopus (112) Google Scholar). p150 interacts with HP1 α/γ and the MBD1 (methyl-CpG binding domain protein 1) through its N- and C-terminal regions, respectively, and may guide them to heterochromatin regions (14Quivy J.P. Roche D. Kirschner D. Tagami H. Nakatani Y. Almouzni G. EMBO J. 2004; 23: 3516-3526Crossref PubMed Scopus (148) Google Scholar, 20Murzina N. Verreault A. Laue E. Stillman B. Mol. Cell. 1999; 4: 529-540Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 21Reese B.E. Bachman K.E. Baylin S.B. Rountree M.R. Mol. Cell. Biol. 2003; 23: 3226-3236Crossref PubMed Scopus (83) Google Scholar). p48 associates with the retinoblastoma tumor suppressor protein (22Qian Y.W. Wang Y.C. Hollingsworth Jr., R.E. Jones D. Ling N. Lee E.Y. Nature. 1993; 364: 648-652Crossref PubMed Scopus (232) Google Scholar) and serves as an escort of various histone metabolism enzymes (23Parthun M.R. Widom J. Gottschling D.E. Cell. 1996; 87: 85-94Abstract Full Text Full Text PDF PubMed Scopus (371) Google Scholar). Whether CAF1 subunits have other independent functions remains to be explored.Previously, a yeast two-hybrid assay was used to screen for proteins associating with the immediate early protein 2 (IE2) of the human cytomegalovirus (HCMV) (24Huang C.F. Wang Y.C. Tsao D.A. Tung S.F. Lin Y.S. Wu C.W. J. Biol. Chem. 2000; 275: 12313-12320Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar). We identified that the p150 fragment aa 87–938 interacted with the C-terminal half (aa 291–579) of IE2. Because proteins obtained using this strategy, such as Nrf1 and Nrf2 (24Huang C.F. Wang Y.C. Tsao D.A. Tung S.F. Lin Y.S. Wu C.W. J. Biol. Chem. 2000; 275: 12313-12320Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar), antagonized the IE2-mediated transcriptional repression of its own promoter, the major IE promoter (MIEP), we examined if p150 has a similar effect. Unexpectedly, in the absence of IE2, p150, but not p60, increased the MIEP activity in a dose-dependent manner. We demonstrated that p150 associated with the MIEP in transfected cells. Both the potential DNA binding and the transcriptional activation domains on p150 were also characterized. This study reveals a previously unidentified role for p150 as a direct transcriptional activator.EXPERIMENTAL PROCEDURESPlasmids—pcDNA3.1-HA-p150 and pcDNA3.1-HA-p150C, which encode the HA-tagged, full-length p150 or the C-terminal residues 641–938, respectively, were kindly provided by Dr. P. D. Kaufman (25Ye X. Franco A.A. Santos H. Nelson D.M. Kaufman P.D. Adams P.D. Mol. Cell. 2003; 11: 341-351Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). To construct the plasmid for establishing a stable cell line expressing aa 641–938 of p150, pSEP7-HA-p150C was generated by inserting the corresponding cDNA into pSEP7 between the HindIII and XhoI sites. pcDNA3.1-HA-p60 was constructed by inserting the corresponding p60 cDNA into pcDNA3.1-HA between the XhoI and XbaI sites. pPK38, ΔPEST, ΔKER, and ΔED, which produce the in vitro translated wild-type p150 or p150 mutants with the corresponding internal deletion, were kindly provided by Dr. B. Stillman (1Kaufman P.D. Kobayashi R. Kessler N. Stillman B. Cell. 1995; 81: 1105-1114Abstract Full Text PDF PubMed Scopus (307) Google Scholar). Plasmids expressing the series of terminally deleted mutants of p150, used for in vitro transcription/translation and for expression in mammalian cells, were generated by inserting the specific PCR-amplified p150 fragment flanked by EcoRI sites into the pcDNA3.1/V5-His-TOPO vector (Invitrogen). To generate the internally deleted mutants of p150, two-step cloning was performed. The cDNAs