FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1970787573> ?p ?o ?g. }

• W1970787573 endingPage "110" @default.
• W1970787573 startingPage "98" @default.
• W1970787573 abstract "SummaryAlthough >90% of patients with osteogenesis imperfecta (OI) have been estimated to have mutations in the COL1A1 and COL1A2 genes for type I procollagen, mutations have been difficult to detect in all patients with the mildest forms of the disease (i.e., type I). In this study, we first searched for mutations in type I procollagen by analyses of protein and mRNA in fibroblasts from 10 patients with mild OI; no evidence of a mutation was found in 2 of the patients by the protein analyses, and no evidence of a mutation was found in 5 of the patients by the RNA analyses. We then searched for mutations in the original 10 patients and in 5 additional patients with mild OI, by analysis of genomic DNA. To assay the genomic DNA, we established a consensus sequence for the first 12 kb of the COL1A1 gene and for 30 kb of new sequences of the 38-kb COL1A2 gene. The sequences were then used to develop primers for PCR for the 103 exons and exon boundaries of the two genes. The PCR products were first scanned for heteroduplexes by conformation-sensitive gel electrophoresis, and then products containing heteroduplexes were sequenced. The results detected disease-causing mutations in 13 of the 15 patients and detected two additional probable disease-causing mutations in the remaining 2 patients. Analysis of the data developed in this study and elsewhere revealed common sequences for mutations causing null alleles. Although >90% of patients with osteogenesis imperfecta (OI) have been estimated to have mutations in the COL1A1 and COL1A2 genes for type I procollagen, mutations have been difficult to detect in all patients with the mildest forms of the disease (i.e., type I). In this study, we first searched for mutations in type I procollagen by analyses of protein and mRNA in fibroblasts from 10 patients with mild OI; no evidence of a mutation was found in 2 of the patients by the protein analyses, and no evidence of a mutation was found in 5 of the patients by the RNA analyses. We then searched for mutations in the original 10 patients and in 5 additional patients with mild OI, by analysis of genomic DNA. To assay the genomic DNA, we established a consensus sequence for the first 12 kb of the COL1A1 gene and for 30 kb of new sequences of the 38-kb COL1A2 gene. The sequences were then used to develop primers for PCR for the 103 exons and exon boundaries of the two genes. The PCR products were first scanned for heteroduplexes by conformation-sensitive gel electrophoresis, and then products containing heteroduplexes were sequenced. The results detected disease-causing mutations in 13 of the 15 patients and detected two additional probable disease-causing mutations in the remaining 2 patients. Analysis of the data developed in this study and elsewhere revealed common sequences for mutations causing null alleles. Osteogenesis imperfecta (OI) is a heritable disorder that produces varying degrees of bone fragility associated with defects in several other tissues rich in type I collagen. Almost 200 mutations in the two genes for type I procollagen (COL1A1 and COL1A2) have been detected in probands with OI (Prockop, 1990Prockop DJ Mutations that alter the primary structure of type I collagen: the perils of a system for generating large structures by the principle of nucleated growth.J Biol Chem. 1990; 265: 15349-15352Abstract Full Text PDF PubMed Google Scholar; Byers, 1993Byers PH Osteogenesis imperfecta.in: Royce PM Steinmann B Connective tissue and its heritable disorders. Wiley-Liss, New York1993: 317-351Google Scholar; Prockop and Kivirikko, 1995Prockop DJ Kivirikko KI Collagens: molecular biology, diseases and potentials for therapy.Annu Rev Biochem. 1995; 64: 403-434Crossref PubMed Scopus (1320) Google Scholar; Kuivaniemi et al., 1997Kuivaniemi H Tromp G Prockop DJ Mutations in fibrillar collagens (types I, II, III and XI), fibril-associated collagen (type IX), and network-forming collagen (type X) cause a spectrum of diseases of bone, cartilage and blood vessels.Hum Mutat. 