FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1970889679> ?p ?o ?g. }

• W1970889679 endingPage "1021.e1" @default.
• W1970889679 startingPage "1013" @default.
• W1970889679 abstract "•CIK-mediated cytotoxicity of CD56+ target cells is blocked by anti-CD56 mAb•CD56 knockdown in CIK cells results in reduced cytotoxicity against CD56+ cells•CD56 knockdown in AML-NS8 negatively affect CIK-mediated lysis•We propose a mechanism of target cell recognition through homophilic CD56 binding Cytokine-induced killer (CIK) cells are in-vitro-expanded T lymphocytes that represent a heterogeneous population. A large majority of CIK cells are CD3+CD56+, and this population has been shown to confer a cytotoxic effect against tumor targets. The scope of this work was to study whether CD56 has a direct role in CIK-mediated cytotoxicity. Blocking of CD56 with the anti-CD56 monoclonal antibody GPR165 significantly reduced CIK-mediated lysis of three CD56+ hematopoietic tumor cell lines (AML-NS8, NB4, and KCL22), whereas no effect was observed on three CD56− hematopoietic tumor cell lines (K562, REH, and MOLT-4). Knockdown of CD56 in CIK cells by short interfering RNA made the cells less cytotoxic against a CD56+ target, and knockdown of CD56 in target cells with lentiviral short hairpin RNA significantly altered their susceptibility to CIK-mediated lysis. Our data suggest that homophilic interaction between CD56 molecules may occur in tumor-cell recognition, leading to CIK-mediated cell death. Cytokine-induced killer (CIK) cells are in-vitro-expanded T lymphocytes that represent a heterogeneous population. A large majority of CIK cells are CD3+CD56+, and this population has been shown to confer a cytotoxic effect against tumor targets. The scope of this work was to study whether CD56 has a direct role in CIK-mediated cytotoxicity. Blocking of CD56 with the anti-CD56 monoclonal antibody GPR165 significantly reduced CIK-mediated lysis of three CD56+ hematopoietic tumor cell lines (AML-NS8, NB4, and KCL22), whereas no effect was observed on three CD56− hematopoietic tumor cell lines (K562, REH, and MOLT-4). Knockdown of CD56 in CIK cells by short interfering RNA made the cells less cytotoxic against a CD56+ target, and knockdown of CD56 in target cells with lentiviral short hairpin RNA significantly altered their susceptibility to CIK-mediated lysis. Our data suggest that homophilic interaction between CD56 molecules may occur in tumor-cell recognition, leading to CIK-mediated cell death. Cytokine-induced killer (CIK) cells are lymphocytes activated ex vivo by the sequential addition of IFN-γ, anti-CD3 antibody (OKT3), and high doses of recombinant human interleukin 2 (rhIL-2) [1Schmidt-Wolf I.G. Negrin R.S. Kiem H.P. Blume K.G. Weissman I.L. Use of a SCID mouse/human lymphoma model to evaluate cytokine-induced killer cells with potent antitumor cell activity.J Exp Med. 1991; 174: 139-149Crossref PubMed Scopus (543) Google Scholar, 2Linn Y.C. Lau L.C. Hui K.M. Generation of cytokine-induced killer cells from leukaemic samples with in vitro cytotoxicity against autologous and allogeneic leukaemic blasts.Br J Haematol. 2002; 116: 78-86Crossref PubMed Scopus (96) Google Scholar]. Their expansion was first described in 1991 by Schmidt Wolf et al. [1Schmidt-Wolf I.G. Negrin R.S. Kiem H.P. Blume K.G. Weissman I.L. Use of a SCID mouse/human lymphoma model to evaluate cytokine-induced killer cells with potent antitumor cell activity.J Exp Med. 1991; 174: 139-149Crossref PubMed Scopus (543) Google Scholar] as an improved protocol to produce high numbers of cytotoxic effector cells that target lymphoma cells. At the end of the expansion, CIK cells represent a heterogeneous population, wherein the CD3+CD56+ cells have been shown to confer the cytotoxic effect against tumor targets [3Franceschetti M. Pievani A. Borleri G. et al.Cytokine-induced killer cells are terminally differentiated activated CD8 cytotoxic T-EMRA lymphocytes.Exp Hematol. 2009; 37: 616-628.e612Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar]. We have previously shown that the CD3+CD56+ population of CIK cells originates from CD56−CD8+ T-cell progenitors that strongly expand in culture in the presence of IL-2 and acquire the CD56 antigen [3Franceschetti M. Pievani A. Borleri G. et al.Cytokine-induced killer cells are terminally differentiated activated CD8 cytotoxic T-EMRA lymphocytes.Exp Hematol. 2009; 37: 616-628.e612Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar]. CD56 is a glycoprotein of the immunoglobulin (Ig) superfamily expressed on the surface of various cells of the brain and skeletal muscle, as well as on natural killer (NK) cells, NK-T cells, and in-vitro-expanded CIK cells. Several isoforms of CD56 can be generated by alternative splicing and posttranslational modifications (reviewed by Walmod et al. [4Walmod P.S. Kolkova K. Berezin V. Bock E. Zippers make signals: NCAM-mediated molecular interactions and signal transduction.Neurochem Res. 2004; 29: 2015-2035Crossref PubMed Scopus (157) Google Scholar]). CD56 has been most extensively studied in the brain, where it is traditionally referred to as neural cell adhesion molecule (NCAM). In neural cells, CD56 has been shown to be involved in cell-to-cell interactions through homophilic binding as well as with other molecules through heterophilic binding. The function of CD56 in the brain is regulated by posttranslational modifications with polysialic acid, which appears to reduce homophilic binding, thereby promoting heterophilic interactions (reviewed by Dallèrac et al. [5Dallérac G. Rampon C. Doyère V. NCAM function in the adult brain: lessons from mimetic peptides and therapeutic potential.Neurochem Res. 2013; 38: 1163-1173Crossref PubMed Scopus (24) Google Scholar]). In addition to being expressed on the surface of neural cells, where it is involved in cell-to-cell interactions and is important for brain development and cognitive processes in the adult brain, CD56 is also present on peripheral blood cells (NK and NK-T cells) and on in-vitro-expanded cytotoxic lymphocytes (e.g., CIK cells). Recently, dendritic cells have also been shown to be able to adopt a CD56+ phenotype and acquire cytotoxic functions [6Roothans D. Smits E. Lion E. Tel J. Anguille S. CD56 marks human dendritic cell subsets with cytotoxic potential.Oncoimmunology. 