FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1969884079> ?p ?o ?g. }

• W1969884079 endingPage "352" @default.
• W1969884079 startingPage "341" @default.
• W1969884079 abstract "A basic conservation of cell migration guidance mechanisms in the nervous and immune systems was proposed when Slit, known for its role in axon guidance, was found to inhibit chemokine-induced leukocyte chemotaxis in vitro. These studies examined the role of Slit2 in modulating inflammation in vivo. In a rat model of glomerulonephritis, endogenous glomerular Slit2 expression fell after disease induction, and its inhibition during the early disease period accelerated inflammation. Ex vivo glomerular leukocytes showed decreased chemokine and chemoattractant-induced chemotaxis in response to Slit2, suggesting an anti-inflammatory role for glomerular Slit2. In contrast to the effect of inhibition, glomerulonephritis was ameliorated by systemic Slit2 administration. Slit2 treatment improved disease histologically and also improved renal function when given early in the disease course. Leukocytes harvested from rats receiving Slit2 showed decreased monocyte chemoattractant protein-1 (MCP)-1-mediated migration, consistent with a peripheral Slit2 effect. In keeping with this functional alteration, Slit2-mediated inhibition of RAW264.7 cell chemotaxis was associated with decreased levels of active cdc42 and Rac1, implicating GTPases in leukocyte Slit2 signaling. These findings suggest a role for endogenous Slit2 in the inhibition of chemoattractant-mediated signals, demonstrate a potentially important anti-inflammatory effect for Slit2 in vivo, and provide further evidence for conserved mechanisms guiding the process of migration in distinct cell types. A basic conservation of cell migration guidance mechanisms in the nervous and immune systems was proposed when Slit, known for its role in axon guidance, was found to inhibit chemokine-induced leukocyte chemotaxis in vitro. These studies examined the role of Slit2 in modulating inflammation in vivo. In a rat model of glomerulonephritis, endogenous glomerular Slit2 expression fell after disease induction, and its inhibition during the early disease period accelerated inflammation. Ex vivo glomerular leukocytes showed decreased chemokine and chemoattractant-induced chemotaxis in response to Slit2, suggesting an anti-inflammatory role for glomerular Slit2. In contrast to the effect of inhibition, glomerulonephritis was ameliorated by systemic Slit2 administration. Slit2 treatment improved disease histologically and also improved renal function when given early in the disease course. Leukocytes harvested from rats receiving Slit2 showed decreased monocyte chemoattractant protein-1 (MCP)-1-mediated migration, consistent with a peripheral Slit2 effect. In keeping with this functional alteration, Slit2-mediated inhibition of RAW264.7 cell chemotaxis was associated with decreased levels of active cdc42 and Rac1, implicating GTPases in leukocyte Slit2 signaling. These findings suggest a role for endogenous Slit2 in the inhibition of chemoattractant-mediated signals, demonstrate a potentially important anti-inflammatory effect for Slit2 in vivo, and provide further evidence for conserved mechanisms guiding the process of migration in distinct cell types. During inflammation, leukocytes have to migrate from the blood circulation into the interstitium of the involved tissue. Inflammatory cells respond to an orchestra of signals and eventually arrive at the appropriate site. While a large number of studies have established the importance of positive regulators in controlling leukocyte chemotaxis, there has been only limited evidence for the existence of endogenous inhibitory regulators of this process. Among the positive regulators, the best known are the secreted proteins of the chemokine family. Chemokines regulate leukocyte trafficking and inflammation through seven transmembrane receptors coupled to G proteins (GPCRs).1Baggiolini M Chemokines and leukocyte traffic.Nature. 