1997; 9: 300-315Crossref PubMed Scopus (261) Google Scholar). The most severe variants of the disease (OI types II–IV) are caused primarily by single-base substitutions that convert a codon for an obligate glycine in the triple helix of the protein to a codon for an amino acid with a bulkier side chain that distorts the conformation of the triple helix. Most of the mutations in the mildest variant (OI type I) cause decreased expression of proα1(I) chains because of either premature-termination codons or RNA-splicing defects in the COL1A1 gene (Willing et al., 1992Willing MC Pruchno CJ Atkinson M Byers PH Osteogenesis imperfecta type I is commonly due to a COL1A1 null allele of type I collagen.Am J Hum Genet. 1992; 51: 508-515PubMed Google Scholar, Willing et al., 1994Willing MC Deschenes SP Scott DA Byers PH Slayton RL Pitts SH Arikat H et al.Osteogenesis imperfecta type I: molecular heterogeneity for COL1A1 null alleles of type I collagen.Am J Hum Genet. 1994; 55: 638-647PubMed Google Scholar, Willing et al., 1996Willing MC Deschenes SP Slayton RL Roberts EJ Premature chain termination is a unifying mechanism for COL1A1 null alleles in osteogenesis imperfecta type I cell strains.Am J Hum Genet. 1996; 59: 799-809PubMed Google Scholar; Redford-Badwal et al., 1996Redford-Badwal DA Stover ML Valli M McKinstry MB Rowe DW Nuclear retention of COL1A1 messenger RNA identifies null alleles causing mild osteogenesis imperfecta.J Clin Invest. 1996; 97: 1035-1040Crossref PubMed Scopus (45) Google Scholar; Körkkö et al., 1997Körkkö J Kuivaniemi H Paassilta P Zhuang J Tromp G De Paepe A Prockop DJ et al.Two new recurrent nucleotide mutations in the COL1A1 gene in four patients with osteogenesis imperfecta: about one-fifth are recurrent.Hum Mutat. 1997; 9: 148-156Crossref PubMed Scopus (23) Google Scholar). DNA linkage studies have suggested that >90% of probands with OI have a mutation in either the COL1A1 gene or the COL1A2 gene (Sykes et al., 1990Sykes B Ogilvie D Wordsworth P Wallis G Mathew C Beighton P Nicholls A et al.Consistent linkage of dominantly inherited osteogenesis imperfecta to the type I collagen loci: COL1A1 and COL1A2.Am J Hum Genet. 1990; 46: 293-307PubMed Google Scholar). However, most unrelated probands have different mutations, and it has been difficult to define the mutations in a number of patients with OI type I by means of previously employed protocols, which have sought to assay type I procollagen synthesized by either cultured skin fibroblasts or mRNAs extracted from such cells. In the present study, we have developed protocols to amplify all 103 exons and exon boundaries of both the COL1A1 gene and the COL1A2 gene by PCR and to scan for mutations by conformation-sensitive gel electrophoresis (CSGE) (Ganguly et al., 1993Ganguly A Rock M Prockop DJ Conformation-sensitive gel electrophoresis for rapid detection of single base differences in double-stranded PCR products and DNA fragments: evidence for solvent-induced bends in DNA heteroduplexes.Proc Natl Acad Sci USA. 1993; 90: 10325-10329Crossref PubMed Scopus (603) Google Scholar; Ganguly and Prockop, 1995Ganguly A Prockop DJ Detection of mismatched bases in double stranded DNA by gel electrophoresis.Electrophoresis. 1995; 16: 1830-1835Crossref PubMed Scopus (31) Google Scholar). To develop the protocols, it was necessary to complete 90% of the structure of the 38-kb COL1A2 gene and to resequence extensive regions of the 18-kb COL1A1 gene. We used the protocols to analyze the COL1A1 and COL1A2 genes in 15 patients with mild OI. Disease-causing mutations were found in 13 of the 15 patients, and two probable disease-causing mutations were found in the remaining 2 patients. Analysis of the data, together with analysis of previously published mutations causing OI, indicate that there are common sequences for mutations that produce null alleles of the COL1A1 gene. All probands presented the typical phenotype of OI type I. The major clinical manifestations for each of them are summarized in table 1.Table 1Clinical Summary of OI Type I Phenotypes in ProbandsProband (Code)Year of BirthFracturesBone Deformity/ Short StatureaA plus sign (+) denotes presence; a minus sign (−) denotes absence; and a plus-or-minus sign (±) denotes possible presence. ND = not definitively defined.Blue ScleraeaA plus sign (+) denotes presence; a minus sign (−) denotes absence; and a plus-or-minus sign (±) denotes possible presence. ND = not definitively defined.Dentinogenesis ImperfectaaA plus sign (+) denotes presence; a minus sign (−) denotes absence; and a plus-or-minus sign (±) denotes possible presence. ND = not definitively defined.Hearing LossaA plus sign (+) denotes presence; a minus sign (−) denotes absence; and a plus-or-minus sign (±) denotes possible presence. ND = not definitively defined.Family HistoryaA plus sign (+) denotes presence; a minus sign (−) denotes absence; and a plus-or-minus sign (±) denotes possible presence. ND = not definitively defined.1 (421)1970Multiple−NDND−−2 (26219642−+−−+3 (207)19636−++−+4 (395)1974>100−++++5 (491)1990Multiple−+?