encoding the p150 fragments N-terminal to the domain to be deleted were first PCR-amplified using primers with 3′ EcoRI linker, followed by cloning into pcDNA3.1/V5-His-TOPO (Invitrogen). The resulting plasmids were then digested with EcoRI and ligated with the EcoRI site-flanked cDNAs encoding the p150 fragments C-terminal to the domain to be deleted. The orientation of the inserts was confirmed by DNA sequencing. Plasmids encoding the firefly luciferase gene driven by the HCMV major IE promoter (pMIEP–733/+2) and the MIEP derivatives pMIEP–540/+2 and pMIEP–235/+2 were kindly provided by Dr. Y. H. W. Lee. To generate plasmids encoding the luciferase reporter driven by serially 5′-deleted mutants of MIEP, the specific MIEP fragments were PCR-amplified with primers containing the NheI or HindIII site and then inserted into pGL2 between the NheI and HindIII sites. All the serially deleted mutants were checked by DNA sequencing after construction. To generate recombinant proteins from Escherichia coli to perform in vitro binding assays, the PCR-amplified cDNA fragment encoding amino acids 1–296 or 311–445 of p150 was inserted into the pET100D/TOPO vector (Invitrogen), which encodes proteins N-terminally tagged with His6 and Xpress. The plasmids encoding Gal4 activation domain (GalAD)-fused p150 fragments were generated by inserting the PCR-amplified cDNA of GalAD from pACT2 (Clontech) into the HindIII site of pcDNA3.1-p150/311–938-V5/His or pcDNA3.1-p150/505-938-V5/His. pMH100-TK, which contains a luciferase reporter gene driven by the thymidine kinase promoter of herpes simplex virus containing an additional five-Gal4-binding site, was kindly provided by Dr. Ronald Evan. To generate plasmids encoding the Gal4 DNA binding domain (GalDBD) fused to the C-terminal end of p150 fragments, the cDNA encoding GalDBD was PCR-amplified from pCMX-GalDBD and cloned into XbaI site of pcDNA3-p150/1–296-V5/His or pcDNA3-p150/1–641-V5/His. The orientation was checked by DNA sequencing. The plasmid encoding the chimera protein with GalDBD at its N terminus and p150 aa 564–938 at its C terminus was generated by inserting the EcoRI-digested p150 fragment from pcDNA3.1-p150/564–938-V5/His into pCMX-Gal4DBD. The cDNA encoding the GalDBD-p150 fragment was then PCR-amplified and subcloned into pcDNA3.1-V5/His (Invitrogen). The plasmid encoding the KER domain fused to the C terminus of VP16 was generated by inserting the EcoRI-digested p150 fragment from pcDNA3.1-p150 311–445-V5/His into pVP16 (Clontech). The series of plasmid pLKO.1-puro-shp150, which encode several short hairpin RNAs (shRNAs) targeting to different regions of p150, were obtained from the National RNAi Core Facility located at the Institute of Molecular Biology/Genomics Research Center, Academia Sinica, Taiwan. The following sequences are the regions targeted by each shp150: shp150-1 (CHAF1A, TRCN-0000074273), 3′-untranslated region, TTGAACCGACTCAATTCCTGTGTAAA; shp150-2 (CHAF1A, TRCN0000074274), +1523 to +1543, CCACCCGGAATGCAGATATTT; shp150-3 (CHAF1A, TRCN0000074275), +897 to +917, CCTCCGCAGAATAACTAAGAA.Cell Culture, Transfection, and Virus Infection—The human lung adenocarcinoma H1299 and osteosarcoma U2OS cells were obtained from and maintained as instructed by the ATCC. U373MG human glioblastoma astrocytoma cells were obtained from the European Collection of Cell Cultures and cultured in minimal essential medium alpha medium (Invitrogen) containing 10% fetal bovine serum, 100 units/ml penicillin G sodium (Invitrogen), and 100 μg/ml of streptomycin sulfate (Invitrogen). All transfections were carried out using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. 