1998; 392: 565-568Crossref PubMed Scopus (2385) Google Scholar, 2Luster AD Chemokines: chemotactic cytokines that mediate inflammation.N Engl J Med. 1998; 338: 436-445Crossref PubMed Scopus (3232) Google Scholar Although there are exceptions, chemokines generally act by establishing a concentration gradient in the interstitium by binding to heparan sulfate proteoglycans (HSPG). Inflammatory cells move toward the origin of the chemokines through a complex array of rearrangements of their cytoskeleton. Guidance cues provided by the cells and interstitium surrounding the inflammatory cells drive them further along the path toward the source of the chemokines and the eventual site of inflammation.Based on the repellent function of Slit in axon guidance and neuronal migration,3Kidd T Bland KS Goodman CS Slit is the midline repellent for the robo receptor in Drosophila.Cell. 1999; 96: 785-794Abstract Full Text Full Text PDF PubMed Scopus (781) Google Scholar, 4Brose K Bland KS Wang KH Arnott D Henzel W Goodman CS Tessier-Lavigne M Kidd T Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance.Cell. 1999; 96: 795-806Abstract Full Text Full Text PDF PubMed Scopus (954) Google Scholar, 5Li HS Chen JH Wu W Fagaly T Zhou L Yuan W Dupuis S Jiang ZH Nash W Gick C Ornitz DM Wu JY Rao Y Vertebrate slit, a secreted ligand for the transmembrane protein roundabout, is a repellent for olfactory bulb axons.Cell. 1999; 96: 807-818Abstract Full Text Full Text PDF PubMed Scopus (392) Google Scholar, 6Wu W Wong K Chen J Jiang Z Dupuis S Wu JY Rao Y Directional guidance of neuronal migration in the olfactory system by the protein Slit.Nature. 1999; 400: 331-336Crossref PubMed Scopus (473) Google Scholar, 7Zhu Y Li H Zhou L Wu JY Rao Y Cellular and molecular guidance of GABAergic neuronal migration from an extracortical origin to the neocortex.Neuron. 1999; 23: 473-485Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar an important role for similar molecules in the negative regulation of leukocyte migration was hypothesized. The Slit family of secreted proteins were subsequently shown to have no direct chemotactic activity of their own on leukocytes, but to act as negative regulators of chemokine-induced leukocyte chemotaxis in vitro.8Wu JY Feng L Park HT Havlioglu N Wen L Tang H Bacon KB Jiang Z Zhang X Rao Y The neuronal repellent Slit inhibits leukocyte chemotaxis induced by chemotactic factors.Nature. 2001; 410: 948-952Crossref PubMed Scopus (352) Google Scholar Although the Drosophila Slit gene was discovered over a decade ago,9Rothberg JM Hartley DA Walther Z Artavanis-Tsakonas S slit: an EGF-homologous locus of D. melanogaster involved in the development of the embryonic central nervous system.Cell. 1988; 55: 1047-1059Abstract Full Text PDF PubMed Scopus (223) Google Scholar, 10Rothberg JM Jacobs JR Goodman CS Artavanis-Tsakonas S slit: an extracellular protein necessary for development of midline glia and commissural axon pathways contains both EGF and LRR domains.Genes Dev. 1990; 4: 2169-2187Crossref PubMed Scopus (428) Google Scholar, 11Nusslein-Volhard C Roth S Axis determination in insect embryos.Ciba Found Symp. 1989; 144: 37-55PubMed Google Scholar its vertebrate homologues including three mammalian Slit genes (Slit 1, 2, and 3) were only recently identified. They are highly homologous to each other and encode ligands for the Roundabout (Robo) receptors.3Kidd T Bland KS Goodman CS Slit is the midline repellent for the robo receptor in Drosophila.Cell. 1999; 96: 785-794Abstract Full Text Full Text PDF PubMed Scopus (781) Google Scholar, 4Brose K Bland KS Wang KH Arnott D Henzel W Goodman CS Tessier-Lavigne M Kidd T Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance.Cell. 1999; 96: 795-806Abstract Full Text Full Text PDF PubMed Scopus (954) Google Scholar, 5Li HS Chen JH Wu W Fagaly T Zhou L Yuan W Dupuis S Jiang ZH Nash W Gick C Ornitz DM Wu JY Rao Y Vertebrate slit, a secreted ligand for the transmembrane protein roundabout, is a repellent for olfactory bulb axons.Cell. 1999; 96: 807-818Abstract Full Text Full Text PDF PubMed Scopus (392) Google Scholar, 12Battye R Stevens A Jacobs JR Axon repulsion from the midline of the Drosophila CNS requires slit function.Development. 1999; 126: 2475-2481PubMed Google Scholar, 13Kidd T Brose K Mitchell KJ Fetter RD Tessier-Lavigne M Goodman CS Tear G Roundabout controls axon crossing of the CNS midline and defines a novel subfamily of evolutionarily conserved guidance receptors.Cell. 1998; 92: 205-215Abstract Full Text Full Text PDF PubMed Scopus (722) Google Scholar, 14Nguyen Ba-Charvet KT Brose K Marillat V Kidd T Goodman CS Tessier-Lavigne M Sotelo C Chedotal A Slit2-mediated chemorepulsion and collapse of developing forebrain axons.Neuron. 