FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1969726589> ?p ?o ?g. }

• W1969726589 endingPage "33502" @default.
• W1969726589 startingPage "33492" @default.
• W1969726589 abstract "We have previously demonstrated that the Src family kinase Yes, the Yes-associated protein (YAP) and TEA domain TEAD2 transcription factor pathway are activated by leukemia inhibitory factor (LIF) and contribute to mouse embryonic stem (mES) cell maintenance of pluripotency and self-renewal. In addition, we have shown that fetal bovine serum (FBS) induces Yes auto-phosphorylation and activation. In the present study we confirm that serum also activates TEAD-dependent transcription in a time- and dose-dependent manner and we identify Inter-α-inhibitor (IαI) as a component in serum capable of activating the Yes/YAP/TEAD pathway by inducing Yes auto-phosphorylation, YAP nuclear localization and TEAD-dependent transcription. The cleaved heavy chain 2 (HC2) sub-component of IαI, is demonstrated to be responsible for this effect. Moreover, IαI is also shown to efficiently increase expression of TEAD-downstream target genes including well-known stem cell factors Nanog and Oct 3/4. IαI is not produced by the ES cells per se but is added to the cells via the cell culture medium containing serum or serum-derived components such as bovine serum albumin (BSA). In conclusion, we describe a novel function of IαI in activating key pluripotency pathways associated with ES cell maintenance and self-renewal. We have previously demonstrated that the Src family kinase Yes, the Yes-associated protein (YAP) and TEA domain TEAD2 transcription factor pathway are activated by leukemia inhibitory factor (LIF) and contribute to mouse embryonic stem (mES) cell maintenance of pluripotency and self-renewal. In addition, we have shown that fetal bovine serum (FBS) induces Yes auto-phosphorylation and activation. In the present study we confirm that serum also activates TEAD-dependent transcription in a time- and dose-dependent manner and we identify Inter-α-inhibitor (IαI) as a component in serum capable of activating the Yes/YAP/TEAD pathway by inducing Yes auto-phosphorylation, YAP nuclear localization and TEAD-dependent transcription. The cleaved heavy chain 2 (HC2) sub-component of IαI, is demonstrated to be responsible for this effect. Moreover, IαI is also shown to efficiently increase expression of TEAD-downstream target genes including well-known stem cell factors Nanog and Oct 3/4. IαI is not produced by the ES cells per se but is added to the cells via the cell culture medium containing serum or serum-derived components such as bovine serum albumin (BSA). In conclusion, we describe a novel function of IαI in activating key pluripotency pathways associated with ES cell maintenance and self-renewal. Pluripotent stem (PS) 2The abbreviations used are: PSpluripotent stemYAPYes-associated proteinLIFleukemia inhibitory factorESembryonic stemiPSinduced PSIαIinter-α-inhibitorECMextracellular matrixHCheavy chain. cells, i.e. embryonic stem (ES) cells and induced pluripotent stem (iPS) cells, can self-renew indefinitely in culture while retaining the potential to differentiate into any cell type in an organism. To successfully maintain pluripotency and self-renewal, PS cells depend on different signals: Mouse PS (mPS) cells respond to the cytokine leukemia inhibitory factor (LIF) and either serum or bone morphogenic proteins (BMPs) (reviewed in Ref. 1Chambers I. Smith A. Self-renewal of teratocarcinoma and embryonic stem cells.Oncogene. 2004; 23: 7150-7160Crossref PubMed Scopus (446) Google Scholar), while human PS (hPS) cells need fibroblast growth factor (FGF) and transforming growth factor (TGF-β, Activin A) (2Xiao L. Yuan X. Sharkis S.J. Activin A maintains self-renewal and regulates fibroblast growth factor, Wnt, and bone morphogenic protein pathways in human embryonic stem cells.Stem Cells. 2006; 24: 1476-1486Crossref PubMed Scopus (284) Google Scholar, 3Vallier L. Alexander M. Pedersen R.A. Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells.J. Cell Sci. 2005; 118: 4495-4509Crossref PubMed Scopus (755) Google Scholar). The extracellular matrix has also been proven to be important for PS cells, in particular hPS cells, which depend on either feeder cells or extracellular matrix-derived coating for attachment and subsequent survival in culture. The extracellular environment has been linked to both maintenance and directed differentiation (4Miyazaki T. Futaki S. Suemori H. Taniguchi Y. Yamada M. Kawasaki M. Hayashi M. Kumagai H. Nakatsuji N. Sekiguchi K. Kawase E. Laminin E8 fragments support efficient adhesion and expansion of dissociated human pluripotent stem cells.Nature Commun. 2012; 3: 1236Crossref PubMed Scopus (254) Google Scholar, 5Braam S.R. Zeinstra L. Litjens S. Ward-van Oostwaard D. van den Brink S. van Laake L. Lebrin F. Kats P. Hochstenbach R. Passier R. Sonnenberg A. Mummery C.L. Recombinant vitronectin is a functionally defined substrate that supports human embryonic stem cell self-renewal via αvβ5 integrin.Stem Cells. 2008; 26: 2257-2265Crossref PubMed Scopus (337) Google Scholar, 6Melkoumian Z. Weber J.L. Weber D.M. Fadeev A.G. Zhou Y. Dolley-Sonneville P. Yang J. Qiu L. Priest C.A. Shogbon C. Martin A.W. Nelson J. West P. Beltzer J.P. Pal S. Brandenberger R. Synthetic peptide-acrylate surfaces for long-term self-renewal and cardiomyocyte differentiation of human embryonic stem cells.Nature Biotechnology. 2010; 28: 606-610Crossref PubMed Scopus (358) Google Scholar, 7Ilic D. Culture of human embryonic stem cells and the extracellular matrix microenvironment.Regenerative Med. 2006; 1: 95-101Crossref PubMed Scopus (22) Google Scholar, 8Stojkovic P. Lako M. Przyborski S. Stewart R. Armstrong L. Evans J. Zhang X. Stojkovic M. Human-serum matrix supports undifferentiated growth of human embryonic stem cells.Stem Cells. 2005; 23: 895-902Crossref PubMed Scopus (106) Google Scholar). pluripotent stem Yes-associated protein leukemia inhibitory factor embryonic stem induced PS inter-α-inhibitor extracellular matrix heavy chain. LIF has been described to activate several intracellular pathways in mES cells, namely the JAK/STAT3, MAPK, PI3K, and Src-family pathways (reviewed in Ref. 9Annerén C. Tyrosine kinase signalling in embryonic stem cells.Clin. Sci. 2008; 115: 43-55Crossref Scopus (28) Google Scholar). Downstream of these pathways an intricate transcriptional network decides the stem cell fate. Some of these transcriptional factors have been designated as stem-cell markers, e.g. Nanog, Oct3/4, Tfe3, Sox2, and Esrrb (10Betschinger J. Nichols J. Dietmann S. Corrin P.D. Paddison P.J. Smith A. Exit from pluripotency is gated by intracellular redistribution of the bHLH transcription factor Tfe3.Cell. 2013; 153: 335-347Abstract Full Text Full Text PDF PubMed Scopus (238) Google Scholar). In addition, the YAP-TEAD transcription factor complex has been reported to be important for mES cell self-renewal and maintenance of pluripotency (11Tamm C. Bower N. Annerén C. Regulation of mouse embryonic stem cell self-renewal by a Yes-YAP-TEAD2 signaling pathway downstream of LIF.J. Cell Sci. 2011; 124: 1136-1144Crossref PubMed Scopus (169) Google Scholar, 12Lian I. Kim J. Okazawa H. Zhao J. Zhao B. Yu J. Chinnaiyan A. Israel M.A. Goldstein L.S. Abujarour R. Ding S. Guan K.L. The role of YAP transcription coactivator in regulating stem cell self-renewal and differentiation.Genes Dev. 2010; 24: 1106-1118Crossref PubMed Scopus (549) Google Scholar). We have shown that LIF signaling through the LIF-receptor activates Yes, which in turn induces nuclear translocation of YAP. Nuclear YAP forms a complex with members of the TEAD transcription factor family (11Tamm C. Bower N. Annerén C. Regulation of mouse embryonic stem cell self-renewal by a Yes-YAP-TEAD2 signaling pathway downstream of LIF.J. Cell Sci. 2011; 124: 1136-1144Crossref PubMed Scopus (169) Google Scholar, 13Annerén C. Cowan C.A. Melton D.A. The Src family of tyrosine kinases is important for embryonic stem cell self-renewal.J. Biol. Chem. 2004; 279: 31590-31598Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 14Vassilev A. Kaneko K.J. Shu H. Zhao Y. DePamphilis M.L. TEAD/TEF transcription factors utilize the activation domain of YAP65, a Src/Yes-associated protein localized in the cytoplasm.Genes Dev. 2001; 15: 1229-1241Crossref PubMed Scopus (538) Google Scholar). Yes, YAP, and TEAD2 are highly expressed in self-renewing mES cells and are down-regulated when cells are induced to differentiate. In addition, the Yes kinase has been shown to suppress differentiation and block embryoid body maturation when overexpressed in mES cells (15Zhang X. Meyn 3rd, M.A. Smithgall T.E. c-Yes tyrosine kinase is a potent suppressor of ES cell differentiation and antagonizes the actions of its closest phylogenetic relative, c-Src.ACS chemical biology. 