5 × 105 or 3 × 106 cells were seeded, respectively, onto 6-well plates or 10-cm plates 1 day before transfection and harvested 24 h post-transfection. To generate stable lines, 300 μg/ml hygromycin or 25 μg/ml puromycin (both from Sigma) were used to enrich cells containing the plasmid. In transfection/infection experiments, cells were transfected with the MIEP-driven luciferase reporter and infected with HCMV 4 h post-transfection. HCMV strain RC256 (26Spaete R.R. Mocarski E.S. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 7213-7217Crossref PubMed Scopus (102) Google Scholar) was obtained from the ATCC and maintained according to the manufacturer's instructions. Infections were performed at multiplicity of infection (m.o.i.) of 1 (Fig. 2A) or the indicated amount (Fig. 2B) for 2 h.Western and Luciferase Assay—Luciferase assays and Western analyses were performed as reported (27Hsu C.H. Chang M.D. Tai K.Y. Yang Y.T. Wang P.S. Chen C.J. Wang Y.H. Lee S.C. Wu C.W. Juan L.J. EMBO J. 2004; 23: 2269-2280Crossref PubMed Scopus (68) Google Scholar).Chromatin Immunoprecipitation (ChIP)—ChIP assays were performed as described (27Hsu C.H. Chang M.D. Tai K.Y. Yang Y.T. Wang P.S. Chen C.J. Wang Y.H. Lee S.C. Wu C.W. Juan L.J. EMBO J. 2004; 23: 2269-2280Crossref PubMed Scopus (68) Google Scholar) with some modifications. The precipitated DNAs were analyzed by real time PCR using a LightCycler (Roche Applied Science) and a QuantiTect SYBR Green PCR kit (Qiagen) according to the manufacturer's instructions. The primers and annealing temperatures were as follows: MIE promoter, 5′-CAATATTGGCCATTAGCC-3′ and 5′-GGGCTATGAACTAATGACC-3′ (–733 to –537 bp, annealed at 58 °C); luciferase 1, 5′-TAGAGGATGGAACCGCTG-3′ and 5′-CCAACCGAACGGACATTT-3′ (+50 to +173 bp, annealed at 60 °C); luciferase 2, 5′-TACCAGAGTCCTTTGATCGT-3′ and 5′-GTGATGGAATGGAACAACACTT-3′ (+545 to +735 bp, annealed at 60 °C); and luciferase 3, 5′-TCCATCTTCCAGGGATACGA-3′ and 5′-CATAGGTCCTCTGACACATAA-3′ (+992 to +1188 bp, annealed at 60 °C).DNA Affinity Protein Assay (DAPA)—DNAs containing serial deletions of MIEP fragments were PCR-amplified from pMIEP–733/+2 with biotinylated primers and extracted by PCR purification kit (Qiagen). Purified DNAs were incubated with streptavidin beads (Sigma) in the DAPA buffer (20 mm HEPES-KOH, pH 8.0, 10% glycerol, 100 mm KCl, 1 mm MgCl2, 0.2 mm EDTA, 0.1% Nonidet P-40) and extensively washed with DAPA buffer. To prepare lysates for determining the association of the endogenous p150 on MIEP, H1299 cells cultured on 500-cm2 dishes with 80% confluence were trypsinized and lysed in a 4-fold pellet volume of high salt lysis buffer (50 mm Tris, pH 8.0, 250 mm NaCl, 0.5% Triton X-100) with mild vortexing at 4 °C for 1 h. After that, the lysates were centrifuged at 16,000 × g for 15 min, and the supernatants were then aliquoted at the concentration of 10 mg/ml and stored at –80 °C. 1 mg of lysate was incubated with the DNA-bead complex in 900 μl of DAPA buffer and rotated at 4 °C overnight. The pulled down proteins were washed three times with DAPA buffer containing 200 mm KCl and separated with 10% SDS-PAGE, followed by Western analysis. To map the MIEP binding domain of p150, the indicated p150 mutants were translated in vitro in the presence of [35S]methionine by the TnT® Quick Coupled Transcription/Translation System (Promega). The 35S-labeled proteins were incubated with streptavidin bead-DNA complex overnight and then washed with DAPA buffer three times. Pulled down proteins were analyzed by SDS-PAGE and subjected to autoradiography. 