−+6 (185)197412−+−−+7 (292)1967Multiple−ND−−+8 (394)1952Multiple−+−−+9 (283)1956Multiple−ND?−+10 (286)1989Multiple−+±−+11 (LE)1963Multiple−+ND−+12 (ROMA)1980Multiple−+−−ND13 (J198)1970Multiple−+−ND−14 (J210)1963MultipleNDaA plus sign (+) denotes presence; a minus sign (−) denotes absence; and a plus-or-minus sign (±) denotes possible presence. ND = not definitively defined.+NDND+15 (J218)1976Multiple−+±−+a A plus sign (+) denotes presence; a minus sign (−) denotes absence; and a plus-or-minus sign (±) denotes possible presence. ND = not definitively defined. Open table in a new tab A skin biopsy was obtained from probands 1–10, and fibroblast cultures were established under standard conditions. Cells were seeded at 35,000 cells/cm2. Labeling of the fibroblasts and purification of the collagen molecules were performed as reported elsewhere (Nuytinck et al., in pressNuytinck L, Coppin A, De Paepe A. A 4 bp insertion polymorphism in the 3′ UTR of the COL1A1 gene is highly informative for null-allele testing in patients with OI type I. Matrix Biol (in press)Google Scholar). In brief, for labeling of the cells, Basal Medium Eagle (Life Technologies) supplemented with 1 μCi 14C proline/ml, 5% dialyzed FCS, 0.05 mg βAPN/ml, and 0.025 mg ascorbic acid/liter was added. After 20 h, the medium was removed and supplemented with proteinase inhibitors (0.1 mg phenylmethyl sulfonyl flouride/ml, 0.1 mg N-ethylmaleimide/ml, and 2 mM EDTA pH 7.5). The cell layer was trypsinized, and the cells were collected by centrifugation and were lysed in 0.5% Triton X-100 in 0.5 M acetic acid. The supernatant was used for collagen analysis. Collagen samples were isolated from the medium by alcohol precipitation and were redissolved in 0.5 M acetic acid. For the conversion of procollagen to collagen, the samples were digested with 50 μg pepsin/μl (Boehringer) for 4 h at 15°C. The digestion was stopped by the addition of 0.5 μg pepstatin/μl (Boehringer). SDS-electrophoresis was performed by the Laemmli, 1975Laemmli UK Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature. 1975; 227: 680-685Crossref Scopus (202436) Google Scholar system, with 3% stacking and 5% separation gel. Prior to being loaded, the samples were lyophilized, redissolved in sample buffer (Tris-HCl pH 6.8, 2 M urea, and 0.04% bromophenol blue), and denatured for 20 min at 55°C. Electrophoresis was performed at 8°C overnight (3.5 V/cm). The gels were processed for fluorography by use of 20% 2.5-diphenyloxazole in 100% acetic acid and then were dried and exposed to a hyperfilm MP (Amersham). Total RNA was isolated from cultured skin fibroblasts by Trizol (Life Technologies). Prior to cDNA synthesis, RNA samples were treated with RNase-free DNase (Life Technologies) to avoid genomic DNA contamination in the reverse transcriptase–PCR experiments. For the conversion to cDNA, Moloney murine leukemia virus reverse transcriptase was used in combination with random hexanucleotide primers. For detection of the MnlI polymorphisms in the COL1A1 gene, the primers and conditions used were those given by Sokolov et al., 1991Sokolov BP Prytkov AN Tromp G Knowlton RG Prockop DJ Exclusion of COL1A1, COL1A2, and COL3A1 genes as candidate genes for Ehlers-Danlos syndrome type I in one large family.Hum Genet. 