2014; 9: 139-146Crossref PubMed Scopus (16) Google Scholar). Moreover, TEAD2 can directly associate with the Oct3/4 promoter and activation of the Yes pathway induces, whereas suppression inhibits, Oct3/4 and Nanog promoter activities. In addition to LIF, we have previously demonstrated that Yes can be activated by fetal bovine serum (FBS) but the specific factor(s) in serum responsible for this effect was not identified (13Annerén C. Cowan C.A. Melton D.A. The Src family of tyrosine kinases is important for embryonic stem cell self-renewal.J. Biol. Chem. 2004; 279: 31590-31598Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). In the present study, we have successfully isolated and identified Inter-α-inhibitor (IαI) as one of the components in serum capable of activating the Yes-YAP-TEAD pathway in mES cells. The IαI protein family is a group of protein-glycosaminoglycan-protein complexes that are present in plasma at high concentrations ranging from 0.6 to 1.2 mg/ml in humans (16Josic D. Brown M.K. Huang F. Lim Y.P. Rucevic M. Clifton J.G. Hixson D.C. Proteomic characterization of inter-α inhibitor proteins from human plasma.Proteomics. 2006; 6: 2874-2885Crossref PubMed Scopus (45) Google Scholar). They consist of alternate combinations of heavy chains (HC1-HC5) and a light chain called bikunin linked together by a chondroitin 4-sulfate chain, or as unassembled proteins. IαI is the most abundant family member in human serum and consists of the HC1, HC2, and Bk domains. It is mainly produced by the liver and is considered to be inactive until it reaches the target tissue where it is cleaved by TNF-stimulated gene 6 protein (TSG-6), which in turn forms a transient covalent bond with the HCs and transfers them to hyaluronan (HA), a major constituent of the extracellular matrix (ECM) (17Jessen T.E. Ødum L. Role of tumour necrosis factor stimulated gene 6 (TSG-6) in the coupling of inter-α-trypsin inhibitor to hyaluronan in human follicular fluid.Reproduction. 2003; 125: 27-31Crossref PubMed Scopus (50) Google Scholar). Up until recently all medium for culturing mouse and human PS cells have included serum or derivatives thereof, such as Knock-Out Serum Replacement (KOSR) or bovine serum albumin (BSA), and thereby also contain IαI proteins. We here show that IαI purified from human plasma, as well as cleaved HC2, but not HC1, activate the Yes/YAP/TEAD2 pathway and induce expression of the pluripotent stem cell transcription factors Nanog and TEAD target genes Oct3/4, Cyr61, and CTGF. Cell lines: Feeder-independent E14 and E14/T (constitutively expressing polyoma large T) mES cells, H181 human ES (hES) cells, K02C human iPS (hiPS) cells, mouse embryonic fibroblasts (MEFs) generated by the Uppsala University Transgenic Facility (Uppsala University), human feeder cell line from human foreskin fibroblasts (HFFs) purchased from ATCC (ATCC-CRL-2429), human kidney cell line (HEKBlue) and human liver tumor cell line (HepG2). Primary antibodies: anti-HC2 (H-90) sc-99107 (Santa Cruz Biotechnology), anti-Oct3/4 (POUF5F1, cl. 7F9.2 (Millipore), anti-YAP #4912 (Cell Signaling), anti-YAP sc-101199 (Santa Cruz Biotechnology), anti-β actin ab8229 (Abcam), anti-Yes 610376 (BD Biosciences), anti-Phospho-Src family (Tyr-416) #2101S (Cell Signaling), anti-P-Ser127-YAP #13008 (Cell Signaling), anti-P-Tyr357-YAP ab62751 (Abcam), and anti-P-Tyr100 #9411 (Cell Signaling). Secondary antibodies: Alexa Fluor 555 goat anti-rabbit (Invitrogen), Alexa Fluor 488 goat anti-mouse (Invitrogen), Alexa Fluor goat anti-rabbit 680 (Millipore), and IRDye 800CW goat anti-mouse (LI-COR Biosciences). Other reagents: Hoechst 33342 (Invitrogen), Odyssey blocking buffer (LI-COR Biosciences), SsoFast EvaGreen Supermix (Bio-Rad), Corning Matrigel hES-qualified (Corning), gelatin 2% (Sigma), protease inhibitory mixture (PIC, Sigma), sodium orthovanadate (Na3VO4, Sigma), PD0325901 inhibitor and CHIR99021 inhibitor (both from Selleckchem), LIF (Millipore). Luciferase and β-gal assay reagents: d-Luciferin (Biothema), 2-nitrophenil β-d-galactopyranoside (Sigma), and adenosine triphosphate (Sigma). The E14 and E14/T mES cell lines were cultured on 0,1% gelatin in 10% serum in the absence of feeder cells as previously described (18Smith A. Culture and differentiation of embryonic stem cells.Methods in Cell Science. 