2013; 2: e23037Crossref PubMed Scopus (27) Google Scholar]. The expression of CD56 in various populations of cytotoxic cells suggests that it may have a role in cell-mediated cytotoxicity. However, there is a controversy in published reports on this subject. Whereas some studies indicate a direct involvement of CD56 in the cytotoxicity of NK cells [7Nitta T. Yagita H. Sato K. Okumura K. Involvement of CD56 (NKH-1/Leu-19 antigen) as an adhesion molecule in natural killer-target cell interaction.J Exp Med. 1989; 170: 1757-1761Crossref PubMed Scopus (126) Google Scholar, 8Takasaki S. Hayashida K. Morita C. Ishibashi H. Niho Y. CD56 directly interacts in the process of NCAM-positive target cell-killing by NK cells.Cell Biol Int. 2000; 24: 101-108Crossref PubMed Scopus (21) Google Scholar], another report concluded that homophilic CD56 interactions probably do not mediate a major role in the cytolytic interaction between NK cells and CD56+ tumor cell targets [9Lanier L.L. Chang C. Azuma M. Ruitenberg J.J. Hemperly J.J. Phillips J.H. Molecular and functional analysis of human natural killer cell-associated neural cell adhesion molecule (N-CAM/CD56).J Immunol. 1991; 146: 4421-4426PubMed Google Scholar]. In the present study, we addressed the question of whether CD56 plays a role in CIK-mediated cytotoxicity against a panel of hematopoietic tumor cell lines using a blocking anti-CD56 antibody and CD56 knockdown in target and effector cells. We depleted CIK cultures of CD56+ cells at the start of culture. Cells were prepared from peripheral blood mononuclear cells (PBMCs) obtained from healthy donors by Ficoll-Hypaque density centrifugation (Cedarlane, Burlington, Canada) as previously described [3Franceschetti M. Pievani A. Borleri G. et al.Cytokine-induced killer cells are terminally differentiated activated CD8 cytotoxic T-EMRA lymphocytes.Exp Hematol. 2009; 37: 616-628.e612Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar]. Briefly, CD56-depleted fractions were separated from PBMCs by negative selection with CD56 microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and cultured in serum-free X-VIVO 15 medium (BioWhittaker, Walkersville, MD) with 1000 U/mL IFN-γ (Boehringer Ingelheim, Ingelheim Germany) added on day 0, 50 ng/mL anti-CD3 monoclonal antibody (mAb; Janssen-Cilag, Schaffhausen, Switzerland) added on day 1, and 500 U/mL rhIL-2 (Novartis, Basilea, Switzerland) included in the medium from day 1 onward. Expansion was performed for 21–28 days. Natural killer cells were prepared from PBMCs obtained from healthy donors by Ficoll-Hypaque density centrifugation followed by NK-cell isolation with NK-cell isolation kit (Miltenyi Biotec). The human cell lines K562 (erythroleukemia), KCL22 (chronic myeloid leukemia in blast crisis), NB4 (acute promyelocytic leukemia), MOLT-4 (acute lymphoblastic leukemia), and REH (B cell precursor leukemia) were maintained in RPMI-1640 medium (Cambrex Bio Science, Walkersville, MD), supplemented with 10% fetal bovine serum (Euroclone, Milan, Italy), and 2 mmol/L L-glutamine (Euroclone). AML-NS8 (acute myeloid leukemia) was maintained in RPMI-1640 medium and supplemented with 20% fetal bovine serum and 2 mmol/L L-glutamine. Chinese hamster ovary (CHO) cells were maintained and transfected as described in Supplementary Methods (online only, available at www.exphem.org). We characterized CIK cells by use of the phycoerytrhin (PE)-conjugated anti-CD56 clone NCAM16.2 (BD Biosciences, Franklin Lakes, NJ) and fluorescein isothiocyanate-conjugated anti-CD3 clone SK7 (BD Biosciences). The anti-CD56 clone B159 (IgG1) and clone GPR165 (IgG2a) [10Pende D. Parolini S. Pessino A. et al.Identification and molecular characterization of NKp30, a novel triggering receptor involved in natural cytotoxicity mediated by human natural killer cells.J Exp Med. 1999; 190: 1505-1516Crossref PubMed Scopus (604) Google Scholar], followed by FITC-conjugated goat-antimouse Ig second reagent (BD Biosciences), were also used. Mean relative fluorescence intensity (MRFI) indicates the ratio between mean fluorescence intensity (MFI) of cells stained with the relevant mAb and that of cells with the isotype-matched negative control. A FACScanto II flow cytometer (BD Biosciences) was used to analyze the samples, and the Facsdiva software (BD Biosciences) was used to analyze the results. For protein expression analyses, cells were collected, washed in saline, and lysed in RIPA buffer containing protease inhibitor cocktail (Thermo Scientific, Waltham, MA). Protein concentration was determined with the Bradford assay (Bio-Rad, Hercules, CA). Equal amounts of total proteins were analyzed in Western blotting according to standard procedures. For Western blotting, anti-CD56 mAb clone 123C3 (Santa Cruz Biotechnology, Santa Cruz, CA) was used. Anti-β-actin mAb (Santa Cruz, Dallas, TX) and anti-α sodium potassium ATPase antibody (Abcam, Cambridge, United Kingdom) were used as loading controls. Detection was performed using horseradish peroxidase–labeled secondary antibodies (Santa Cruz Biotechnology) and Super Signal West Pico or Dura Chemiluminescent Substrate (Pierce, Rockford, IL). Cell lysis by CIK cells was evaluated with the calcein release assay as previously described [11Introna M. Franceschetti M. Ciocca A. et al.Rapid and massive expansion of cord blood-derived cytokine-induced killer cells: An innovative proposal for the treatment of leukemia relapse after cord blood transplantation.Bone Marrow Transplant. 