1991; 88: 125-129Crossref PubMed Scopus (32) Google Scholar. After enzymatic digestion, the fragments were evaluated either by agarose electrophoresis or by separation on polyacrylamide gels by automated laser detection (ALF; Pharmacia). For the detection of the 4-bp insertion polymorphism in the 3′ end of the COL1A1 gene (Nuytinck et al., in pressNuytinck L, Coppin A, De Paepe A. A 4 bp insertion polymorphism in the 3′ UTR of the COL1A1 gene is highly informative for null-allele testing in patients with OI type I. Matrix Biol (in press)Google Scholar), the following primers were used: 5′-CCT TTC TGC TCC TTT CTC CA (sense primer) and 5′-AGC AAC ACA GTT ACA CAA GG (antisense primer). Approximately 500 ng of genomic DNA was amplified under the following conditions: 94°C for 1 min, 56°C for 1 min, and 72°C for 1 min, for 25 cycles. The products were separated on a 6% polyacrylamide gel by an automated laser fluorescent DNA sequencer (ALF; Pharmacia). A fragment of 430 bp (allele A1) and/or a fragment of 434 bp (allele A2) was obtained by use of size markers for correct fragment-length evaluation. To define the consensus sequences, genomic DNAs from eight unrelated probands with OI were used as separate templates for PCR with primers based on published sequences of the COL1A1 gene (Chu et al., 1985Chu M-L de Wet W Bernard M Ramirez F Fine structural analysis of the human proα1(I) collagen gene: promoter structure, AluI repeats, and polymorphic transcripts.J Biol Chem. 1985; 260: 2315-2320Abstract Full Text PDF PubMed Google Scholar; D'Alessio et al., 1988D'Alessio M Bernard M Pretorious P de Wet W Ramirez F Complete nucleotide sequence of the region encompassing the first twenty-five exons of the human proα1(I) collagen gene (COL1A1).Gene. 1988; 67: 105-115Crossref PubMed Scopus (57) Google Scholar; Määttä et al., 1991Määttä A Bornstein P Penttinen RP Highly conserved sequences in the 3′-untranslated region of the COL1A1 gene bind cell-specific nuclear proteins.FEBS Lett. 1991; 279: 9-13Crossref PubMed Scopus (21) Google Scholar; Westerhausen et al., 1991Westerhausen AI Constantinou C Pack M Peng M Hanning C Olsen A Prockop DJ Completion of the last half of the structure of the human gene for the proα1(I) chain of type I procollagen (COL1A1).Matrix. 1991; 11: 375-379Crossref PubMed Scopus (13) Google Scholar). The PCR reactions were performed with a commercial DNA polymerase (AmpliTaq® Gold; Perkin-Elmer) in a 40-μl volume, with thermal cycling at 95°C for 10 min, for one cycle, followed by 95°C for 40 s, 60°C for 40 s, and 72°C for 50 s, for 35 cycles. The PCR products ranged in size from 1 kb to 2.5 kb. Sequences were defined by automated sequencing (ABI PRISM™ 377 Sequencer; Perkin-Elmer; and ABI PRISM Dye Therminator Cycle Sequencing Ready Kit, with AmpliTaq DNA polymerase, FS; Perkin-Elmer). Prior to the sequencing, the samples were treated with exonuclease I, to degrade the residual PCR primers, and with shrimp alkaline phosphatase, to dephosphorylate the residual nucleotides (Hanke and Wink, 1994Hanke M Wink M Direct DNA sequencing of PCR-amplified vector inserts following enzymatic degradation of primer and dNTPs.Biotechniques. 1994; 17: 858-860PubMed Google Scholar; Werle et al., 1994Werle E Schneider C Renner M Volker M Fiehn W Convenient single-step, one tube purification of PCR products for direct sequencing.Nucleic Acids Res. 1994; 22: 4354-4355Crossref PubMed Scopus (530) Google Scholar). To sequence the 5′ end of the human COL1A2 gene, a 14-kb fragment spanning introns 1–21 was obtained from an EcoRI/EcoRI genomic fragment that had previously been cloned into bacteriophage in the course of the definition of one mutation that had been shown to cause OI (Vasan et al., 1991Vasan NS Kuivaniemi H Vogel BE Minor RR Wootton JAM Tromp G Weksberg R et al.A mutation in the proα2(I) gene (COL1A2) for type I procollagen in Ehlers-Danlos syndrome type VII: evidence suggesting that skipping of exon 6 in RNA splicing may be a common cause of the phenotype.Am J Hum Genet. 1991; 48: 305-317PubMed Google Scholar). The fragment was broken randomly by sonication, and the fragments were size separated by gel electrophoresis. The selected fragments were subcloned into a plasmid (pUC18), and 60 clones were isolated. Plasmid DNA from 13 color-selected colonies indicated that the inserts ranged in size from 500 to 4,000 bp. Approximately 90% of the sequences were recovered by shotgun sequencing of the clones. The remaining gaps were closed by sequencing the original bacteriophage clone containing the 14-kb genomic fragment, by manual or automated procedures. To complete the structure of the COL1A2 gene, a genomic P1 clone containing the complete human gene was obtained