1991; 13: 89-94Google Scholar). Unless stated otherwise, mES cells were plated and grown overnight at 37 °C and 5% CO2 until 70–80% confluence and then serum-starved for 4–24 h in minimal GMEM-based medium (serum-free medium, here-in called “No FBS”) before treatment with different factors. The mES cells were also cultured in 2i medium (19Ying Q.L. Wray J. Nichols J. Batlle-Morera L. Doble B. Woodgett J. Cohen P. Smith A. The ground state of embryonic stem cell self-renewal.Nature. 2008; 453: 519-523Crossref PubMed Scopus (2543) Google Scholar), a serum-free N2B27 medium supplemented with the MEK inhibitor PD0325901 (1 μm) and GSK3 inhibitor CHIR99021 (3 μm), and 1,000 units/ml LIF as described in Ref. 20Li P. Tong C. Mehrian-Shai R. Jia L. Wu N. Yan Y. Maxson R.E. Schulze E.N. Song H. Hsieh C.L. Pera M.F. Ying Q.L. Germline competent embryonic stem cells derived from rat blastocysts.Cell. 2008; 135: 1299-1310Abstract Full Text Full Text PDF PubMed Scopus (536) Google Scholar. The hES cell line H181 and the hiPS cell line K02C were cultured on Matrigel coating (Corning) in mTESR-1 medium (StemCell Technologies) (21Ludwig T.E. Bergendahl V. Levenstein M.E. Yu J. Probasco M.D. Thomson J.A. Feeder-independent culture of human embryonic stem cells.Nature Methods. 2006; 3: 637-646Crossref PubMed Scopus (508) Google Scholar). Mouse embryonic fibroblasts (MEFs), human foreskin fibroblasts (HFFs), human kidney cells HEKBlue, and human liver carcinoma cell line HepG2 were expanded in ATCC-formulated Iscove's Modified Dulbecco's medium supplemented with 10% FBS. FBS was treated with a mild acetonitrile (ACN) precipitation to separate smaller proteins from its carriers as previously described (22Lei T. He Q.Y. Wang Y.L. Si L.S. Chiu J.F. Heparin chromatography to deplete high-abundance proteins for serum proteomics.Clin. Chim. Acta. 2008; 388: 173-178Crossref PubMed Scopus (33) Google Scholar). The supernatant was diluted into 2 m ammonium sulfate containing binding buffer for a modified Blue-Sepharose chromatography, described previously (23Arakawa T. Tsumoto K. Ejima D. Kita Y. Yonezawa Y. Tokunaga M. Induced binding of proteins by ammonium sulfate in affinity and ion-exchange column chromatography.J. Biochem. Biophys. Methods. 2007; 70: 493-498Crossref PubMed Scopus (18) Google Scholar) and eluted using 2 m NaCl (Eluate 1) and 1 m arginine (Eluate 2). The eluted fractions were concentrated and dialyzed against phosphate-buffered saline (PBS) using Vivaspin 6 columns (GE Healthcare) and then tested for induction of TEAD activity using luciferase assay (described below). Eluate 1 was further purified using Heparin-Sepharose 6 Fast Flow (GE Healthcare) and eluted stepwise with an NaCl gradient. The eluted fractions were again dialyzed against PBS and tested for their ability to induce TEAD-dependent transcription. The isolation of IαI and the heavy chains HC1 and HC2 was performed as described previously (24Blom A.M. Mörgelin M. Oyen M. Jarvet J. Fries E. Structural characterization of inter-α-inhibitor. Evidence for an extended shape.J. Biol. Chem. 1999; 274: 298-304Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Briefly, a side fraction from the commercial production of factor IX (Pharmacia-Upjohn, Stockholm, Sweden) was subjected to gel filtration on a HiPrep 26/60 Sephacryl S-400 HR column using the ÄKTA system (both from GE Healthcare), generating more than 95% pure IαI. For the release of the heavy chains, 2 m NaOH treatment followed by anion exchange chromatography (MonoQ 5/50 GL; GE Healthcare) was performed as described before (25Enghild J.J. Thøgersen I.B. Pizzo S.V. Salvesen G. Analysis of inter-α-trypsin inhibitor and a novel trypsin inhibitor, pre-α-trypsin inhibitor, from human plasma. Polypeptide chain stoichiometry and assembly by glycan.J. Biol. Chem. 1989; 264: 15975-15981Abstract Full Text PDF PubMed Google Scholar). The fractions were run on an 8% acrylamide SDS-PAGE gel and stained with Coomassie Brilliant Blue followed by mass spectrometry analysis (MS-MALDI-TOF) for assessment of purity. Unless specified differently, protein concentrations were determined by UV measurements