2006; 38: 621-627Crossref PubMed Scopus (80) Google Scholar], with the exception that 7 μmol/L Calcein-AM (Sigma-Aldrich, St. Lois, MO) was used to label the target cells. At least three replicates were done for each sample, and each experiment was performed at least three times. For masking experiments, CIK cells were preincubated for 15 min in the presence of 30 μg/mL anti-CD56 mAb clone GPR165 [10Pende D. Parolini S. Pessino A. et al.Identification and molecular characterization of NKp30, a novel triggering receptor involved in natural cytotoxicity mediated by human natural killer cells.J Exp Med. 1999; 190: 1505-1516Crossref PubMed Scopus (604) Google Scholar] (IgG2a), an isotype control mAb (anti-CD20-1F5, IgG2a) or saturating amounts of anti-CD56 clone B159 before use in cytolytic assay. For masking experiments involving only effector or target cells, CIK, AML-NS8, or MOLT-4 were incubated for 15 min in the presence of 30 μg/mL anti-CD56 mAb clone GPR165. The cells were then washed twice in cell medium before use in cytolytic assay. The calcein release into the supernatant was measured with FLUOStar Optima (BMG Labtech, Ortenberg, Germany) and analyzed with the MARS data analysis software (BMG Labtech). Percentage-specific lysis was calculated with the following formula: %-specific lysis = [(sample lysis - spontaneous lysis)/(maximum lysis - spontaneous lysis)] × 100%. Relative lysis was calculated with the following formula: % relative lysis = (%-specific lysis treated sample/%-specific lysis untreated control) × 100%. For the temporary knockdown of CD56 in CIK cells, a siGENOME SMARTpool siRNA (2 μmol/L) was electroporated into 5 × 106 CIK cells at d+18 using Human T Cell Nucleofector Kit (Lonza, Basel, Switzerland) and Nucleofector program U014, following the manufacturer's instructions. siRNAs were: siCD56 pool (against CD56) and nontarget siRNA (siNT) pool (Thermo Scientific). Successful knockdown was confirmed with direct immunofluorescence using allophycocyanin (APC)-conjugated anti-CD56 antibody clone NCAM16.2 (BD Bioscience), and samples were analyzed with FACScanto II flow cytometer (BD Biosciences). For the stable knockdown of CD56 in AML-NS8 cells, MISSION shRNA clones TRCN0000073460 (shRNA1), TRCN0000073461 (shRNA2), TRCN0000373032 (shRNA3), TRCN0000373034 (shRNA4), and TRCN0000373085 (shRNA; Sigma-Aldrich) were used. Lentiviral particles containing the MISSION shRNA clones were produced in HEK293 cells utilizing the ViraPower Lentiviral Expression System (Invitrogen, Carlsbad, CA) following the manufacturer's instructions and were used to transduce early-passage AML-NS8 cells. Stable MISSION shRNA-transduced cells were selected and maintained with puromycin (0.3 μg/mL). As a negative control, the nontarget (NT) shRNA clone SHC216 (Sigma-Aldrich) was used. Successful knockdown was confirmed with direct immunofluorescence using APC-conjugated anti-CD56 antibody clone NCAM16.2 (BD Bioscience), and samples were analyzed with a FACScanto II flow cytometer (BD Biosciences). Total RNA was extracted using Trizol (Invitrogen). Subsequently, the RNA was treated with Turbo DNA-free DNase (Ambion, Austin, TX) for 30 min at 37°C to remove any contaminating DNA. The yield was determined using Optima FLUOstar (BMG Labtech). First-strand cDNA synthesis and relative quantitative real-time polymerase chain reaction (PCR) using SYBR green (Roche, Basilea, Switzerland) was carried out as previously described [12Capelli C. Gotti E. Morigi M. et al.Minimally manipulated whole human umbilical cord is a rich source of clinical-grade human mesenchymal stromal cells expanded in human platelet lysate.Cytotherapy. 2011; 13: 786-801Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar]. Total CD56 transcripts were amplified with forward primer 5′ TGAATGTGCCACCTACCATCC3′ and reverse primer 5′ TTCCCCATCCTTTGTCCAGC 3′. The following primers were used to amplify CD56 isoform specific transcripts: 120 kDa-FWD 5′CACAGCCATCCCAGCAACCTTG 3′, 120 kDa-REV 5′ TCCAAAGGGGGCACTGATCTT 3′, 140 kDa-FWD 5′CACTGACGGAGCCCGAGAAG3′, 140 kDa-REV 5′TCATGCTTTGCTCTCGTTCTCC3′, 180 kDa-FWD 5′ GACCCCAGATATTGACCTTGC 3′, and 180 kDa-REV 5′CCTTCTCGGTCTTTGCTGGC 3′. The RPL13A transcript was used as a normalization control, forward primer 5′CCTGGAGGAGAAGAAAGAGA-3′, reverse primer 5′-TTGAGGACCTCTGTGTATTTGTCAA-3′. A standard curve was performed for each amplicon and used to estimate the PCR amplification efficiency. Relative quantification was performed using the comparative Cycle threshold (Ct) 2-ΔCt method. The Student t test was used to compare experimental groups, with p < 0.05 considered statistically significant. To avoid NK cell contamination in the CIK culture, PBMCs were depleted of CD56+ cells before culture start, as previously reported [3Franceschetti M. Pievani A. Borleri G. et al.Cytokine-induced killer cells are terminally differentiated activated CD8 cytotoxic T-EMRA lymphocytes.Exp Hematol. 2009; 37: 616-628.e612Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 13Pievani A. Borleri G. Pende D. et al.Dual-functional capability of CD3+CD56+ CIK cells, a T-cell subset that acquires NK function and retains TCR-mediated specific cytotoxicity.Blood. 2011; 118: 3301-3310Crossref PubMed Scopus (176) Google Scholar]. The percentage of CD56+ cells in CIK cultures gradually increased during the expansion (Fig. 1A), until it reached its maximum at between 21–28 days, in accordance with earlier reports [3Franceschetti M. Pievani A. Borleri G. et al.Cytokine-induced killer cells are terminally differentiated activated CD8 cytotoxic T-EMRA lymphocytes.Exp Hematol. 