FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1971294629> ?p ?o ?g. }

• W1971294629 endingPage "45181" @default.
• W1971294629 startingPage "45171" @default.
• W1971294629 abstract "The Mre11/Rad50 complex is a critical component of the cellular response to DNA double-strand breaks, in organisms ranging from archaebacteria to humans. In mammalian cells, Mre11/Rad50 (M/R) associates with a third component, Nbs1, that regulates its activities and is targeted by signaling pathways that initiate DNA damage-induced checkpoint responses. Mutations in the genes that encode Nbs1 and Mre11 are responsible for the human radiation sensitivity disorders Nijmegen breakage syndrome (NBS) and ataxia-telangiectasia-like disorder (ATLD), respectively, which are characterized by defective checkpoint responses and high levels of chromosomal abnormalities. Here we demonstrate nucleotide-dependent DNA binding by the human M/R complex that requires the Nbs1 protein and is specific for double-strand DNA duplexes. Efficient DNA binding is only observed with non-hydrolyzable analogs of ATP, suggesting that ATP hydrolysis normally effects DNA release. The alleles of MRE11 associated with ATLD and the C-terminal Nbs1 polypeptide associated with NBS were expressed with the other components and found to form triple complexes except in the case of ATLD 3/4, which exhibits variability in Nbs1 association. The ATLD 1/2, ATLD 3/4, and p70 M/R/N complexes exhibit nucleotide-dependent DNA binding and exonuclease activity equivalent to the wild-type enzyme, although the ATLD complexes both show reduced activity in endonuclease assays. Sedimentation equilibrium analysis of the recombinant human complexes indicates that Mre11 is a stable dimer, Mre11 and Nbs1 form a 1:1 complex, and both M/R and M/R/N form large multimeric assemblies of ∼1.2 MDa. Models of M/R/N stoichiometry in light of this and previous data are discussed. The Mre11/Rad50 complex is a critical component of the cellular response to DNA double-strand breaks, in organisms ranging from archaebacteria to humans. In mammalian cells, Mre11/Rad50 (M/R) associates with a third component, Nbs1, that regulates its activities and is targeted by signaling pathways that initiate DNA damage-induced checkpoint responses. Mutations in the genes that encode Nbs1 and Mre11 are responsible for the human radiation sensitivity disorders Nijmegen breakage syndrome (NBS) and ataxia-telangiectasia-like disorder (ATLD), respectively, which are characterized by defective checkpoint responses and high levels of chromosomal abnormalities. Here we demonstrate nucleotide-dependent DNA binding by the human M/R complex that requires the Nbs1 protein and is specific for double-strand DNA duplexes. Efficient DNA binding is only observed with non-hydrolyzable analogs of ATP, suggesting that ATP hydrolysis normally effects DNA release. The alleles of MRE11 associated with ATLD and the C-terminal Nbs1 polypeptide associated with NBS were expressed with the other components and found to form triple complexes except in the case of ATLD 3/4, which exhibits variability in Nbs1 association. The ATLD 1/2, ATLD 3/4, and p70 M/R/N complexes exhibit nucleotide-dependent DNA binding and exonuclease activity equivalent to the wild-type enzyme, although the ATLD complexes both show reduced activity in endonuclease assays. Sedimentation equilibrium analysis of the recombinant human complexes indicates that Mre11 is a stable dimer, Mre11 and Nbs1 form a 1:1 complex, and both M/R and M/R/N form large multimeric assemblies of ∼1.2 MDa. Models of M/R/N stoichiometry in light of this and previous data are discussed. The mre11 and rad50 mutants in Saccharomyces cerevisiae were originally named for the deficiencies in meiotic recombination and ionizing radiation survival observed in mutant strains (1Game J.C. Mortimer R.K. Mutat. Res. 1974; 24: 281-292Crossref PubMed Scopus (338) Google Scholar, 2Ajimura M. Leem S.H. Ogawa H. Genetics. 1993; 133: 51-66Crossref PubMed Google Scholar). We now know that the protein products of these two genes associate together with a third component, Xrs2, in budding yeast, and that the complex plays important roles in homologous recombination, non-homologous end-joining, telomere maintenance, S-phase checkpoint control, and meiotic recombination (3Alani E. Padmore R. Kleckner N. Cell. 1990; 61: 419-436Abstract Full Text PDF PubMed Scopus (479) Google Scholar, 4Ivanov E.L. Korolev V.G. Fabre F. Genetics. 