and the absorbance coefficients for the protein moieties of IαI, HC1, and HC2 were obtained from Bloom et al. (24Blom A.M. Mörgelin M. Oyen M. Jarvet J. Fries E. Structural characterization of inter-α-inhibitor. Evidence for an extended shape.J. Biol. Chem. 1999; 274: 298-304Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). The protein solutions were concentrated and dialyzed against PBS on Vivaspin 20 columns and stored at −20 °C. Protein samples from the purification were loaded on 8% acrylamide gels. The gels were subsequently stained with Coomassie Blue staining and the selected bands were excised and subjected to MS-MALDI TOF analysis (Mass Spectrometry platform, Uppsala University). Luciferase expression constructs (final concentration 1–2 μg DNA/cm2) were introduced into mES cells by transfection with Lipofectamine 2000 (LP2000, Invitrogen) according to the manufacturer's recommendations. Briefly, cells were incubated in Opti-MEM (Invitrogen), plasmids and LP2000 mixture at 37 °C for 4 h. The transfection was stopped with 10:1 V/V of serum-free medium. The constructs used were pCS GT-IIC-luciferase (GTIIC) (26Jiang S.W. Eberhardt N.L. Involvement of a protein distinct from transcription enhancer factor-1 (TEF-1) in mediating human chorionic somatomammotropin gene enhancer function through the GT-IIC enhanson in choriocarcinoma and COS cells.J. Biol. Chem. 1995; 270: 13906-13915Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar), pPyCAGIP Nanog, a pGL3-basic vector carrying the 1 kb upstream region of mouse Nanog (27Hattori N. Imao Y. Nishino K. Hattori N. Ohgane J. Yagi S. Tanaka S. Shiota K. Epigenetic regulation of Nanog gene in embryonic stem and trophoblast stem cells.Genes Cells. 2007; 12: 387-396Crossref PubMed Scopus (151) Google Scholar), and the pCMV β-gal reference plasmid containing a bacterial β-galactosidase gene. The cells were serum-starved for up to 18 h after transfection and exposed for 6 up to 18 h to the different factors. The different samples were assayed for luciferase and β-galactosidase activities in a microplate luminometer and photometer reader (Wallac VICTOR 1420 Multilabel Counter; Perkin Elmer). Cells were fixed with cold 4% paraformaldehyde (Sigma) for 15 min and then blocked with PBS 0.5% BSA and 0.3% Triton-X100 (Sigma). The cells were incubated at 4 °C overnight with primary antibodies anti-YAP (1:300) and anti-Oct3/4 (1:300), and subsequently incubated with Alexa Fluor secondary antibodies and co-stained with Hoechst (DAPI). Coverslips were mounted using fluoromount (Sigma), and analyzed with inverted confocal fluorescent microscopy (LSM700, Zeis). YAP nuclear localization was measured using ImageJ freeware (NIH). Shortly, DAPI staining was used to determine the limits of nuclear localization and Oct3/4 staining confirmed pluripotent stem cell colonies. Relative YAP nuclear staining was calculated by dividing YAP nuclear staining relative to area divided by cytoplasmic staining relative to area. Cells were incubated 15 min with 100 μm Na3VO4 and harvested in lysis buffer as previously described (13Annerén C. Cowan C.A. Melton D.A. The Src family of tyrosine kinases is important for embryonic stem cell self-renewal.J. Biol. Chem. 2004; 279: 31590-31598Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). The lysates were sonicated, and total protein concentration was measured using BCA Protein Assay kit (Pierce). 10 μg anti-Yes antibody (BD Biosciences) or anti-YAP antibody (Santa Cruz Biotechnology) were coupled to Protein A Dynabeads according to the manufacturer's recommendations using the Immunoprecipitation Dynabeads Protein A kit (Life Technologies) and then incubated end-over-end with 1 mg of protein extract overnight at 4 °C. The bound proteins were eluted in blotting loading buffer containing SDS and β-mercaptoethanol. Immunoprecipitated fractions and total lysates were run on 7.5% acrylamide gels under denaturing conditions, and the proteins were transferred to an Immobilon-FL membrane (Millipore). The membranes were blotted with anti-phospho-Src family (Tyr-416, 1:500), anti-phopsho tyrosine (P-Tyr100, 1:500), total YAP (1:250), βactin (1:5000), total Yes (1:1000), P-Ser127 YAP (1:1000), or P-Tyr357 YAP (1:500). The membranes were then incubated with Alexa Fluor anti-rabbit 680 (1:1000) and IRDye 800CW anti-mouse (1:1000). Immunosignals were imaged using an Odyssey fluorescent imaging scanner and band intensity quantification was analyzed using Odyssey 2.1 software (LI-COR Biosciences). Total RNA was extracted and purified with Qiagen RNeasy Mini kit (Qiagen) according to the manufacturer's instructions. The cDNA was reverse-transcribed from 1 μg of total RNA using iScript (Bio-Rad). First-strand cDNAs were amplified by Quantitative real-time PCR using the Miniopticon Real-Time PCR Detection System (Bio-Rad), SsoFast Evagreen Supermix and specific primers. The average Ct value for each gene was normalized against GAPDH or 18 S ribosomal RNA (18 S) gene expression and the comparative Ct value (fold change) was calculated using 2−ΔΔC(t). Transcript level comparison was based on primer efficiency estimated from five-point dilution curves and used for comparative Ct computation according to the PFAFFL method (28Pfaffl M.W. A new mathematical model for relative quantification in real-time RT-PCR.Nucleic Acids Res. 2001; 29: e45Crossref PubMed Scopus (25504) Google Scholar). For RT-PCR the first-strand cDNAs were amplified using the SsoFast Evagreen Supermix (Bio-Rad) and specific primers. The PCR products were electrophoresed on a 2% (w/v) agarose gel with GelRed (Biotum) staining, and photographed using the UVP BioImaging system (Bio-Rad). The PCR primers used are: mouse HC1 (forward: aggctgacgttcgggctcgt, reverse: ggcccagagcctctccacatga), mouse HC2 (forward: agtgatcttgtggaactggcccca, reverse: acagtgtccgtctcctctccgg), mouse TSG-6 (forward: cgtccacggctttgtaggaagatac, reverse: agcctccagccgtgacggat), mouse Oct3/4 (forward: gatgctgtgagcccaaggcaag, reverse: ggctcctgatcaacagcatcac), mouse Nanog (forward: ctttcacctattaaggtgcttgc, reverse: tggcat cggttcatcatggtac), mouse Cyr61 (forward: cagctc actgaagaggcttcct, reverse: gcgtgcagagggttgaaaa), mouse CTGF (forward: cttctgcgatttcggctcc, reverse: tacaccgacccaccgaaga), mouse 18 S (forward: agtccctgccctttgtacaca, reverse: gatccga- gggcctcactaaac), human HC1 (forward: gcctggtgttatcctgagcc, reverse: cggggttcagcgtaatgttc), human HC2 (forward: ctcacctaaagcccacggac, reverse: ggcttctcagggtcctttcc), human TSG-6 (forward: aagcacggtctggcaaatacaagc, reverse: atccatccagcagcacagacatga), human GAPDH (forward: gaaggtgaaggtcggagtc, reverse: gaagatggtgatgggatttc). Experiments were performed at least in three independent experiments, and data are presented as mean ± S.E. When applicable, statistical analysis was done using One-way ANOVA with Dunnett's test on GraphPad Prism version 5.00d for Mac (GraphPad Software, San Diego, CA), * = p < 0.05, ** = p < 0.001, and *** = p < 0.001. We have previously shown that FBS induces auto-phosphorylation activity of the Src-family member Yes (13Annerén C. Cowan C.A. Melton D.A. The Src family of tyrosine kinases is important for embryonic stem cell self-renewal.J. Biol. Chem. 2004; 279: 31590-31598Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). To determine whether FBS also activates TEAD-dependent transcription, mES cells were transfected with a reporter gene construct expressing the firefly luciferase gene driven by the human chorionic somatomammotropin (CS) promoter with multiple (24Blom A.M. Mörgelin M. Oyen M. Jarvet J. Fries E. Structural characterization of inter-α-inhibitor. Evidence for an extended shape.J. Biol. Chem. 1999; 274: 298-304Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) copies of the TEAD-binding GTIIC enhanson (pGTIIC-Luc), as previously described (11Tamm C. Bower N. Annerén C. Regulation of mouse embryonic stem cell self-renewal by a Yes-YAP-TEAD2 signaling pathway downstream of LIF.J. Cell Sci. 2011; 124: 1136-1144Crossref PubMed Scopus (169) Google Scholar). The TEAD-binding enhanson region binds all four TEAD family transcription factors (TEAD1-TEAD4) and therefore measures induction of TEAD family-dependent transcription (26Jiang S.W. Eberhardt N.L. Involvement of a protein distinct from transcription enhancer factor-1 (TEF-1) in mediating human chorionic somatomammotropin gene enhancer function through the GT-IIC enhanson in choriocarcinoma and COS cells.J. Biol. Chem. 1995; 270: 13906-13915Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). In a previous report, we demonstrated only minimal luciferase activity in mES cells transfected with the control luciferase construct containing