2009; 37: 616-628.e612Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 13Pievani A. Borleri G. Pende D. et al.Dual-functional capability of CD3+CD56+ CIK cells, a T-cell subset that acquires NK function and retains TCR-mediated specific cytotoxicity.Blood. 2011; 118: 3301-3310Crossref PubMed Scopus (176) Google Scholar]. As previously described [3Franceschetti M. Pievani A. Borleri G. et al.Cytokine-induced killer cells are terminally differentiated activated CD8 cytotoxic T-EMRA lymphocytes.Exp Hematol. 2009; 37: 616-628.e612Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 13Pievani A. Borleri G. Pende D. et al.Dual-functional capability of CD3+CD56+ CIK cells, a T-cell subset that acquires NK function and retains TCR-mediated specific cytotoxicity.Blood. 2011; 118: 3301-3310Crossref PubMed Scopus (176) Google Scholar], at the peak of culture, CD3+CD56+ cells represented the predominant population. The cultures did not contain NK cells. Several isoforms of CD56 can be generated by alternative splicing and by posttranslational modifications. To identify the isoforms expressed by CIK cells, we analyzed the expression of total CD56 transcripts and of the three major CD56 isoforms at various time points of the expansion by quantitative PCR (Fig. 1B and C). The increase in total CD56 RNA and the 140 kDa isoform (National Center for Biotechnology Information, Reference Sequence: NM_181351.4) was closely correlated to the increase in CD56+ phenotype. A small amount of the 120 kDa isoform transcript was present at d+21, whereas the transcript corresponding to the 180 kDa isoform was not found in CIK cultures at any time point of the expansion. Western blotting with anti-CD56 mAb of total proteins from CIK cells at day 21 of expansion and from fresh NK cells revealed a band of approximately 200 kDa for both cell types (Fig. 1D). No corresponding band was found in the MOLT-4 cell line. We first tested CIK-mediated cytotoxicity against a panel of hematopoietic tumor cell lines (K562, MOLT-4, REH, KCL22, NB4, and AML-NS8) and found that the CIK cells were able to mediate cell lysis of all the tumor cell lines tested in a 4-hour assay with specific lysis that varied from 10% to 35% at a 10:1 E:T ratio (Fig. 2A). To examine whether CD56 is important in CIK-mediated cytotoxicity, we tested the blocking effect of two anti-CD56 antibodies on the assay outcome. B159 is a commercial anti-CD56 mAb, whereas GPR165 mAb was previously described as anti-CD56 [10Pende D. Parolini S. Pessino A. et al.Identification and molecular characterization of NKp30, a novel triggering receptor involved in natural cytotoxicity mediated by human natural killer cells.J Exp Med. 1999; 190: 1505-1516Crossref PubMed Scopus (604) Google Scholar] and was also shown by immunostaining of CHO cells transfected with the 140 kDa isoform of CD56 (Supplementary Figure E1, online only, available at www.exphem.org) to be specific for CD56. Staining of CIK cells resulted in identical profiles with the two mAbs. The anti-CD56 B159 mAb did not significantly affect CIK-mediated cytotoxicity against any of the cancer cell lines tested. On the other hand, the anti-CD56 GPR165 mAb significantly reduced the specific lysis of three out of six target cell lines tested, namely, AML-NS8, NB4, and KCL22 (Fig. 2A). The blocking effect was found to be dose dependent (Fig. 2B), indicating that the amount of antibody used was not saturating. Preincubation with 30 μg of isotype control mAb (1F5, IgG2a) did not affect CIK-mediated lysis of AML-NS8 and NB4 (Supplementary Figure E2, online only, available at www.exphem.org). Neither GPR165 nor B159 had a negative effect on the CIK cell survival in a 4-hour assay. We analyzed the CD56 phenotype of the six tumor cell lines by flow cytometry. Remarkably, the three cell lines whose CIK-mediated lysis was shown to be affected by mAb-mediated CD56 blocking (KCL22, AML-NS8, and NB4), all expressed CD56 (Fig. 2C). On the other hand, the three cancer cell lines whose lysis was not affected in the same experimental conditions either did not express CD56 on their surface (K562 and REH) or expressed CD56 at a very low level (MOLT-4; Fig. 2C). In the blocking assay with GPR165 described above, the antibody was not removed from the cells after preincubation; therefore, it is highly probable that the antibody also bound to CD56 expressed on target cells. To assay whether the observed blocking could be attributed to the CD56 on CIK or on target cells independently, we incubated either CIK or target cells in the presence of the blocking antibody, washed the cells, and used them in a cytotoxicity assay. Blocking of CD56 on either effector (Fig. 2D) or target (Fig. 2E) cells significantly inhibited the lysis of AML-NS8 cells, whereas the lysis of MOLT-4 was not significantly affected by blocking of effector cells or target cells (Fig. 2D and E). Addition of isotype control mAb 1F5, IgG2a, did not significantly modify cytotoxicity results (Fig. 2D and E). To further document the relevance of CD56 in CIK cells, we transiently knocked down the expression of CD56 protein through electroporation with a pool of anti-CD56 siRNAs. The transfection did not significantly alter CD56 expression of siNT cells (Fig. 3A). In contrast, we observed on average a 40% (range 35% to 52%) reduction of the number of CD56-expressing cells in the siCD56-transfected cells, and the mean fluorescent intensity of CD56+ cells decreased by about 1 log (Fig. 3A), suggesting that CD56 expression in the remaining CD56+ cells was significantly reduced. These cells were used in a cytotoxic assay against AML-NS8 and MOLT-4 target cells (Fig. 3B). The knockdown of the CD56 molecule on effector cells reduced their lysis of AML-NS8 to about 50% as compared to the mock transfected cells (p < 0.05), whereas the lysis of MOLT-4 was not affected. These data