1999; 22: 463-473Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar, 15Yuan W Zhou L Chen JH Wu JY Rao Y Ornitz DM The mouse SLIT family: secreted ligands for ROBO expressed in patterns that suggest a role in morphogenesis and axon guidance.Dev Biol. 1999; 212: 290-306Crossref PubMed Scopus (250) Google Scholar It is now clear that Slit and Robo genes are expressed in a range of tissues in addition to the brain.8Wu JY Feng L Park HT Havlioglu N Wen L Tang H Bacon KB Jiang Z Zhang X Rao Y The neuronal repellent Slit inhibits leukocyte chemotaxis induced by chemotactic factors.Nature. 2001; 410: 948-952Crossref PubMed Scopus (352) Google Scholar Slit proteins are secreted proteins containing four leucine-rich domains, nine EGF-like repeats, and a cysteine-rich carboxyl domain. They interact with glypican-1,16Hu H Cell-surface heparan sulfate is involved in the repulsive guidance activities of Slit2 protein.Nat Neurosci. 2001; 4: 695-701Crossref PubMed Scopus (179) Google Scholar, 17Liang Y Annan RS Carr SA Popp S Mevissen M Margolis RK Margolis RU Mammalian homologues of the Drosophila slit protein are ligands of the heparan sulfate proteoglycan glypican-1 in brain.J Biol Chem. 1999; 274: 17885-17892Crossref PubMed Scopus (108) Google Scholar, 18Ronca F Andersen JS Paech V Margolis RU Characterization of slit protein interactions with glypican-1.J Biol Chem. 2001; 276: 29141-29147Crossref PubMed Scopus (104) Google Scholar and as is the case with many of the chemokines, also appear to act by establishing concentration gradients through HSPG binding.Although a potential role for Slit proteins in the negative regulation of leukocyte migration was shown through in vitro studies,8Wu JY Feng L Park HT Havlioglu N Wen L Tang H Bacon KB Jiang Z Zhang X Rao Y The neuronal repellent Slit inhibits leukocyte chemotaxis induced by chemotactic factors.Nature. 2001; 410: 948-952Crossref PubMed Scopus (352) Google Scholar the role of these molecules in regulating leukocyte chemotaxis in vivo has not been reported. Furthermore, although the inhibitory effect of Slit in vitro suggests that it may be helpful in treating inflammatory diseases, the practical benefit of manipulating Slit activity in vivo has not been previously examined.A model of crescentic glomerulonephritis (GN) in Wistar-Kyoto (WKY) rats, induced by the administration of anti-glomerular basement membrane (GBM) antibodies19Chen S Bacon KB Li L Garcia GE Xia Y Lo D Thompson DA Siani MA Yamamoto T Harrison JK Feng L In vivo inhibition of CC and CX3C chemokine-induced leukocyte infiltration and attenuation of glomerulonephritis in Wistar-Kyoto (WKY) rats by vMIP-II.J Exp Med. 1998; 188: 193-198Crossref PubMed Scopus (234) Google Scholar, 20Feng L Chen S Garcia GE Xia Y Siani MA Botti P Wilson CB Harrison JK Bacon KB Prevention of crescentic glomerulonephritis by immunoneutralization of the fractalkine receptor CX3CR1.Kidney Int. 1999; 56: 612-620Crossref PubMed Scopus (166) Google Scholar was used to investigate the in vivo role and therapeutic effect of Slit protein. Multiple chemokines are known to be up-regulated in crescentic GN in both animal models and patients. Inhibition of chemokine signaling can attenuate crescentic GN,21Rovin BH Phan LT Chemotactic factors and renal inflammation.Am J Kidney Dis. 1998; 31: 1065-1084Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar, 22Schlondorff D Nelson PJ Luckow B Banas B Chemokines and renal disease.Kidney Int. 1997; 51: 610-621Crossref PubMed Scopus (170) Google Scholar, 23Segerer S Nelson PJ Schlondorff D Chemokines, chemokine receptors, and renal disease: from basic science to pathophysiologic and therapeutic studies.J Am Soc Nephrol. 2000; 11: 152-176PubMed Google Scholar, 24Holdsworth SR Kitching AR Tipping PG Chemokines as therapeutic targets in renal disease.Curr Opin Nephrol Hypertens. 