only the CS promoter (11Tamm C. Bower N. Annerén C. Regulation of mouse embryonic stem cell self-renewal by a Yes-YAP-TEAD2 signaling pathway downstream of LIF.J. Cell Sci. 2011; 124: 1136-1144Crossref PubMed Scopus (169) Google Scholar). After transfection, the mES cells were serum and LIF-starved, stimulated with increasing concentrations of FBS and harvested at different time points. The TEAD-dependent luciferase expression was subsequently analyzed. Total protein values were used to normalize luciferase levels. As shown in Fig. 1, A and B, FBS significantly activates TEAD-dependent transcription in a dose and time-dependent manner. The highest TEAD activity was achieved with 5% FBS and for 6-h exposure time, and therefore all subsequent experiments to assess activation of TEAD-dependent transcription were performed using these conditions, unless stated otherwise. BMP4 can replace FBS in mES cell cultures (29Ying Q.L. Nichols J. Chambers I. Smith A. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3.Cell. 2003; 115: 281-292Abstract Full Text Full Text PDF PubMed Scopus (1715) Google Scholar). It has also been shown that YAP binds to SMAD1 in response to BMP signaling and contributes to mES cell maintenance of self-renewal and pluripotency by inducing Id gene transcription (30Varelas X. Sakuma R. Samavarchi-Tehrani P. Peerani R. Rao B.M. Dembowy J. Yaffe M.B. Zandstra P.W. Wrana J.L. TAZ controls Smad nucleocytoplasmic shuttling and regulates human embryonic stem-cell self-renewal.Nature Cell Biology. 2008; 10: 837-848Crossref PubMed Scopus (497) Google Scholar). Therefore, we considered BMP4 as a potential component of serum capable of activating TEAD transcription. However, BMP4 did not induce TEAD-dependent transcription. Moreover, the addition of the BMP inhibitor Noggin did not inhibit the capacity of FBS to induce TEAD, suggesting that another factor present in serum activates TEAD-dependent transcription (Fig. 1C). To assess whether the TEAD activity could be induced by other growth factors present in serum, we tested a panel of commercially available growth factors for their ability to affect TEAD family-dependent transcription, in serum-starved cells. However, no noticeable effect on TEAD-dependent transcription was detected after stimulation with the different factors, except for EGF, which caused a small yet insignificant increase in TEAD dependent-transcription (Fig. 1D). Because none of the tested growth factors affected TEAD-dependent transcription, a reverse approach was initiated with the aim of isolating and identifying one or more components in serum that can induce TEAD-dependent transcription. Thus, FBS was separated by chromatography as described under “Experimental Procedures,” and the eluted fractions were tested for their ability to induce TEAD-dependent transcription. Mouse ES cells co-transfected with pGTIIC-Luc and pCMV β-gal constructs were then serum- and LIF-starved and subsequently stimulated with the eluted fractions. The luciferase activity was normalized to the β-gal transcription level to remove transfection rate variations between samples and overall activation induced by the complex mix of growth factors, cytokines, and other molecules present in FBS. The fractions were also separated with SDS-PAGE and stained with Coomassie Blue to assess protein content. Fig. 2A shows the stained gels and the respective fraction's ability to induce TEAD-dependent transcription. Eluate 1 from the first Blue-Sepharose chromatography step was found to induce the highest level of TEAD activation, and was therefore used for further separation by heparin chromatography. The eluted fractions were again analyzed for TEAD-dependent activation as described above (Fig. 2B). By correlating band intensity with lucifer" @default.
• W1969726589 created "2016-06-24" @default.
• W1969726589 creator A5063054096 @default.
• W1969726589 creator A5070378634 @default.
• W1969726589 creator A5072122153 @default.
• W1969726589 date "2014-11-01" @default.
• W1969726589 modified "2023-10-01" @default.
• W1969726589 title "Serum Inter-α-inhibitor Activates the Yes Tyrosine Kinase and YAP/TEAD Transcriptional Complex in Mouse Embryonic Stem Cells" @default.
• W1969726589 cites W1568020701 @default.
• W1969726589 cites W1973154892 @default.
• W1969726589 cites W1978018545 @default.