confirm results obtained with the anti-CD56 blocking mAb and indicate that CD56 expression on the surface of CIK cells is important for the cytotoxicity against CD56+ target cells. In light of the results above, and to examine whether CD56 expressed on target cells is necessary for CIK-mediated lysis, we decided to knock down CD56 expression in the CD56+ target cell line AML-NS8. Five MISSION lentiviral shRNA clones targeting the CD56 transcript at various points (Fig. 4A) were tested for CD56 knockdown. As a control, AML-NS8 was also transfected with a NT shRNA clone. The CD56 knockdown efficiency varied greatly among the clones (Fig. 4B). We chose the shRNA5 clone for the assessment of CIK-mediated cytotoxicity. Despite successful knockdown with the shRNA5 clone, a small percentage of cells still expressed CD56 on their surface. To completely remove the CD56+ cells, we performed a depletion using anti-CD56 microbeads (Miltenyi; AML-NS8 shRNA5 DEPL). Flow cytometry analysis confirmed successful CD56 depletion (Fig. 4C). All cell lines had comparable proliferation index. We next tested whether the knockdown and subsequent depletion of CD56 on the target cell line would affect CIK-mediated lysis. As shown in Figure 4D, the lysis of shRNA5 cells was similar to that of the parental or shRNA NT cells, whereas complete depletion of CD56 on target cells (shRNA5 DEPL) resulted in around 30% reduction of CIK-mediated lysis as compared with the parental and NT shRNA cells. This reduction was found to be statistically significant. In this article, we have analyzed the role of CD56 in CIK cells derived from NK-cell-depleted PBMCs. We show that CD56 is important for CIK-mediated cytotoxicity against CD56+ hematopoietic target cells and propose a mechanism for target-cell recognition in CIK-mediated cytotoxicity. The procedure for CIK expansion in vitro from PBMCs was first described in the early 1990s [1Schmidt-Wolf I.G. Negrin R.S. Kiem H.P. Blume K.G. Weissman I.L. Use of a SCID mouse/human lymphoma model to evaluate cytokine-induced killer cells with potent antitumor cell activity.J Exp Med. 1991; 174: 139-149Crossref PubMed Scopus (543) Google Scholar]. At the end of the expansion, the CIK cell cultures were shown to represent a heterogeneous cell population, where the predominant subset, characterized by the highest cytotoxic activity, expressed both the T-cell marker CD3 and the NK-cell marker CD56 [14Lu P.H. Negrin R.S. A novel population of expanded human CD3+CD56+ cells derived from T cells with potent in vivo antitumor activity in mice with severe combined immunodeficiency.J Immunol. 1994; 153: 1687-1696PubMed Google Scholar]. As previously reported by our group [3Franceschetti M. Pievani A. Borleri G. et al.Cytokine-induced killer cells are terminally differentiated activated CD8 cytotoxic T-EMRA lymphocytes.Exp Hematol. 2009; 37: 616-628.e612Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 13Pievani A. Borleri G. Pende D. et al.Dual-functional capability of CD3+CD56+ CIK cells, a T-cell subset that acquires NK function and retains TCR-mediated specific cytotoxicity.Blood. 2011; 118: 3301-3310Crossref PubMed Scopus (176) Google Scholar], the CD3+CD56+ cells originate in vitro from CD56−CD8+ T-cell progenitors that strongly expand in culture and acquire the CD56 antigen, whereas the CD56+ cells present in the PBMCs maintain their phenotype but do not expand. It is therefore possible to deplete the PBMCs of CD56+ cells on the first day of culture to eliminate NK cells (CD3−CD56+) and circulating NK-T cells (CD3+CD56+), and still obtain CIK cells that are identical to those derived from unselected PBMCs [13Pievani A. Borleri G. Pende D. et al.Dual-functional capability of CD3+CD56+ CIK cells, a T-cell subset that acquires NK function and retains TCR-mediated specific cytotoxicity.Blood. 2011; 118: 3301-3310Crossref PubMed Scopus (176) Google Scholar], thus avoiding the possibility that CIK-mediated effects are contributed to NK and NK-T cells in the culture. The percentage of CD56+ cells in the CD56-depleted CIK culture gradually increased during the expansion until it reached its maximum at 21–28 days, in accordance with earlier reports [3Franceschetti M. Pievani A. Borleri G. et al.Cytokine-induced killer cells are terminally differentiated activated CD8 cytotoxic T-EMRA lymphocytes.Exp Hematol. 2009; 37: 616-628.e612Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 13Pievani A. Borleri G. Pende D. et al.Dual-functional capability of CD3+CD56+ CIK cells, a T-cell subset that acquires NK function and retains TCR-mediated specific cytotoxicity.Blood. 2011; 118: 3301-3310Crossref PubMed Scopus (176) Google Scholar]. Several CD56 isoforms can be generated by alternative splicing and by posttranslational modifications. The three most abundant isoforms are referred to by their molecular masses as 120, 140, and 180 kDa (reviewed by Walmod [4Walmod P.S. Kolkova K. Berezin V. Bock E. Zippers make signals: NCAM-mediated molecular interactions and signal transduction.Neurochem Res. 2004; 29: 2015-2035Crossref PubMed Scopus (157) Google Scholar]). The 120 kDa isoform is linked to the plasma membrane by a glycosylphosphatidylinositol anchor, whereas the 140kDa and 180kDa isoforms share a transmembrane domain but display cytoplasmic tails of different lengths, suggesting that they can bind different signaling proteins and thus activate different intracellular pathways. In this study, we show that the stimuli used for expansion of CIK cells activate the transcription and expression of the 140 kDa isoform of CD56 and, to a very small extent, the 120 kDa isoform. Analysis of CD56 expression in NK cells has revealed that they also express the 140 kDa isoform [15Lanier L.L. Testi R. Bindl J. Phillips J.H. Identity of Leu-19 (CD56) leukocyte differentiation antigen and neural cell adhesion molecule.J Exp Med. 1989; 169: 2233-2238Crossref PubMed Scopus (414) Google Scholar]. Furthermore, the same isoform is expressed by a number of malignant neoplasms [16Gattenlöhner S. Stühmer T. Leich E. et al.Specific detection of CD56 (NCAM) isoforms for the identification of aggressive malignant neoplasms with progressive development.Am J Pathol. 