1992; 132: 651-664Crossref PubMed Google Scholar, 5Moore J.K. Haber J.E. Mol. Cell. Biol. 1996; 16: 2164-2173Crossref PubMed Scopus (599) Google Scholar, 6Kironmai K.M. Muniyappa K. Genes Cells. 1997; 2: 443-455Crossref PubMed Scopus (116) Google Scholar, 7Boulton S.J. Jackson S.P. EMBO J. 1998; 17: 1819-1828Crossref PubMed Scopus (556) Google Scholar, 8Haber J.E. Cell. 1998; 95: 583-586Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar, 9Bressan D.A. Baxter B.K. Petrini J.H. Mol. Cell. Biol. 1999; 19: 7681-7687Crossref PubMed Scopus (234) Google Scholar, 10Chen L. Trujillo K. Ramos W. Sung P. Tomkinson A.E. Mol. Cell. 2001; 8: 1105-1115Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar, 11D'Amours D. Jackson S.P. Genes Dev. 2001; 15: 2238-2249Crossref PubMed Scopus (183) Google Scholar, 12Grenon M. Gilbert C. Lowndes N.F. Nat. Cell Biol. 2001; 3: 844-847Crossref PubMed Scopus (155) Google Scholar, 13D'Amours D. Jackson S.P. Nat. Rev. Mol. Cell. Biol. 2002; 3: 317-327Crossref PubMed Scopus (718) Google Scholar, 14Lobachev K.S. Gordenin D.A. Resnick M.A. Cell. 2002; 108: 183-193Abstract Full Text Full Text PDF PubMed Scopus (324) Google Scholar, 15Gonzalez-Barrera S. Cortes-Ledesma F. Wellinger R.E. Aguilera A. Mol. Cell. 2003; 11: 1661-1671Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar). Homologs of Mre11 and Rad50 have been identified in every organism that has been genetically characterized, as well as some bacteriophage, indicating that the functions of the complex are fundamental to DNA transactions. Proteins analogous to the Xrs2 component have not been identified in prokaryotes or archaebacteria, however, suggesting that this part of the complex is unique to eukaryotic cells. In mammals, the Mre11 and Rad50 proteins associate with a protein called Nbs1 (also nibrin and p95) (16Carney J.P. Maser R.S. Olivares H. Davis E.M. Le Beau M. Yates 3rd, J.R. Hays L. Morgan W.F. Petrini J.H. Cell. 1998; 93: 477-486Abstract Full Text Full Text PDF PubMed Scopus (1027) Google Scholar) into a large complex, Mre11/Rad50/Nbs1 (M/R/N). 1The abbreviations used are: M, Mre11; R, Rad50; N, Nbs1; NBS, Nijmegen breakage syndrome; A-T, ataxia-telangiectasia; ATLD, ataxia-telangiectasia-like disorder; ATM, ataxia-telangiectasia-mutated gene; MOPS, 4-morpholinepropanesulfonic acid; GST, glutathione S-transferase; AMP-PNP, adenosine 5′-(β,γ-imino)triphosphate; ATPγS, adenosine 5′-O-(thiotriphosphate). Nbs1 has little if any sequence similarity to Xrs2, but has clinical significance because mutations in the NBS1 gene have been identified as causal factors in the human autosomal recessive genetic disorder Nijmegen breakage syndrome (NBS) (17Varon R. Vissinga C. Platzer M. Cerosaletti K.M. Chrzanowska K.H. Saar K. Beckmann G. Seemanova E. Cooper P.R. Nowak N.J. Stumm M. Weemaes C.M. Gatti R.A. Wilson R.K. Digweed M. Rosenthal A. Sperling K. Concannon P. Reis A. Cell. 1998; 93: 467-476Abstract Full Text Full Text PDF PubMed Scopus (873) Google Scholar). Patients with NBS exhibit radiation sensitivity, immune system deficiency, and a high rate of malignancy (18Shiloh Y. Annu. Rev. Genet. 1997; 31: 635-662Crossref PubMed Scopus (428) Google Scholar). At the cellular level, abnormalities include a defective S-phase checkpoint response and an elevated rate of chromosomal breakage and translocations, although few overt deficiencies in DNA repair are found. It was recently demonstrated that the most common NBS allele, 657del5, can generate a C-terminal polypeptide through the use of an internal ribosome entry site upstream of the 5-nucleotide deletion (19Maser R.S. Zinkel R. Petrini J.H. Nat. Genet. 