by PCR screening of human P1 library (Genome Systems). Screening was done by PCR amplification using primers designed on the basis of the published human cDNA sequences (de Wet et al., 1987de Wet W Bernard M Benson-Chanda V Chu M-L Dickson L Weil D Ramirez F Organization of the human proα2(I) collagen gene.J Biol Chem. 1987; 262: 16032-16036Abstract Full Text PDF PubMed Google Scholar; Kuivaniemi et al., 1988Kuivaniemi H Tromp G Chu M-L Prockop DJ Structure of a full-length cDNA clone for the preproα2(I) chain of human type I procollagen: comparison with the chick gene confirms unusual patterns of gene conservation.Biochem J. 1988; 252: 633-640Crossref PubMed Scopus (91) Google Scholar). The PCR primers were C1PF1 (5′-GTA CAT TTC CTA GAG AAC TTG) and C1PR1 (5′-CTA CTC TCA GCC CAG GAG GTC CTG), corresponding to sequences in intron 19 and exon 21/intron 21. Three positive clones were obtained: DMPC-HFF1 1250-E2, GS control 7403; DMPC-HFF1 1365-B1, GS control 7404; and DMPC-HFF1 1473-F6, GC control 7405. Because P1 clone 7407 was found to contain the entire coding sequences of the human COL1A2 gene, the clone was selected for detailed characterization of the gene. To increase the yield of DNA, P1 clone 7407 was transferred from Escherichia coli strain NS3529 to E. coli strain NS3516 via transduction, as suggested by Genome Systems. The P1 plasmid DNA was isolated by the method of Birnboim and Doly, 1979Birnboim HC Doly J A rapid alkaline extraction procedure for screening recombinant plasmid DNA.Nucleic Acids Res. 1979; 7: 1513-1523Crossref PubMed Scopus (9745) Google Scholar, with modifications suggested by Genome Systems. The isolated DNA was dissolved in water and was further purified, by spot dialysis with a membrane (VSWP 02500; Millipore), against water. Nucleotide sequencing was performed by cycle sequencing of the P1 clone (dsDNA Cycle Sequencing System; Life Technologies; and Cycle Sequencing Kit; Pharmacia Biotech). Sequencing primers for the COL1A2 gene were designed on the basis of published cDNA and genomic sequences (Bernard et al., 1983Bernard MP Myers JC Chu M-L Ramirez F Prockop DJ Structure of a cDNA for the proα2 chain of human type I procollagen: comparison with chick cDNA for proα2 (I) identifies structurally conserved features of the protein and the gene.Biochemistry. 1983; 22: 1139-1145Crossref PubMed Scopus (185) Google Scholar; de Wet et al., 1987de Wet W Bernard M Benson-Chanda V Chu M-L Dickson L Weil D Ramirez F Organization of the human proα2(I) collagen gene.J Biol Chem. 1987; 262: 16032-16036Abstract Full Text PDF PubMed Google Scholar; Kuivaniemi et al., 1988Kuivaniemi H Tromp G Chu M-L Prockop DJ Structure of a full-length cDNA clone for the preproα2(I) chain of human type I procollagen: comparison with the chick gene confirms unusual patterns of gene conservation.Biochem J. 1988; 252: 633-640Crossref PubMed Scopus (91) Google Scholar). Additional primers were designed on the basis of sequences obtained during the study. The 5′ end of the primer was labeled with T4 polynucleotide kinase (U.S. Biochemical) and [γ-33P]ATP (DuPont NEN). For cycle sequencing, 0.5–2.0 μg of P1 DNA was used as template, and thermal cycling was performed with a commercial instrument (either GeneAmp 9600; Perkin Elmer; or PTC 225 DNA Engine Tetrad; MJ-Research). Some of the nucleotide sequences were obtained by the Terminator Cycle Sequencing Ready Reaction kit and ABI PRISM 377 DNA Sequencer (Perkin-Elmer). The data were analyzed by means of the Wisconsin Sequence Analysis Package versions 8.0 and 8.1 UNIX (Genetics Computer Group) and the Editseq program from the Lasergene software package (DNAStar). Genomic DNA was extracted from blood samples or from cultured skin fibroblasts. The exons and the flanking sequences of the 51 exons of the COL1A1 gene and the 52 exons of the COL1A2 gene were amplified by a series of specific primers (table 2). Genomic DNA was amplified in a 40-μl volume, by thermal cycling at 95°C for 10 min, for one cycle, followed by 95°C for 40 s, 60°C for 40 s, and 72°C for 50 s, for 35 cycles. This was followed by heteroduplex formation steps: 95°C for 5 min and 68°C for 30 min. CSGE analysis was performed as described elsewhere, with the precaution that the taurine buffer was not autoclaved (Ganguly et al., 1993Ganguly A Rock M Prockop DJ Conformation-sensitive gel electrophoresis for rapid detection of single base differences in double-stranded PCR products and DNA fragments: evidence for solvent-induced bends in DNA heteroduplexes.Proc Natl Acad Sci USA. 1993; 90: 10325-10329Crossref PubMed Scopus (603) Google Scholar; Ganguly and Prockop, 1995Ganguly A Prockop DJ Detection of mismatched bases in double stranded DNA by gel electrophoresis.Electrophoresis. 