2009; 174: 1160-1171Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar]. Thus the 140 kDa isoform accounts for the vast majority of the CD56 proteins expressed by hematopoietic cells and tumors. This suggests that, in normal hematopoietic cells, the 140 kDa isoform is under a transcriptional control that can be activated with external stimuli. Mutations, amplifications, deletions, or other aberrations in any of the CD56 regulatory proteins can abrogate this control, leading to CD56 expression in malignant cells. For example, overexpression of the sex determining region Y Box 4 (SOX4) transcription factor in the CD56− myeloma cell line has been shown to induce CD56 expression [17Iqbal M.S. Otsuyama K. Shamsasenjan K. Asaoku H. Kawano M.M. CD56 expression in human myeloma cells derived from the neurogenic gene expression: Possible role of the SRY-HMG box gene, SOX4.Int J Hematol. 2010; 91: 267-275Crossref PubMed Scopus (10) Google Scholar], while CD56 expression in acute myeloid leukemia cells correlates with an abnormal expression pattern of runt-related transcription factor 1 (RUNX1) isoforms [18Gattenloehner S. Chuvpilo S. Langebrake C. et al.Novel RUNX1 isoforms determine the fate of acute myeloid leukemia cells by controlling CD56 expression.Blood. 2007; 110: 2027-2033Crossref PubMed Scopus (31) Google Scholar]. Western blotting of total proteins from CIK cells revealed a band of approximately 200 kDa (Fig. 1D). This is larger than expected for a protein of 140 kDa but can be partially explained by glycosylation and hydrophobicity of the protein and is in line with results obtained with CD56 molecule from NK-cells, which have previously been shown to express the 140 kDa isoform with an apparent 220 kDa molecular weight on Western blotting [19Lanier L.L. Le A.M. Civin C.I. Loken M.R. Phillips J.H. The relationship of CD16 (Leu-11) and Leu-19 (NKH-1) antigen expression on human peripheral blood NK cells and cytotoxic T lymphocytes.J Immunol. 1986; 136: 4480-4486PubMed Google Scholar]. These results also indicate that CD56 in CIK cells is glycosylated and that the glycosylation pattern may be different from that of the NK cells. The mechanism of CIK-mediated killing initiates with target cell recognition and binding and results in secretory lysosome exocytosis [20Mehta B.A. Schmidt-Wolf I.G. Weissman I.L. Negrin R.S. Two pathways of exocytosis of cytoplasmic granule contents and target cell killing by cytokine-induced CD3+ CD56+ killer cells.Blood. 1995; 86: 3493-3499PubMed Google Scholar]. This mechanism is closely related to (or the same as) that used by NK cells. Mehta et al. [20Mehta B.A. Schmidt-Wolf I.G. Weissman I.L. Negrin R.S. Two pathways of exocytosis of cytoplasmic granule contents and target cell killing by cytokine-induced CD3+ CD56+ killer cells.Blood. 1995; 86: 3493-3499PubMed Google Scholar] proposed that CIK cells were able to kill target cells through two pathways, both of which involved exocytosis of cytoplasmic granule contents. One pathway was stimulated by direct contact with the target cell line and was not sensitive to inhibition by immunosuppressive drugs, whereas the other was stimulated by mAb-mediated CD3 crosslinking and was sensitive to immunosuppressive drugs. We show here that CD56 is directly involved in the lysis of target cells, and hypothesize a mechanism of target cell recognition through homophilic binding of two CD56 proteins in trans on effector and target cells that lead to target cell lysis. As a first support to this hypothesis, we show that the CIK-mediated cytotoxicity can be blocked by an anti-CD56 mAb (GPR165) only when the target cell line expresses CD56 on its surface. The blocking is dose dependent. Masking of CD56 on either effector cells or CD56+ target cells lead to reduction of CIK-mediated lysis. This finding, together with the above described effects, leads us to deduce that the masking effect is accounted for by direct CD56-CD56 interaction and not simply by steric hindrance, otherwise we would expect to see the blocking effect also in a cytolytic assay against CD56− target cells. The fact that the mAb GPR165 does not affect the CIK-mediated lysis of CD56− target cells can either indicate that effector cell CD56 is not involved in the lysis of CD56− target cells or that the antibody does not inhibit a heterophilic interaction of CD56. Interestingly, whereas specific blocking of CIK cells did not affect the lysis of MOLT-4, there was a small but nonsignificant effect when blocking was performed on the MOLT-4 target cells. This effect might be attributed to the fact that a small percentage of MOLT-4 cells expresses CD56 at a very low level. Further support for the importance of CD56 in target cell recognition comes from the findings that transient CD56 knockdown in CIK cells resulted in reduced cytotoxicity against CD56+ AML-NS8 target cells, whereas lysis of a MOLT-4 cells, expressing CD56 at a very low level, was not altered. As a third line of support, our results also showed that CD56 knockdown in AML-NS8 negatively affected CIK-mediated lysis of this cell line. Remarkably, it was necessary to completely remove the CD56 antigen from this cell line to observe a significant reduction of the lysis, suggesting that the expression of CD56 on 20% of cells is still sufficient to activate the CD56-dependent lysis by CIK cells. The much stronger inhibitory effect obtained by the addition of the anti-CD56 mAb