2000; 9: 505-511Crossref PubMed Scopus (21) Google Scholar making this disease a useful model to study the role of negative regulators of leukocyte chemotaxis.The findings reported here demonstrate a role for endogenous Slit2 in the inhibition of leukocyte chemotaxis in vivo, and suggest a potentially important anti-inflammatory function for Slit2. The effect on leukocytes appears to be mediated through signaling pathways responsible for cell migration and motility, consistent with the effect of Slit proteins in the nervous system.Materials and MethodsAll work with animals was performed in accordance with National Institute of Health guidelines and with protocols approved by the Baylor College of Medicine Animal Ethics committee.Crescentic Glomerulonephritis: Induction, Treatment, and AnalysisMale WKY rats, (180 to 200 g; Harlan Laboratories, Madison, WI), received one injection of anti-GBM serum (25 μl/100g) on day 0, as described previously.20Feng L Chen S Garcia GE Xia Y Siani MA Botti P Wilson CB Harrison JK Bacon KB Prevention of crescentic glomerulonephritis by immunoneutralization of the fractalkine receptor CX3CR1.Kidney Int. 1999; 56: 612-620Crossref PubMed Scopus (166) Google Scholar Slit and Robo mRNA expression was monitored using RNase protection assay at various time points in unmodified disease for 30 days after induction. As anti-GBM antibody binding to the GBM occurs within the first hour after injection,25Allison ME Wilson CB Gottschalk CW Pathophysiology of experimental glomerulonephritis in rats.J Clin Invest. 1974; 53: 1402-1423Crossref PubMed Scopus (105) Google Scholar, 26Wilson CB Nephritogenic antibody mechanisms involving antigens within the glomerulus.Immunol Rev. 1981; 55: 257-297Crossref PubMed Scopus (27) Google Scholar to eliminate concerns regarding an effect on this process, Slit2 antibody and early recombinant human Slit2 (rhSlit2) treatment (described below) commenced after this time (6 hours later). Proteinuria was assessed by the sulfosalicylic method.27Feng L Xia Y Yoshimura T Wilson CB Modulation of neutrophil influx in glomerulonephritis in the rat with anti-macrophage inflammatory protein-2 (MIP-2) antibody.J Clin Invest. 1995; 95: 1009-1017Crossref PubMed Scopus (167) Google Scholar Serum creatinine levels were measured using a kit (Sigma, St. Louis, MO, USA). Kidney tissues were fixed in formalin or methanol-Carnoy solution and paraffin-embedded. Five-μm paraffin sections were stained with periodic acid-Schiff (PAS) reagent to assess glomerular crescent formation. Infiltrating macrophages were identified by staining for ED-1 as previously described.19Chen S Bacon KB Li L Garcia GE Xia Y Lo D Thompson DA Siani MA Yamamoto T Harrison JK Feng L In vivo inhibition of CC and CX3C chemokine-induced leukocyte infiltration and attenuation of glomerulonephritis in Wistar-Kyoto (WKY) rats by vMIP-II.J Exp Med. 1998; 188: 193-198Crossref PubMed Scopus (234) Google Scholar Crescents and ED-1-positive (ED-1+) cells were scored by a researcher blinded to the experimental set up.Slit2 Antiserum AdministrationSeveral rabbit polyclonal antisera against human Slit2 protein (production described below) were tested in in vitro chemotaxis assays. One antiserum was shown to completely block the ability of Slit2 to inhibit chemotaxis of rat SVZa neuronal cells in our standard neuronal migration assays28Wong K Ren XR Huang YZ Xie Y Liu G Saito H Tang H Wen L Brady-Kalnay SM Mei L Wu JY Xiong WC Rao Y Signal transduction in neuronal migration: roles of GTPase-activating proteins and the small GTPase Cdc42 in the Slit-Robo pathway.Cell. 2001; 107: 209-221Abstract Full Text Full Text PDF PubMed Scopus (456) Google Scholar, 29Chen JH Wen L Dupuis S Wu JY Rao Y The N-terminal leucine-rich regions in Slit are sufficient to repel olfactory bulb axons and subventricular zone neurons.J Neurosci. 2001; 21: 1548-1556Crossref PubMed Google Scholar at an antiserum concentration of 1 in 500 (data not shown). Neutralizing anti-Slit2 antiserum was administered daily by intravenous (tail vein) injection (0.5 ml/rat/day for 7 days) commencing 6 hours after disease induction. Control rats received pre-immune serum. A total of 36 rats were examined with sacrifice occurring on days 3 (n = 6), 5 (n = 6), and 7 (n = 6). The experiments were performed in three separate sets (12 rats at a time, n = 2 per time point) and results pooled at the end. For the proteinuria and creatinine measurements, six rats per time point were also analyzed.Early Recombinant Human Slit2 (rhSlit2) TreatmentRats received daily intravenous injections of rhSlit2 (production described below). Each rat received seven injections in total with each dose delivering approximately 500 ng of rhSlit2 (in 0.5 ml). The first