1995; 16: 1830-1835Crossref PubMed Scopus (31) Google Scholar). The gels were examined with a hand-held UV illuminator (short wave), to identify regions containing bands of homoduplexes and heteroduplexes. Appropriate regions were cut from the gels, transferred to a filter paper, and analyzed further in a UV-image analyzer with a CCD camera (DOC-ITTM Gel Documentation System; UVP). The image from the monitor was recorded by a thermal printer. PCR products containing heteroduplexes were sequenced either manually (Sequenase PCR Product Sequencing Kit; USB) or by automated instrument (ABI PRISM 377 Sequencer; Perkin-Elmer; and ABI PRISM Dye Therminator Cycle Sequencing Ready Kit with AmpliTaq DNA polymerase, FS; Perkin-Elmer) after treatment with exonuclease I and shrimp alkaline phosphatase (Hanke and Wink, 1994Hanke M Wink M Direct DNA sequencing of PCR-amplified vector inserts following enzymatic degradation of primer and dNTPs.Biotechniques. 1994; 17: 858-860PubMed Google Scholar; Werle et al., 1994Werle E Schneider C Renner M Volker M Fiehn W Convenient single-step, one tube purification of PCR products for direct sequencing.Nucleic Acids Res. 1994; 22: 4354-4355Crossref PubMed Scopus (530) Google Scholar). PCR products that contained deletions in one allele were purified from agarose (QIAEX II Gel Extraction Kit; Qiagen). Approximately 60 ng of purified product was cloned into a plasmid (pT7 Blue T-Vector Kit; Novagen) and was sequenced.Table 2Oligonucleotide Primers for PCR Amplification of Promoter Regions, 103 Exons, and Flanking Sequences and Polyadenylation Signals of the COL1A1 And COL1A2 GenesCOL1A1COL1A2RegionSequencePositionSize (bp)SequencePositionSize (bp)Promoter: 5′atcctgaggacccagctgcac−387344gccacgtcccttcccccattc−312340 3′gttagcgtccgctcatgcgtg−44aagtccgcgtatccacaaagctgagcat28Exon: 1: 5′gacgggagtttctcctcggggtc−115321agttggaggtactggccacgactg−108315 3′gagtctccggatcatccacgtc103gcgttttcccacatgcctgag137 2: 5′gctgatgaggagcaggcgag−161333tgctgatccctgccatacttttgac−189280atccaagtgtgcctcttagac−90tcttcccttccaagagaagacatc80 3′gtttgctaatgctgctcccgtc108 3: 5′gctggaggcctctgccgacgggagcagc−71240gtgaaggtatatttgtatactacac−97279 3′ggcctcgggggccagtgtctc133tgttatcttaaacatcaaagctac167 4: 5′gcctctgccgacgggagcagc−201372cattgtagttacatcagtcttacc−112294 3′aggctgtccagggatgccatc135gcttcttctgcagtgcattacctg146 5: 5′acctggcctcttgtttcttctc−162386tccaccctacttgcacatagaaagg−110385 3′ctgtaggattcttgcaacttttct122gacaagggctcacaaagagaatggg182 6: 5′cacaccaggaagtgcatgatgtcag−99261tcggccaagtttttgacgtacagct−208338 3′ctcccaagctgtctataccagccgc90tggcgtggtaaaatgtgacataaaa76 7: 5′atacgcggctggtatagacag−166300gggaggaataaaaactatggaatc−125316 3′tctctgagcatctctcctgccctca89gaccagcttcaccaggctcac146 8: 5′tggagggaagactgggatgag−111247gtactgaaagcttgtaatgcctc−88223 3′aagacccaggcctgggagttcttct82ggagacccatcatttcactaagg81 9: 5′cccctggtgagcctggcgag−194347tgaacctggtcaaactgtgagtac−109273 3′ctgagtatcgttcccaaatgtg97tgtcaggcatattcagcttttggca110 10: 5′ctggggccccccaaacctgacctgc−120262accaagattcccccatttgtgctga−70344 3′ggccattagaacacactcactg88gttgcttatggtatgcttgctgtc220 11: 5′ctgaacctgggcttcactgcac−98292tttgtcgctctgtgcttagagg−143321 3′gatgtccactctctggcccttg140cttccctttggcaaactccagggat124 12: 5′caaagggatggcggtgatgac−111253gctgggacctggaacactggacttc−145260 3′ctgtagatcagagaataatgag88tggaggtcatggggaatttcaatca61 13: 5′gtaagaggctgtctgaacatc−88228gaacctggatatgtggtactatctg−212361 3′gtcagatgagatgggagacagc95gaatacaatgctgaaggatacagtg104 14: 5′ggtgagtgtgcccagttccag−117263cttgtacaggttggaaactgaac−94258 3′cgttaagtccactgagcactg92ccacgggcaccctaagaaga110 15: 5′gatccctgagctctggaaggggctc−83279ccgtgggcttcctggtgagag−148298 3′gagatggcagctgcaagtcac145tggtaaagtgtctgaaatgatgc105 16: 5′gggcgaggttatgttggtctg−102229caccctggataccatgaatgtc−187318 3′tttggggaacagggagacatgaacc73ctgcaaacacagttccaatctttca77 17: 5′ctgatcattgctctcctgtccctgt−103320cagtagccaagatggcagaatc−191462 3′accaggctgtccatcagcac118ccagtaaggccgtttgctccag172 