• W1969726589 cites W1982498121 @default.
• W1969726589 cites W1987803647 @default.
• W1969726589 cites W1991449790 @default.
• W1969726589 cites W1991963460 @default.
• W1969726589 cites W1992949513 @default.
• W1969726589 cites W1994758141 @default.
• W1969726589 cites W2001594257 @default.
• W1969726589 cites W2001845507 @default.
• W1969726589 cites W2004549400 @default.
• W1969726589 cites W2006557127 @default.
• W1969726589 cites W2010305100 @default.
• W1969726589 cites W2010983242 @default.
• W1969726589 cites W2013885571 @default.
• W1969726589 cites W2020973522 @default.
• W1969726589 cites W2023175623 @default.
• W1969726589 cites W2023458688 @default.
• W1969726589 cites W2031569048 @default.
• W1969726589 cites W2034971124 @default.
• W1969726589 cites W2038441458 @default.
• W1969726589 cites W2044475547 @default.
• W1969726589 cites W2047253372 @default.
• W1969726589 cites W2050728315 @default.
• W1969726589 cites W2054474334 @default.
• W1969726589 cites W2058521801 @default.
• W1969726589 cites W2059306179 @default.
• W1969726589 cites W2060088854 @default.
• W1969726589 cites W2063395944 @default.
• W1969726589 cites W2068638812 @default.
• W1969726589 cites W2075857997 @default.
• W1969726589 cites W2079159284 @default.
• W1969726589 cites W2082019843 @default.
• W1969726589 cites W2106618287 @default.
• W1969726589 cites W2108244474 @default.
• W1969726589 cites W2124059822 @default.
• W1969726589 cites W2126712555 @default.
• W1969726589 cites W2129480424 @default.
• W1969726589 cites W2131162243 @default.
• W1969726589 cites W2132318885 @default.
• W1969726589 cites W2135102533 @default.
• W1969726589 cites W2135327201 @default.
• W1969726589 cites W2135964116 @default.
• W1969726589 cites W2138035159 @default.
• W1969726589 cites W2138197862 @default.
• W1969726589 cites W2143076230 @default.
• W1969726589 cites W2146337514 @default.
• W1969726589 cites W2159196011 @default.
• W1969726589 cites W2167978765 @default.
• W1969726589 doi "https://doi.org/10.1074/jbc.m114.580076" @default.
• W1969726589 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4246103" @default.
• W1969726589 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/25301940" @default.
• W1969726589 hasPublicationYear "2014" @default.
• W1969726589 type Work @default.
• W1969726589 sameAs 1969726589 @default.
• W1969726589 citedByCount "14" @default.
• W1969726589 countsByYear W19697265892015 @default.
• W1969726589 countsByYear W19697265892016 @default.
• W1969726589 countsByYear W19697265892018 @default.
• W1969726589 countsByYear W19697265892019 @default.
• W1969726589 countsByYear W19697265892020 @default.
• W1969726589 countsByYear W19697265892021 @default.
• W1969726589 countsByYear W19697265892022 @default.
• W1969726589 countsByYear W19697265892023 @default.
• W1969726589 crossrefType "journal-article" @default.
• W1969726589 hasAuthorship W1969726589A5063054096 @default.
• W1969726589 hasAuthorship W1969726589A5070378634 @default.
• W1969726589 hasAuthorship W1969726589A5072122153 @default.
• W1969726589 hasBestOaLocation W19697265891 @default.
• W1969726589 hasConcept C104317684 @default.
• W1969726589 hasConcept C145103041 @default.
• W1969726589 hasConcept C153911025 @default.
• W1969726589 hasConcept C184235292 @default.
• W1969726589 hasConcept C28328180 @default.
• W1969726589 hasConcept C502942594 @default.
• W1969726589 hasConcept C54355233 @default.
• W1969726589 hasConcept C86803240 @default.
• W1969726589 hasConcept C95444343 @default.
• W1969726589 hasConceptScore W1969726589C104317684 @default.
• W1969726589 hasConceptScore W1969726589C145103041 @default.
• W1969726589 hasConceptScore W1969726589C153911025 @default.
• W1969726589 hasConceptScore W1969726589C184235292 @default.
• W1969726589 hasConceptScore W1969726589C28328180 @default.
• W1969726589 hasConceptScore W1969726589C502942594 @default.
• W1969726589 hasConceptScore W1969726589C54355233 @default.
• W1969726589 hasConceptScore W1969726589C86803240 @default.
• W1969726589 hasConceptScore W1969726589C95444343 @default.
• W1969726589 hasIssue "48" @default.
• W1969726589 hasLocation W19697265891 @default.

• next