10% of the lysate was loaded as input control.Electrophoretic Mobility Shift Assay (EMSA)—The recombinant p150 fragments expressed in BL21 Star (DE3) One Shot Chemically Competent E. coli (Invitrogen) were purified using Ni-Sepharose™ 6 Fast Flow (GE Healthcare) according to the procedure described in QIAexpress Detection and Assay Handbook (Qiagen). For probe labeling, the PCR-amplified MIEP fragments were purified and end-labeled with [γ-32P]ATP (6,000 Ci/mmol at 10 mCi/ml; NEG502Z, PerkinElmer Life Sciences) by T4 polynucleotide kinase (New England Biolabs) at 37 °C for 30 min, followed by the purification using G-25 column (GE Healthcare). DNA binding reactions were set up in 30 μl of binding buffer (20 mm HEPES, pH 7.9, 8% glycerol, 0.5 mm EDTA, 100 mm KCl, 0.5 mm dithiothreitol, and 0.5 mm phenylmethylsulfonyl fluoride) containing 32P-labeled MIEP DNA fragments and various E. coli-expressing recombinant proteins. After incubation on ice for 20 min, reaction mixtures were separated by 4 or 6% native acrylamide gels in 0.5× TBE containing 5% glycerol and subjected to autoradiography. For antibody supershift assays, the anti-Xpress antibody (Invitrogen), which recognizes the epitope fused to the E. coli-expressing proteins, was added into the reactions before gel electrophoresis.Antibodies—The primary antibodies used in Western blots are as follows: rabbit anti-p150N antibody (H-300; Figs. 2B and 5F and supplemental Fig. S1), mouse anti-VP16 antibody (1Kaufman P.D. Kobayashi R. Kessler N. Stillman B. Cell. 1995; 81: 1105-1114Abstract Full Text PDF PubMed Scopus (307) Google Scholar, 2Takami Y. Ono T. Fukagawa T. Shibahara K. Nakayama T. Mol. Biol. Cell. 2007; 18: 129-141Crossref PubMed Scopus (68) Google Scholar, 3Nabatiyan A. Krude T. Mol. Cell. Biol. 2004; 24: 2853-2862Crossref PubMed Scopus (94) Google Scholar, 4Hoek M. Stillman B. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 12183-12188Crossref PubMed Scopus (189) Google Scholar, 5Shibahara K. Stillman B. Cell. 1999; 96: 575-585Abstract Full Text Full Text PDF PubMed Scopus (535) Google Scholar, 6Moggs J.G. Grandi P. Quivy J.P. Jonsson Z.O. Hubscher U. Becker P.B. Almouzni G. Mol. Cell. Biol. 2000; 20: 1206-1218Crossref PubMed Scopus (253) Google Scholar, 7Verreault A. Kaufman P.D. Kobayashi R. Stillman B. Cell. 1996; 87: 95-104Abstract Full Text Full Text PDF PubMed Scopus (521) Google Scholar, 8Rogers S. Wells R. Rechsteiner M. Science. 1986; 234: 364-368Crossref PubMed Scopus (1946) Google Scholar, 9Belizario J.E. Alves J. Garay-Malpartida M. Occhiucci J.M. Curr. Protein Pept. Sci. 2008; 9: 210-220Crossref PubMed Scopus (46) Google Scholar, 10Enomoto S. Berman J. Genes Dev. 1998; 12: 219-232Crossref PubMed Scopus (169) Google Scholar, 11Monson E.K. de Bruin D. Zakian V.A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 13081-13086Crossref PubMed Scopus (113) Google Scholar, 12Huang S. Zhou H. Tarara J. Zhang Z. EMBO J. 2007; 26: 2274-2283Crossref PubMed Scopus (62) Google Scholar, 13Ramirez-Parra E. Gutierrez C. Trends Plant Sci. 2007; 12: 570-576Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 14Quivy J.P. Roche D. Kirschner D. Tagami H. Nakatani Y. Almouzni G. EMBO J. 2004; 23: 3516-3526Crossref PubMed Scopus (148) Google Scholar, 15Zabaronick S.R. Tyler J.K. Mol. Cell. Biol. 2005; 25: 652-660Crossref PubMed Scopus (45) Google Scholar, 16Schonrock N. Exner V. Probst A. Gruissem W. Hennig L. J. Biol. Chem. 2006; 281: 9560-9568Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 17Kitagawa H. Fujiki R. Yoshimura K. Mezaki Y. Uematsu Y. Matsui D. Ogawa S. Unno K. Okubo M. Tokita A. Nakagawa T. Ito T. Ishimi Y. Nagasawa H. Matsumoto T. Yanagisawa J. Kato S. Cell. 2003; 113: 905-917Abstract