18: 5′taagtgtccccgactcagtgtc−88220cgttggacctcctgtaagtag−156306 3′agccagggcgtgacgtaggag87aaaatgcagtgtggtccattagg105 19: 5′aagtatcctgccaggcttcag−101319taatgtgtgctgcctctacagc−64330 3′gaagaggatgagctgagagtc119catatagcagacgggagtgtac167 20: 5′caagggtaacagcgtgagtac−144348cttgagcttctctttaccttgac−106325 3′tgaggctgggcctccagtgtc150caccactgggaccaggaggac165 21: 5′ggctctgaggctggcacaggatg−65292cgtaagtagctctatcatcac−126363 3′ggaaaccacggctaccaggtc119aaggcagatggaaagcagatg129 22: 5′ccggaccccctggcgagcgtg−114278gggttgggtgaagtgttttggcttg−135268 3′cacaggaacagttagggtctc110gaggatgctaaagctaatgacac79 23: 5′cccaaggtaacctctccttgc−131309gctgtctatcacttacttcctag−109268 3′gatccggaacgcctcatcccaagac79tcaaaaatgcaactgtcagcaagac136 24: 5′gtcttgggatgaggcgttccggatc−110283aaaaagtcgggggaaaaggtgcctt−101349 3′gtccggggcgaccatcttgac119tctcccctgctctgctttcagtcct194 25: 5′gccctggcagccctggtcctg−129368tttcatccgtggcagcatcataagc−81276 3′tagggaggctgaggtccagaaagtg140ctgagactggactgattcgcag96 26: 5′agggcccagcaagaagcacctgc−160309tggagctgcatggtgatggatc−165298 3′gctgaggaccgtggcctctagc95tatcagatggtgtaaaaaaaaaagtgtggttcttagatg79 27: 5′cctgcaggaggggtgctagag−83239gctttcgtgggaacccacaatgagt−139315 3′cacagagagaacactacagtcac100tagcaacgtatgtcaccactg122 28: 5′ctgctgtgagtgtccctgatg−108247tggccatctccattttcagtc−92257 3′ggagggaaggtttagaatctg85tgcttcagtcctgaaatcatgt111 29: 5′ggtgaggcctcatggctgtc−112251gagctgtaaatcaccataccgtac−115333 3′tggctgtctgattagctaggaggcgg85tggctcattctctccatcagcac164 30: 5′gggttcctctctaatcacggccagac−110246tgcactcatgtagatactgccaggt−121264 3′agaagggaaggacagggcatgtgaag91gacttgttgcagggtcatcagtggc100 31: 5′cctctggagcaagagtaagtag−107318aaaccagggctcggaagctacacaa−102359 3′accccacaccctatctccatg112ggtccactggaatcggattgctgtt158 32: 5′tttctcaaggcttgtcgttggccttg−120291tctccctcctttcaatagcccagcc−152336 3′gattcaaaggaggcagagatgggagc63gtgaaaacttgggcatccttgtgca75 33: 5′cctctcaggaaacccagacacaagcaaExons 33 and 34 were fused for the COL1A1 gene.−87318gaatggtaaggaatcgagacattgc−148276 3′aatttggaaaattctcaattcaacataaaaaaaaatccaagtacgaag74 34: 5′ggagtaccctccttctgagagtggc−198330 3′gttcccaggttgacagctcagaExons 33 and 34 were fused for the COL1A1 gene.123attgctggggctctttgggactagg78 35: 5′gtcctgccaaactgagctgtc−129327actctgtgagatgtgcgtcag−137320 3′attggagagatgcgtctgacaggagg144gttggggccagcaggaccgac140 36: 5′ccctgtctgtgccttcaccccttgc−97249gaagccctgtaagtaagaacctg−112246 3′cttctcccctgaggatggctgac98gttacagctctggtattccgac80 37: 5′tgcctccattactgctcctcc−81276gatttgctggtccggctgtgag−113348 3′tgtaggagagcacagacgcatcaagc87cttccgttattttccatcttctatc127 38: 5′tgagtggcttggccctctgtg−97240tgcgggaatgatccacttgaagaaa−85283 3′agagggagaacagccaactcatccg99tcggaattgctctgaatagaatgaa144 39: 5′gagtatcacccgcctctctgttgagc−124259gaaattcccatcttacccaaattcttg−70263 3′tcagtcagccccaccatccttctg81gaaaagctgacttcagaccaggag139 40: 5′gtgggggctgccagaaggatg−94337cataaaggaagacaggagttgc−192447 3′tgaggtgccagacagcagcacag81catcaacaaatagatgccacttg93 41: 5′agtgccagctcagatctctgcagctc−98309ctcacaatcttcaagccaacctgtg−75258 3′gtccgctggagtcatctctac103tctgtcacatttgaagtggcagctt75 42: 5′gagaacagatttggtagagatgac−84329ggaggggaaggttagcattccatcg−64351 3′caggggaaccttcggcaccag135aaagcccattctttggcctaagcaa179 43: 5′cccatgccagtaccctcagcatggc−90242agggttcgttactgagcactg−110323 3′gggagagcaggggaatatgggtcag98ccacggggccatgaggaccag159 44: 5′gcaacactccatgaccacagc−96304atggtcaacccggacacaag−106331 3′cctgcctgggtgaagtccgac100caacttagctaggcccaagatac117 45: 5′ggagagagagatccagcagagggga−94246caacccagattgatgctaagcttc−288480 3′gggacaaactgtcaggcggaagttc98gtatcaattctcagcatggactg138 46: 5′catgccttcagaactctacag−90297gcagattaccagcagaggtgagagc−145320 3′ggggaaagaatgactatccag99tgaaaatccttctgagctgaaggcc67 47: 5′gttgcccacactgcccttgtc−92249tcccattgaatttggaaaaaaaaaaaatatgtctcttgac−81257 3′aacccttctccagagaggcaaaggg103gacaccaggtacatgtgagctg114 48: 5′ccgtggggccagagccagcag−102299caagagaagacagttcatctctg−115326 3′gcacagagagggaagagagtgggga89tggggctaactttaatgggttgtc103 49: 5′gctggtcctgttgtatgtagc−103475gaacatgcttccgtgtgaagctc−102535 3′ccagcaccatatggtaggggcacat89agggaaatgaggttgggtgctggtt177" @default.
• W1970787573 created "2016-06-24" @default.
• W1970787573 creator A5030828941 @default.
• W1970787573 creator A5036173636 @default.
• W1970787573 creator A5038704651 @default.
• W1970787573 creator A5047673414 @default.
• W1970787573 creator A5060290280 @default.
• W1970787573 creator A5088607690 @default.
• W1970787573 date "1998-01-01" @default.