injection was given 6 hours after disease induction. Control rats received injections of vehicle buffer (Tris-HCl). A total of 36 rats were examined in a manner similar to that for the antibody treatment described above (sacrifice day 3, 5, and 7 with n = 6 per group).Delayed rhSlit2 TreatmentRats received daily intravenous injections as above for 5 days, commencing on day 7 after the induction of GN. Control rats received injections of vehicle buffer (Tris-HCl). All rats were sacrificed on day 12 (n = 5 per group).RNase Protection AssayRNase protection assays were performed as described30Xia Y Garcia G Chen S Wilson CB Feng L Cloning of rat 92-kDa type IV collagenase and expression of an active recombinant catalytic domain.FEBS Lett. 1996; 382: 285-288Abstract Full Text PDF PubMed Scopus (22) Google Scholar using a kit (Torrey Pines Biologicals, Houston, TX) with corresponding probes labeled with [32P]UTP. Total RNA from organs and cells was isolated using Trizol (Gibco, BRL, Grand Island, NY). Previously described riboprobes specific for rat Slit1, Slit2, and Slit3, and the housekeeping gene L32 were used.8Wu JY Feng L Park HT Havlioglu N Wen L Tang H Bacon KB Jiang Z Zhang X Rao Y The neuronal repellent Slit inhibits leukocyte chemotaxis induced by chemotactic factors.Nature. 2001; 410: 948-952Crossref PubMed Scopus (352) Google Scholar, 19Chen S Bacon KB Li L Garcia GE Xia Y Lo D Thompson DA Siani MA Yamamoto T Harrison JK Feng L In vivo inhibition of CC and CX3C chemokine-induced leukocyte infiltration and attenuation of glomerulonephritis in Wistar-Kyoto (WKY) rats by vMIP-II.J Exp Med. 1998; 188: 193-198Crossref PubMed Scopus (234) Google ScholarGlomeruli were obtained by standard sieving techniques27Feng L Xia Y Yoshimura T Wilson CB Modulation of neutrophil influx in glomerulonephritis in the rat with anti-macrophage inflammatory protein-2 (MIP-2) antibody.J Clin Invest. 1995; 95: 1009-1017Crossref PubMed Scopus (167) Google Scholar, 31Camazine SM Ryan GB Unanue ER Karnovsky MJ Isolation of phagocytic cells from the rat renal glomerulus.Lab Invest. 1976; 35: 315-326PubMed Google Scholar and Slit2 mRNA expression was assessed. Although three separate assays were performed, each used individual rat samples with only n = 1 or 2 available for each time point, thus no statistical analysis was made. Densitometry was performed on all three assays and similar results were obtained (Alphaease Software 5.0, Alpha Innotech Corp, CA). Slit2 mRNA expression was expressed as a percentage of that in normal glomeruli.Reverse Transcriptase PCRRat peripheral blood mononuclear cells were assessed for Robo1 mRNA expression. Five μg of total RNA was reverse transcribed (20 μl reaction, 250 ng random primers, 10 mmol/L each dNTP) at 42°C for 50 minutes in the presence of Superscript II (Invitrogen, NY). RNase H (2u) was then added (37°C for 20 minutes) and 5 μl of the first-strand reaction was used in the PCR (100 μl volume, 10 μmol/L primers, 20mMdNTP, 150 mmol/L MgCl2, 5u Taq polymerase). Rat Robo1 primers used were: 5′GAGTCCTGTGTCTACAGACAG and 3′GCCCACATTTGCTTGCTCTCTC. The mixture was amplified for 40 cycles, denatured at 93°C, annealed at 62°C, and elongated at 72°C. Expected size of the PCR product was 547 bp. In control PCR reactions, reverse-transcribed samples following RNase and DNase pretreatment were used.Production of Rabbit Polyclonal Anti-Human Slit2 AntiseraOur general methodology for polyclonal antibody production has been previously described.30Xia Y Garcia G Chen S Wilson CB Feng L Cloning of rat 92-kDa type IV collagenase and expression of an active recombinant catalytic domain.FEBS Lett. 1996; 382: 285-288Abstract Full Text PDF PubMed Scopus (22) Google Scholar The cDNA sequence encoding the human Slit2 protein from amino acids 1–300 (GenBank Accession No. XM 039647) was generated by PCR. Human Slit2 shows a remarkable degree of homology with Slit proteins from other species. For example, the homologies for human Slit2 with rat Slit2, xenopus Slit, and drosophila Slit are 95%, 87% and 40%, respectively.5Li HS Chen JH Wu W Fagaly T Zhou L Yuan W Dupuis S Jiang ZH Nash W Gick C Ornitz DM Wu JY Rao Y Vertebrate slit, a secreted ligand for the transmembrane protein roundabout, is a repellent for olfactory bulb axons.Cell. 1999; 96: 807-818Abstract Full Text Full Text PDF PubMed Scopus (392) Google Scholar The alignment of human Slit2 with rat Slit2 for the peptide sequence used to generate the antisera reveals very close identity (Figure 1A). The His-tagged human Slit2 cDNA sequence was subcloned to pET20 (Novagen, Madison, WI), expressed in E. coli, and re-folded to generate soluble peptide. The peptide was affinity purified by a Ni-nitrilotriacetic acid affinity column and run on a SDS-PAGE gel for verification (size ∼25 kd) before immunizing rabbits. Recombinant peptide (100 μg) in complete Freund's adjuvant was administered to rabbits subcutaneously. Fifty-μg injections in incomplete Freund's adjuvant were repeated every 2 weeks. Serum was collected at various time points after the sixth week, and assessed for specificity against human and rat Slit2 in Western blot assays. The antiserum (at a dilution of 1:5000) identified Slit2 protein produced by 293T cells transfected with the full-length cDNA sequence for both human and rat Slit25Li HS Chen JH Wu W Fagaly T Zhou L Yuan W Dupuis S Jiang ZH Nash W Gick C Ornitz DM Wu JY Rao Y Vertebrate slit, a secreted ligand for the transmembrane protein roundabout, is a repellent for olfactory bulb axons.Cell. 1999; 96: 807-818Abstract Full Text Full Text PDF PubMed Scopus (392) Google Scholar (Figure 1B). Briefly, 2 × 106 cells in 400 μl, were electroporated (at room temperature, 300V for 25ms) with 20 μg of plasmid (pcDNA3.1) containing either the human or rat Slit2 sequence. Controls were also performed with the vector alone. Electroporated cells were recovered in 20% fetal bovine serum (FBS) Dulbeccos modified Eagle's media (DMEM) medium at 37°C for 24 hours. By Western blotting, bands of the appropriate size (∼220 to 240 kd) were seen in the 293T cells transfected with Slit2 but not in the control cells (vector alone, Figure 1B).Production of rhSlit2 and RoboNBoth rhSlit2 and RoboN were produced from stably transfected 293T cells. The methods required have been extensively described previously.5Li HS Chen JH Wu W Fagaly T Zhou L Yuan W Dupuis S Jiang ZH Nash W Gick C Ornitz DM Wu JY Rao Y Vertebrate slit, a secreted ligand for the transmembrane protein roundabout, is a repellent for olfactory bulb axons.Cell. 1999; 96: 807-818Abstract Full Text Full Text PDF PubMed Scopus (392) Google Scholar, 6Wu W Wong K Chen J Jiang Z Dupuis S Wu JY Rao Y Directional guidance of neuronal migration in the olfactory system by the protein Slit.Nature. 1999; 400: 331-336Crossref PubMed Scopus (473) Google Scholar The full-length human Slit2 cDNA sequence and the extracellular domain of Robo1 were tagged at the carboxy terminus with c-myc and HA, respectively. Cells were cultured in DMEM supplemented with 5% fetal bovine serum and media was collected 3 days after cells became confluent. In brief, slit- and RoboN-conditioned media were harvested from stable 293T cells (grown in DMEM with 5% fetal calf serum (FCS)) transfected with c-myc-tagged Slit2 or HA-tagged RoboN constructs. The pH of the conditioned media was adjusted to 7.5 before being passed three times through agarose-linked columns containing either monoclonal 9E10 (for c-myc tag) or 12CA5 (for HA tag) antibodies (Berkley Antibody Co. BAbCo, Richmond, CA). Columns were washed with phosphate-buffered saline (PBS), and eluted with 0.1 mol/L glycine (pH 2.9). The pH was immediately adjusted back to 7.5 with Tris buffer by adding appropriate amounts of 1 mol/L Tris (pH 7.5). Since rhSlit2 was used in vivo, a large preparation was produced, and about 11 μg of purified rSlit2 protein was typically obtained from 100 ml of Slit-2 stable transfectant culture. RoboN was diluted to 1 nmol/L and used in chemotaxis assays. The Slit2 protein was used in chemotaxis assays as described or at full strength (1 μg/ml) in the in vivo experiments. Endotoxin contamination of the reagents was excluded using the Limulus Amebocyte assay (BioWhittaker Inc., Walkersville, MD), indicating a concentration of <0.015 endotoxin U/ml. The purity of both rhSlit2 and RoboN is shown in Figure 1C.Glomerular Leukocyte Chemotaxis AssaysFor each set of assays, glomerular leukocytes from three rats with GN were isolated and used. Experiments were repeated on two further occasions (n = 3 each time) and the findings were shown to be reproducible. Harvested cells from each rat were run in duplicate in the chemotaxis