Full Text PDF PubMed Scopus (240) Google Scholar, 18Marheineke K. Krude T. J. Biol. Chem. 1998; 273: 15279-15286Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 19Quivy J.P. Gerard A. Cook A.J. Roche D. Almouzni G. Nat. Struct. Mol. Biol. 2008; 15: 972-979Crossref PubMed Scopus (112) Google Scholar, 20Murzina N. Verreault A. Laue E. Stillman B. Mol. Cell. 1999; 4: 529-540Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 21Reese B.E. Bachman K.E. Baylin S.B. Rountree M.R. Mol. Cell. Biol. 2003; 23: 3226-3236Crossref PubMed Scopus (83) Google Scholar; Fig. 5F), mouse anti-GalDBD antibody (RK5C1; Fig. 5F), and mouse anti-PCNA antibody (PC10; Fig. 2B) (all from Santa Cruz Biotechnology); mouse anti-cytomegalovirus antibody against immediate early proteins of cytomegalovirus (MAB810; Fig. 2B), mouse anti-β-tubulin antibody (MAB3408; Figs. 1C, 2A, and 4A and supplemental Fig. S1), mouse anti-actin antibody (MAB1501; Figs. 1B, 2B, 3, A and B, 4E, and 5, D and E) (all from Millipore); mouse anti-HA antibody (12CA5, Roche Applied Science; Fig. 4A and supplemental Fig. S1; 16B12, Covance; Figs. 1A, 2A, and 4E); mouse anti-V5 antibody (R960-25, Invitrogen; Figs. 1, B and C, 3C, and 5, D and E); mouse anti-p150 antibody (ab7655; Figs. 3A and 4F), and mouse anti-p60 antibody (ab8133; Fig. 1B) (both from Abcam). The primary antibodies used in ChIP are as follows: rabbit anti-RNA polymerase II antibody (sc-585; Fig. 3B), rabbit anti-p150N antibody (H-300; Fig. 4C) (both from Santa Cruz Biotechnology); mouse anti-HA antibody (16B12, Covance; Fig. 4B); rabbit anti-acetylated H3 antibody (06599) and rabbit anti-acetylated H4 antibody (06866) (Fig. 6) (both from Upstate).FIGURE 5Characterization of the DNA binding domain of p150. A, KER domain (residues 311–445) is critical for p150 binding to MIEP. In vitro DAPA experiments similar to Fig. 4D were performed except that the MIEP oligo on beads was incubated with various in vitro translated, 35S-labeled p150 fragments. The GFP sequence and two nuclear localization sequences (NLS) from SV40 large T protein (GFP/2LTNLS) were fused to the KER domain (GFP/KER) or ED domain (GFP-(505–641)). Main panel, schematic diagram of the p150 deletion mutants. Right panel, autoradiography results. PEST, domain enriched in proline (P), glutamic acid (E), serine (S), and threonine (T); KER, domain enriched in lysine (K), glutamic acid (E), and arginine (R); ED, domain enriched in glutamic acid (E) and aspartic acid (D). B, E. coli-expressing KER domain binds to MIEP region from –733 to –537 bp. The E. coli-expressing His-Xpress-fused aa 311–445 (X-KER, lanes 3 and 4) or 1–296 (X-(1–296), lanes 2 and 5) of p150 was incubated with the 32P-labeled MIEP DNA fragments from –733 to –537 bp, followed by EMSA. The anti-Xpress antibody was used for super-shifting the DNA-protein complex. The reaction mixtures were separated on a 4% native acrylamide gel that was then subjected to autoradiography. C, MIEP region from –593 to –574 bp is required for KER binding to MIEP in vitro. The EMSA experiment similar to B was performed except that 32P-labeled MIEP DNA fragment from –593 to –537 bp (lanes 1, 2, and 5) or –573 to –537 bp (lanes 3, 4, and 6) was used, and the reaction mixtures were separated on a 6% native acrylamide gel. D, overexpression of KER suppresses the MIEP activity in cells. H1299 cells were transfected with pMIEP–733/+2 together with vector or the plasmid encoding two NLS sequence-fused aa 311–445 (2NLS-KER-V5, lane 2), 445–564 (2NLS-445–564-V5), or 505–641 (2NLS-505–641-V5) of p150. Cell lysates were harvested 24 h post-transfection and analyzed for luciferase activity (upper panel) and protein expression (lower panel). E, KER domain is required to guide the activation domain of Gal4 protein (GalAD) to act on MIEP. H1299 cells were transfected with pMIEP–733/+2 together with vector or the plasmid encoding the GalAD fused to the p150 fragment from aa 311–938 (lane 2) or 505–938 (lane 3) and analyzed for luciferase activity (upper panel) and protein expression (lower panel). F, KER alone directs the activation domain of VP16 protein (VP16AD) to act on MIEP. H1299 cells were transfected with pMIEP–733/+2 and the Renilla reporter driven by SV40 promoter, together with vector or the plasmid encoding the full-length p150-V5 (lane 2), the VP16AD fused to KER (VP16AD-KER, lane 3), or VP16AD fused to the DNA binding domain of Gal4 protein (GalDBD-VP16AD, lane 4) and analyzed for luciferase activity (upper panel) and protein expression (lower panel).View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 1p150 specifically activates the MIEP promoter. A, p150, but not p150C or p60, stimulates the MIEP-driven luciferase activity. H1299 cells were transfected with plasmid encoding the firefly luciferase gene driven by the HCMV major IE promoter (pMIEP–733/+2) with vector alone (lanes 1 and 5) or with plasmid encoding the indicated protein (lanes 2–4 and 6–8). Cell lysates were harvested 24 h post-transfection and analyzed for luciferase activity (upper panel) and protein expression (lower panel). The nonspecific protein in the Western blot was used as a loading control. B, knocking down p60 does not affect the p150-mediated MIEP activation. H1299 cells treated with oligo of the scrambled sequence (control) or the small interfering RNA oligo targeting to the p60 gene (si-p60) were transfected with pMIEP–733/+2 together with vector (lanes 1 and 3) or plasmid encoding the C-terminally V5-tagged p150 (p150-V5, lanes 2 and 4). The cell lysates were then collected for luciferase activity assays (upper panel) and Western analysis (lower panel). C, activities of PCNA, p16, or SV40 promoters are not affected by p150. H1299 cells were transfected with vector (white bar) or plasmid encoding p150-V5 (black bar) together with the luciferase reporter gene driven by HCMV major IE (pMIEP–733/+2, lanes 1 and 2), PCNA (lanes 3 and 4), or p16 (lanes 5 and 6) promoter, or the Renilla reporter gene driven by SV40 promoter (lanes 7 and 8) and analyzed for luciferase activity (upper panel) and protein expression (lower panel).View Large Image" @default.
• W1968865001 created "2016-06-24" @default.
• W1968865001 creator A5024889020 @default.
• W1968865001 creator A5024954066 @default.
• W1968865001 creator A5065009352 @default.
• W1968865001 creator A5085232048 @default.
• W1968865001 date "2009-05-01" @default.
• W1968865001 modified "2023-09-27" @default.
• W1968865001 title "Gene-specific Transcriptional Activation Mediated by the p150 Subunit of the Chromatin Assembly Factor 1" @default.
• W1968865001 cites W1964541915 @default.
• W1968865001 cites W1964716733 @default.
• W1968865001 cites W1965850475 @default.
• W1968865001 cites W1979187818 @default.
• W1968865001 cites W1984828027 @default.
• W1968865001 cites W1990726449 @default.
• W1968865001 cites W1992763575 @default.
• W1968865001 cites W1997589266 @default.
• W1968865001 cites W2006591674 @default.
• W1968865001 cites W2007884336 @default.
• W1968865001 cites W2010601153 @default.
• W1968865001 cites W2014996014 @default.
• W1968865001 cites W2019061085 @default.
• W1968865001 cites W2024023212 @default.
• W1968865001 cites W2044941418 @default.
• W1968865001 cites W2050691074 @default.
• W1968865001 cites W2052540561 @default.