• W1970787573 modified "2023-10-16" @default.
• W1970787573 title "Analysis of the COL1A1 and COL1A2 Genes by PCR Amplification and Scanning by Conformation-Sensitive Gel Electrophoresis Identifies Only COL1A1 Mutations in 15 Patients with Osteogenesis Imperfecta Type I: Identification of Common Sequences of Null-Allele Mutations" @default.
• W1970787573 cites W109746061 @default.
• W1970787573 cites W1517703297 @default.
• W1970787573 cites W1521713956 @default.
• W1970787573 cites W1579073579 @default.
• W1970787573 cites W1583215340 @default.
• W1970787573 cites W1587602433 @default.
• W1970787573 cites W1590867663 @default.
• W1970787573 cites W1964377753 @default.
• W1970787573 cites W1965950166 @default.
• W1970787573 cites W1982956225 @default.
• W1970787573 cites W1994545236 @default.
• W1970787573 cites W1994645387 @default.
• W1970787573 cites W1999624953 @default.
• W1970787573 cites W2002100378 @default.
• W1970787573 cites W2002823265 @default.
• W1970787573 cites W2011640110 @default.
• W1970787573 cites W2015746101 @default.
• W1970787573 cites W2018289835 @default.
• W1970787573 cites W2019410656 @default.
• W1970787573 cites W2032319180 @default.
• W1970787573 cites W2048615756 @default.
• W1970787573 cites W2064429308 @default.
• W1970787573 cites W2068616414 @default.
• W1970787573 cites W2072527511 @default.
• W1970787573 cites W2076321530 @default.
• W1970787573 cites W2076978982 @default.
• W1970787573 cites W2083334219 @default.
• W1970787573 cites W2090238172 @default.
• W1970787573 cites W2097707959 @default.
• W1970787573 cites W2100837269 @default.
• W1970787573 cites W2129201414 @default.
• W1970787573 cites W2131950737 @default.
• W1970787573 cites W2134975191 @default.
• W1970787573 cites W2147293998 @default.
• W1970787573 cites W2286683073 @default.
• W1970787573 cites W2400212730 @default.
• W1970787573 cites W2413362246 @default.
• W1970787573 cites W2417578991 @default.
• W1970787573 cites W2476542314 @default.
• W1970787573 cites W295475211 @default.
• W1970787573 cites W41751146 @default.
• W1970787573 cites W57824037 @default.
• W1970787573 doi "https://doi.org/10.1086/301689" @default.
• W1970787573 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1376813" @default.
• W1970787573 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9443882" @default.
• W1970787573 hasPublicationYear "1998" @default.
• W1970787573 type Work @default.
• W1970787573 sameAs 1970787573 @default.
• W1970787573 citedByCount "163" @default.
• W1970787573 countsByYear W19707875732012 @default.
• W1970787573 countsByYear W19707875732013 @default.
• W1970787573 countsByYear W19707875732014 @default.
• W1970787573 countsByYear W19707875732015 @default.
• W1970787573 countsByYear W19707875732016 @default.
• W1970787573 countsByYear W19707875732017 @default.
• W1970787573 countsByYear W19707875732018 @default.
• W1970787573 countsByYear W19707875732019 @default.
• W1970787573 countsByYear W19707875732020 @default.
• W1970787573 countsByYear W19707875732021 @default.
• W1970787573 countsByYear W19707875732022 @default.
• W1970787573 countsByYear W19707875732023 @default.
• W1970787573 crossrefType "journal-article" @default.
• W1970787573 hasAuthorship W1970787573A5030828941 @default.
• W1970787573 hasAuthorship W1970787573A5036173636 @default.
• W1970787573 hasAuthorship W1970787573A5038704651 @default.
• W1970787573 hasAuthorship W1970787573A5047673414 @default.
• W1970787573 hasAuthorship W1970787573A5060290280 @default.
• W1970787573 hasAuthorship W1970787573A5088607690 @default.
• W1970787573 hasBestOaLocation W19707875731 @default.
• W1970787573 hasConcept C104317684 @default.
• W1970787573 hasConcept C105702510 @default.
• W1970787573 hasConcept C116834253 @default.
• W1970787573 hasConcept C153911025 @default.
• W1970787573 hasConcept C2777668750 @default.
• W1970787573 hasConcept C49105822 @default.
• W1970787573 hasConcept C54355233 @default.
• W1970787573 hasConcept C59822182 @default.
• W1970787573 hasConcept C70721500 @default.
• W1970787573 hasConcept C86803240 @default.
• W1970787573 hasConceptScore W1970787573C104317684 @default.
• W1970787573 hasConceptScore W1970787573C105702510 @default.
• W1970787573 hasConceptScore W1970787573C116834253 @default.
• W1970787573 hasConceptScore W1970787573C153911025 @default.
• W1970787573 hasConceptScore W1970787573C2777668750 @default.
• W1970787573 hasConceptScore W1970787573C49105822 @default.
• W1970787573 hasConceptScore W1970787573C54355233 @default.
• W1970787573 hasConceptScore W1970787573C59822182 @default.

• next