GPR165 to the AML-NS8 target cells (Fig. 2D), with respect to the effect observed by silencing the CD56 on the same target (Fig. 4D), is puzzling. One possible explanation is that the presence of the mAb may still allow CD56 homophilic interaction between effector and target cells, but may block the downstream events leading to target cell lysis. This cannot take place in the absence of the CD56 on the target cell line. Taken together, our results show that CD56 is involved in CIK-mediated lysis and lead us to hypothesize that homophilic binding of CD56 molecules in trans on effector and target cells is an important event contributing to target cell lysis. There are several possible CD56-independent pathways that can step in when the target cell is CD56−. We have previously shown that lymphocyte function-associated antigen 1 (LFA1) plays a crucial role for functional binding and cytotoxicity against target cells that highly express intercellular adhesion molecule (ICAM)-1 -2 and -3 [13Pievani A. Borleri G. Pende D. et al.Dual-functional capability of CD3+CD56+ CIK cells, a T-cell subset that acquires NK function and retains TCR-mediated specific cytotoxicity.Blood. 2011; 118: 3301-3310Crossref PubMed Scopus (176) Google Scholar]. AML-NS8 expresses high amounts of ICAM-2 and, to some extent, ICAM-1 and ICAM-3; therefore, it is possible that, when CD56 is knocked down, these cells are recognized by LFA-1 expressed on CIK cells and are thus targeted for lysis. We have also previously shown that the activating receptors natural-killer group 2, member D (NKG2D), natural-killer cell p30-related protein (NKp30), and DNAX accessory molecule-1 (DNAM1) involved in NK-cell triggering in the process of tumor cell lysis are expressed on the surface of CIK cells, and we have confirmed their involvement in CIK-mediated cell lysis with antibody-mediated blocking experiments [13Pievani A. Borleri G. Pende D. et al.Dual-functional capability of CD3+CD56+ CIK cells, a T-cell subset that acquires NK function and retains TCR-mediated specific cytotoxicity.Blood. 2011; 118: 3301-3310Crossref PubMed Scopus (176) Google Scholar]. Thus, there may be several possible pathways for CIK-mediated cytotoxicity depending on the ligands expressed by target cells. It has been shown that, in addition to homophilic interactions, CD56 is also involved in heterophilic interactions, and several ligands have been shown to bind CD56 [4Walmod P.S. Kolkova K. Berezin V. Bock E. Zippers make signals: NCAM-mediated molecular interactions and signal transduction.Neurochem Res. 2004; 29: 2015-2035Crossref PubMed Scopus (157) Google Scholar]. It is, therefore, possible that CD56-mediated cell death is activated through heterophilic CD56 binding. The only known CD56-binding protein that previously has been shown to be expressed in hematopoietic cancers is fibroblast growth factor receptor 1 (FGFR1) [21Chan A. Hong D.L. Atzberger A. et al.CD56bright human NK cells differentiate into CD56dim cells: Role of contact with peripheral fibroblasts.J Immunol. 2007; 179: 89-94Crossref PubMed Scopus (248) Google Scholar]. We found that FGFR1 is not expressed on the surface of any of the cell lines used in this study (Valgardsdottir et al., unpublished data). In accordance, antibody-mediated blocking of FGFR1 did not alter the CIK-mediated cytotoxicity against any of the lines, excluding its role in CD56-mediated cell death (Valgardsdottir et al., unpublished data). In conclusion, we show that CD56 plays a direct role in CIK-mediated cytotoxicity against CD56+ hematopoietic tumor cell targets. Our data suggest that homophilic interactions between CD56 molecules may occur in tumor cell recognition, leading to CIK-mediated cell death. This CD56-mediated mechanism is additional to previously published mechanisms, including LFA-1, NKp30, NKG2D, and DNAM-1, further underlining the versatility of CIK cells in mediating cell death. This, together with the finding that CD56 is expressed on different cell populations displaying cytotoxic activity, may suggest a role for CD56 in immune surveillance of hematopoietic tumors. This work was supported by the Italian Association for Cancer Research , Special Programme in Molecular Clinical Oncology, 5 × 1000 “Innate Immunity in Cancer” (no. 9962 ) and by Associazione Italiana contro le Leucemie, Linfomi e Mieloma, Bergamo-Sezione Paolo Belli. Dr M Introna has received support from the Associazione Italiana Lotta alle Leucemie, Linfomi e Mieloma. Dr D Pende has received a grant from Ricerca Finalizzata (no. RF-2010-2316606 ). No financial interest/relationships with financial interest relating to the topic of this article have been declared. We transiently transfected CHO cells with pCDNA3.1TOPO-CD56 construct, utilizing JetPEI (Polyplus-Transfection, Illkirch, France) according to the manufacturer's instructions. After 48–72 hours, cells were stained with GPR165 mAb followed by PE-conjugated goat-antimouse isotype-specific second reagent (Southern Biotechnology Associated, Birmingham, AL) or with the anti-CD56 mAb NCAM16-2-APC-conjugated (BD Bioscience) and analyzed by flow cytometry using a FACSCalibur (BD Bioscience). We maintained Chinese hamster ovarian (CHO) cells in DMEM-medium supplemented with 10% fetal calf serum (Euroclone) and 2 mmol/L L-glutamine (Euroclone).Supplementary Figure E2Isotype control mAb does not affect CIK mediated cytotoxicity of CD56+ cell lines. (A) CIK cells were preincubated with 30 μg/mL of an IgG2a mAb (1F5, open bars) or medium (black bars) before adding target cells (AML-NS8, NB4) and evaluating CIK-mediated cytotoxicity in a calcein release assay at an E:T ratio of 10:1. For each cell line, results are shown as the mean of three independent experiments ± SD.View Large Image Figure ViewerDownload Hi-res image Download (PPT)" @default.