assays and the average of these two numbers was used as the cell migration for that particular rat.In brief, 6 days after disease induction, kidneys were decapsulated and sieved. Suspensions were checked for glomerular purity (>95%), pooled, and incubated with digestive enzymes.19Chen S Bacon KB Li L Garcia GE Xia Y Lo D Thompson DA Siani MA Yamamoto T Harrison JK Feng L In vivo inhibition of CC and CX3C chemokine-induced leukocyte infiltration and attenuation of glomerulonephritis in Wistar-Kyoto (WKY) rats by vMIP-II.J Exp Med. 1998; 188: 193-198Crossref PubMed Scopus (234) Google Scholar, 31Camazine SM Ryan GB Unanue ER Karnovsky MJ Isolation of phagocytic cells from the rat renal glomerulus.Lab Invest. 1976; 35: 315-326PubMed Google Scholar, 32Cook HT Smith J Cattell V Isolation and characterization of inflammatory leukocytes from glomeruli in an in situ model of glomerulonephritis in the rat.Am J Pathol. 1987; 126: 126-136PubMed Google Scholar Both resident glomerular cells and inflammatory cells were obtained in the final “soup”. The inflammatory cells were characterized by examination of stained cytospins, and consisted primarily of macrophage/monocytes (∼75%) with some lymphocytes (25%). Cells were resuspended (4 × 106 cells/ml) in DMEM with 3% normal rat serum and kept on ice before use. Chemotaxis was measured by transfilter assays in 48-well chemotaxis chambers (Neuroprobe, Cabin John, MD).8Wu JY Feng L Park HT Havlioglu N Wen L Tang H Bacon KB Jiang Z Zhang X Rao Y The neuronal repellent Slit inhibits leukocyte chemotaxis induced by chemotactic factors.Nature. 2001; 410: 948-952Crossref PubMed Scopus (352) Google Scholar, 19Chen S Bacon KB Li L Garcia GE Xia Y Lo D Thompson DA Siani MA Yamamoto T Harrison JK Feng L In vivo inhibition of CC and CX3C chemokine-induced leukocyte infiltration and attenuation of glomerulonephritis in Wistar-Kyoto (WKY) rats by vMIP-II.J Exp Med. 1998; 188: 193-198Crossref PubMed Scopus (234) Google Scholar Different chemoattractants (chemokines or the bacterial chemoattractant product N-formyl peptide f-Met-Leu-Phe; fMLP, all at 10 nmol/L) were placed in lower wells of chambers (30 μl/well) and separated from cell suspension (50 μl) in upper wells by 5-μm pore-size PVP-free polycarbonate filters.The effect of Slit2 was assessed in two different ways: first, by adding it to lower wells only (12.5 to 200 pM) and second, by pre-incubating the cells for 30 minutes in Slit2 (on ice) and then adding them directly (no washing) to the upper chambers. In these experiments the upper well Slit2 concentrations were the same as the lower well Slit2 concentrations. Cells not pre-incubated with Slit2 were similarly placed on ice for 30 minutes before the assay. In the assays with Slit2 pre-incubation and addition to both upper and lower chambers, the effect of adding RoboN was also assessed. Here, RoboN was added (final concentration, 1 nmol/L) at the same time as the Slit2.Chambers were incubated at 37°C in 5% CO2 for 90 minutes. The filter upper surface was washed three times with PBS and scraped to remove cells that had settled. Cells trapped in filter pores or adherent to the undersurface were fixed in methanol and stained. Transfilter migration was expressed as the total number of cells seen migrating in five 0.1 mm2 fields. Results were expressed as mean ± SD. All counts were obtained by a researcher blinded to the experimental set-up.Chemotaxis Assays on Peripheral Blood Mononuclear Cells from Rats Receiving rhSlit2Normal WKY rats received a single intravenous injection of rhSlit2 (approx 500 ng in 0.5 ml) through the tail vein. Control rats received a vehicle buffer (Tris-HCl). Thirty minutes later, rats were anesthetized, bled, and sacrificed. Blood counts and smears were examined for total and differential white cell counts." @default.
• W1969884079 created "2016-06-24" @default.
• W1969884079 creator A5004471228 @default.
• W1969884079 creator A5008942444 @default.
• W1969884079 creator A5011446466 @default.
• W1969884079 creator A5026528566 @default.
• W1969884079 creator A5036235462 @default.
• W1969884079 creator A5058161492 @default.
• W1969884079 creator A5068399329 @default.
• W1969884079 creator A5069804519 @default.
• W1969884079 creator A5071002341 @default.
• W1969884079 creator A5073070877 @default.
• W1969884079 creator A5081844561 @default.