• W1968865001 cites W2068666227 @default.
• W1968865001 cites W2069378046 @default.
• W1968865001 cites W2069681995 @default.
• W1968865001 cites W2080791829 @default.
• W1968865001 cites W2095352111 @default.
• W1968865001 cites W2108116072 @default.
• W1968865001 cites W2110008842 @default.
• W1968865001 cites W2122062914 @default.
• W1968865001 cites W2122256266 @default.
• W1968865001 cites W2142250724 @default.
• W1968865001 cites W2150721910 @default.
• W1968865001 cites W2157190630 @default.
• W1968865001 cites W2160333545 @default.
• W1968865001 cites W2160461365 @default.
• W1968865001 cites W2163184765 @default.
• W1968865001 doi "https://doi.org/10.1074/jbc.m901833200" @default.
• W1968865001 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2682852" @default.
• W1968865001 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19324875" @default.
• W1968865001 hasPublicationYear "2009" @default.
• W1968865001 type Work @default.
• W1968865001 sameAs 1968865001 @default.
• W1968865001 citedByCount "9" @default.
• W1968865001 countsByYear W19688650012014 @default.
• W1968865001 countsByYear W19688650012015 @default.
• W1968865001 countsByYear W19688650012017 @default.
• W1968865001 countsByYear W19688650012019 @default.
• W1968865001 crossrefType "journal-article" @default.
• W1968865001 hasAuthorship W1968865001A5024889020 @default.
• W1968865001 hasAuthorship W1968865001A5024954066 @default.
• W1968865001 hasAuthorship W1968865001A5065009352 @default.
• W1968865001 hasAuthorship W1968865001A5085232048 @default.
• W1968865001 hasBestOaLocation W19688650012 @default.
• W1968865001 hasConcept C104292427 @default.
• W1968865001 hasConcept C104317684 @default.
• W1968865001 hasConcept C153911025 @default.
• W1968865001 hasConcept C167227067 @default.
• W1968865001 hasConcept C185592680 @default.
• W1968865001 hasConcept C54355233 @default.
• W1968865001 hasConcept C67258246 @default.
• W1968865001 hasConcept C83640560 @default.
• W1968865001 hasConcept C86339819 @default.
• W1968865001 hasConcept C86803240 @default.
• W1968865001 hasConcept C95444343 @default.
• W1968865001 hasConceptScore W1968865001C104292427 @default.
• W1968865001 hasConceptScore W1968865001C104317684 @default.
• W1968865001 hasConceptScore W1968865001C153911025 @default.
• W1968865001 hasConceptScore W1968865001C167227067 @default.
• W1968865001 hasConceptScore W1968865001C185592680 @default.
• W1968865001 hasConceptScore W1968865001C54355233 @default.
• W1968865001 hasConceptScore W1968865001C67258246 @default.
• W1968865001 hasConceptScore W1968865001C83640560 @default.
• W1968865001 hasConceptScore W1968865001C86339819 @default.
• W1968865001 hasConceptScore W1968865001C86803240 @default.
• W1968865001 hasConceptScore W1968865001C95444343 @default.
• W1968865001 hasIssue "21" @default.
• W1968865001 hasLocation W19688650011 @default.
• W1968865001 hasLocation W19688650012 @default.
• W1968865001 hasLocation W19688650013 @default.
• W1968865001 hasLocation W19688650014 @default.
• W1968865001 hasOpenAccess W1968865001 @default.
• W1968865001 hasPrimaryLocation W19688650011 @default.
• W1968865001 hasRelatedWork W1989493465 @default.
• W1968865001 hasRelatedWork W1998000745 @default.
• W1968865001 hasRelatedWork W2187435303 @default.
• W1968865001 hasRelatedWork W2216103240 @default.
• W1968865001 hasRelatedWork W2340754003 @default.
• W1968865001 hasRelatedWork W2582038667 @default.
• W1968865001 hasRelatedWork W3119883962 @default.
• W1968865001 hasRelatedWork W4312032010 @default.
• W1968865001 hasRelatedWork W4327860934 @default.
• W1968865001 hasRelatedWork W8528407 @default.
• W1968865001 hasVolume "284" @default.

• next