• W1970889679 created "2016-06-24" @default.
• W1970889679 creator A5010646680 @default.
• W1970889679 creator A5014012949 @default.
• W1970889679 creator A5018208681 @default.
• W1970889679 creator A5035673194 @default.
• W1970889679 creator A5035849763 @default.
• W1970889679 creator A5045212954 @default.
• W1970889679 creator A5049475287 @default.
• W1970889679 creator A5055401685 @default.
• W1970889679 creator A5083934929 @default.
• W1970889679 date "2014-12-01" @default.
• W1970889679 modified "2023-10-18" @default.
• W1970889679 title "Direct involvement of CD56 in cytokine-induced killer–mediated lysis of CD56+ hematopoietic target cells" @default.
• W1970889679 cites W1741012896 @default.
• W1970889679 cites W1965412973 @default.
• W1970889679 cites W1985204651 @default.
• W1970889679 cites W1994863160 @default.
• W1970889679 cites W1998130196 @default.
• W1970889679 cites W2021765135 @default.
• W1970889679 cites W2040286333 @default.
• W1970889679 cites W2075932796 @default.
• W1970889679 cites W2076033451 @default.
• W1970889679 cites W2086968991 @default.
• W1970889679 cites W2087362460 @default.
• W1970889679 cites W2100045859 @default.
• W1970889679 cites W2133114658 @default.
• W1970889679 cites W2135150353 @default.
• W1970889679 cites W2154518608 @default.
• W1970889679 cites W2164524832 @default.
• W1970889679 cites W2164606734 @default.
• W1970889679 cites W88796997 @default.
• W1970889679 doi "https://doi.org/10.1016/j.exphem.2014.08.005" @default.
• W1970889679 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/25201755" @default.
• W1970889679 hasPublicationYear "2014" @default.
• W1970889679 type Work @default.
• W1970889679 sameAs 1970889679 @default.
• W1970889679 citedByCount "26" @default.
• W1970889679 countsByYear W19708896792015 @default.
• W1970889679 countsByYear W19708896792016 @default.
• W1970889679 countsByYear W19708896792017 @default.
• W1970889679 countsByYear W19708896792018 @default.
• W1970889679 countsByYear W19708896792019 @default.
• W1970889679 countsByYear W19708896792020 @default.
• W1970889679 countsByYear W19708896792021 @default.
• W1970889679 countsByYear W19708896792022 @default.
• W1970889679 crossrefType "journal-article" @default.
• W1970889679 hasAuthorship W1970889679A5010646680 @default.
• W1970889679 hasAuthorship W1970889679A5014012949 @default.
• W1970889679 hasAuthorship W1970889679A5018208681 @default.
• W1970889679 hasAuthorship W1970889679A5035673194 @default.
• W1970889679 hasAuthorship W1970889679A5035849763 @default.
• W1970889679 hasAuthorship W1970889679A5045212954 @default.
• W1970889679 hasAuthorship W1970889679A5049475287 @default.
• W1970889679 hasAuthorship W1970889679A5055401685 @default.
• W1970889679 hasAuthorship W1970889679A5083934929 @default.
• W1970889679 hasBestOaLocation W19708896791 @default.
• W1970889679 hasConcept C109159458 @default.
• W1970889679 hasConcept C185592680 @default.
• W1970889679 hasConcept C203014093 @default.
• W1970889679 hasConcept C2778690821 @default.
• W1970889679 hasConcept C28328180 @default.
• W1970889679 hasConcept C57409179 @default.
• W1970889679 hasConcept C86803240 @default.
• W1970889679 hasConcept C95444343 @default.
• W1970889679 hasConceptScore W1970889679C109159458 @default.
• W1970889679 hasConceptScore W1970889679C185592680 @default.
• W1970889679 hasConceptScore W1970889679C203014093 @default.
• W1970889679 hasConceptScore W1970889679C2778690821 @default.
• W1970889679 hasConceptScore W1970889679C28328180 @default.
• W1970889679 hasConceptScore W1970889679C57409179 @default.
• W1970889679 hasConceptScore W1970889679C86803240 @default.
• W1970889679 hasConceptScore W1970889679C95444343 @default.
• W1970889679 hasFunder F4320323054 @default.
• W1970889679 hasIssue "12" @default.
• W1970889679 hasLocation W19708896791 @default.
• W1970889679 hasLocation W19708896792 @default.
• W1970889679 hasOpenAccess W1970889679 @default.
• W1970889679 hasPrimaryLocation W19708896791 @default.
• W1970889679 hasRelatedWork W1996916774 @default.
• W1970889679 hasRelatedWork W2023834531 @default.
• W1970889679 hasRelatedWork W2029259805 @default.
• W1970889679 hasRelatedWork W2055826174 @default.
• W1970889679 hasRelatedWork W2120223845 @default.
• W1970889679 hasRelatedWork W2127548364 @default.
• W1970889679 hasRelatedWork W2998343095 @default.
• W1970889679 hasRelatedWork W3021115544 @default.
• W1970889679 hasRelatedWork W3133629953 @default.
• W1970889679 hasRelatedWork W3182217228 @default.
• W1970889679 hasVolume "42" @default.
• W1970889679 isParatext "false" @default.
• W1970889679 isRetracted "false" @default.
• W1970889679 magId "1970889679" @default.
• W1970889679 workType "article" @default.