• W1969884079 date "2004-07-01" @default.
• W1969884079 modified "2023-10-06" @default.
• W1969884079 title "Modulation of Inflammation by Slit Protein In Vivo in Experimental Crescentic Glomerulonephritis" @default.
• W1969884079 cites W1499597566 @default.
• W1969884079 cites W1529799129 @default.
• W1969884079 cites W1547580946 @default.
• W1969884079 cites W1599219198 @default.
• W1969884079 cites W1602835962 @default.
• W1969884079 cites W1611957532 @default.
• W1969884079 cites W189258402 @default.
• W1969884079 cites W1917919273 @default.
• W1969884079 cites W1967450020 @default.
• W1969884079 cites W1971029667 @default.
• W1969884079 cites W1979258465 @default.
• W1969884079 cites W1982266855 @default.
• W1969884079 cites W2005659566 @default.
• W1969884079 cites W2005918138 @default.
• W1969884079 cites W2010084732 @default.
• W1969884079 cites W2019129382 @default.
• W1969884079 cites W2020046465 @default.
• W1969884079 cites W2021182179 @default.
• W1969884079 cites W2023266494 @default.
• W1969884079 cites W2026965831 @default.
• W1969884079 cites W2030696262 @default.
• W1969884079 cites W2034575503 @default.
• W1969884079 cites W2036899384 @default.
• W1969884079 cites W2038253791 @default.
• W1969884079 cites W2042910934 @default.
• W1969884079 cites W2046369608 @default.
• W1969884079 cites W2048228486 @default.
• W1969884079 cites W2056220715 @default.
• W1969884079 cites W2060822348 @default.
• W1969884079 cites W2061172411 @default.
• W1969884079 cites W2073769825 @default.
• W1969884079 cites W2085146138 @default.
• W1969884079 cites W2089553333 @default.
• W1969884079 cites W2093844155 @default.
• W1969884079 cites W2096369647 @default.
• W1969884079 cites W2111320927 @default.
• W1969884079 cites W2119261083 @default.
• W1969884079 cites W2119745892 @default.
• W1969884079 cites W2132985898 @default.
• W1969884079 cites W2146337027 @default.
• W1969884079 cites W2146822492 @default.
• W1969884079 cites W2150396060 @default.
• W1969884079 cites W2156800219 @default.
• W1969884079 cites W2164808616 @default.
• W1969884079 cites W2168344733 @default.
• W1969884079 cites W2279014485 @default.
• W1969884079 cites W2318274025 @default.
• W1969884079 cites W2464514713 @default.
• W1969884079 doi "https://doi.org/10.1016/s0002-9440(10)63301-9" @default.
• W1969884079 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1618548" @default.
• W1969884079 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15215188" @default.
• W1969884079 hasPublicationYear "2004" @default.
• W1969884079 type Work @default.
• W1969884079 sameAs 1969884079 @default.
• W1969884079 citedByCount "54" @default.
• W1969884079 countsByYear W19698840792012 @default.
• W1969884079 countsByYear W19698840792013 @default.
• W1969884079 countsByYear W19698840792014 @default.
• W1969884079 countsByYear W19698840792015 @default.
• W1969884079 countsByYear W19698840792016 @default.
• W1969884079 countsByYear W19698840792017 @default.
• W1969884079 countsByYear W19698840792018 @default.
• W1969884079 countsByYear W19698840792019 @default.
• W1969884079 countsByYear W19698840792020 @default.
• W1969884079 countsByYear W19698840792021 @default.
• W1969884079 countsByYear W19698840792022 @default.
• W1969884079 countsByYear W19698840792023 @default.
• W1969884079 crossrefType "journal-article" @default.
• W1969884079 hasAuthorship W1969884079A5004471228 @default.
• W1969884079 hasAuthorship W1969884079A5008942444 @default.
• W1969884079 hasAuthorship W1969884079A5011446466 @default.
• W1969884079 hasAuthorship W1969884079A5026528566 @default.
• W1969884079 hasAuthorship W1969884079A5036235462 @default.
• W1969884079 hasAuthorship W1969884079A5058161492 @default.
• W1969884079 hasAuthorship W1969884079A5068399329 @default.
• W1969884079 hasAuthorship W1969884079A5069804519 @default.
• W1969884079 hasAuthorship W1969884079A5071002341 @default.
• W1969884079 hasAuthorship W1969884079A5073070877 @default.
• W1969884079 hasAuthorship W1969884079A5081844561 @default.
• W1969884079 hasBestOaLocation W19698840791 @default.
• W1969884079 hasConcept C126322002 @default.
• W1969884079 hasConcept C142724271 @default.

• next