2001; 27: 417-421Crossref PubMed Scopus (183) Google Scholar). This translation product (p70) is capable of binding Mre11; thus, the 657del5 NBS allele is very likely a hypomorphic allele that can supply a subset of the normal functions of Nbs1. The clinical presentation of NBS patients constitutes a subset of the phenotype of patients with ataxia-telangiectasia (A-T), a related radiation sensitivity disorder. A-T is caused by mutations in the A-T-mutated gene (ATM), which encodes a large protein kinase that initiates DNA damage signaling in response to DNA double-strand breaks in eukaryotic cells. A biochemical connection between the two disorders was established with the demonstration that the ATM protein kinase phosphorylates the Nbs1 protein, in addition to many other targets, and that Nbs1 phosphorylation by ATM is essential for a normal S-phase checkpoint response (20Gatei M. Young D. Cerosaletti K.M. Desai-Mehta A. Spring K. Kozlov S. Lavin M.F. Gatti R.A. Concannon P. Khanna K. Nat. Genet. 2000; 25: 115-119Crossref PubMed Scopus (410) Google Scholar, 21Lim D.S. Kim S.T. Xu B. Maser R.S. Lin J. Petrini J.H. Kastan M.B. Nature. 2000; 404: 613-617Crossref PubMed Scopus (675) Google Scholar, 22Wu X. Ranganathan V. Weisman D.S. Heine W.F. Ciccone D.N. O'Neill T.B. Crick K.E. Pierce K.A. Lane W.S. Rathbun G. Livingston D.M. Weaver D.T. Nature. 2000; 405: 477-482Crossref PubMed Scopus (373) Google Scholar, 23Zhao S. Weng Y.C. Yuan S.S. Lin Y.T. Hsu H.C. Lin S.C. Gerbino E. Song M.H. Zdzienicka M.Z. Gatti R.A. Shay J.W. Ziv Y. Shiloh Y. Lee E.Y. Nature. 2000; 405: 473-477Crossref PubMed Scopus (436) Google Scholar). An additional connection between M/R/N and ATM arose with the identification of two families with A-T-like disorder (ATLD), clinically identical to A-T, yet caused by mutations in the MRE11 gene (24Stewart G.S. Maser R.S. Stankovic T. Bressan D.A. Kaplan M.I. Jaspers N.G. Raams A. Byrd P.J. Petrini J.H. Taylor A.M. Cell. 1999; 99: 577-587Abstract Full Text Full Text PDF PubMed Scopus (855) Google Scholar). The two known ATLD mutations are quite different; the ATLD 1/2 allele contains a premature stop codon resulting in a truncation of the C-terminal domain, whereas the ATLD 3/4 allele contains a missense mutation within the nuclease domain in the N terminus. The biochemical basis of the abnormalities seen in ATLD patients has not yet been elucidated. Using a recombinant baculovirus system, we have expressed the human Mre11, Rad50, and Nbs1 proteins together and found that they form a large protein complex that exhibits several distinct enzymatic activities on DNA substrates. The Mre11 protein contains highly conserved phosphoesterase motifs that are responsible for the manganese-dependent nuclease activities of M/R/N. By itself and in association with Rad50 and Nbs1, Mre11 exhibits a distributive, 3′ to 5′ exonuclease activity on blunt and 3′ recessed ends (25Paull T.T. Gellert M. Mol. Cell. 1998; 1: 969-979Abstract Full Text Full Text PDF PubMed Scopus (706) Google Scholar, 26Trujillo K.M. Yuan S.S. Lee E.Y. Sung P. J. Biol. Chem. 1998; 273: 21447-21450Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar), as well as a weak endonuclease activity on distorted DNA substrates such as hairpin structures. Association of Nbs1 with Mre11 stimulates the endonuclease function to act on hairpin structures and on 3′ overhangs (27Paull T.T. Gellert M. Genes Dev. 1999; 13: 1276-1288Crossref PubMed Scopus (449) Google Scholar), although Nbs1 itself has no apparent enzymatic activities. The Rad50 protein contains conserved Walker A and Walker B ATPase motifs that are closely related to the ABC transporter family of membrane-associated ATPases. A long coiled-coil region separates the N-terminal and C-terminal ATP binding domains, which are thought to associate with each other via intramolecular, antiparallel association of the coiled-coil region along its length, a hypothesis supported by microscopy data and by analogy with the SMC family of related coiled-coil proteins (28de Jager M. van Noort J. van Gent D.C. Dekker C. Kanaar R. Wyman C. Mol. Cell. 2001; 8: 1129-1135Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar, 29Hirano M. Hirano T. EMBO J. 2002; 21: 5733-5744Crossref PubMed Scopus (152) Google Scholar, 30Haering C.H. Lowe J. Hochwagen A. Nasmyth K. Mol. Cell. 2002; 9: 773-788Abstract Full Text Full Text PDF PubMed Scopus (563) Google Scholar). M/R can catalyze a limited DNA unwinding reaction on DNA ends that is stimulated by ATP and also requires Nbs1 (27Paull T.T. Gellert M. Genes Dev. 1999; 13: 1276-1288Crossref PubMed Scopus (449) Google Scholar). Crystal structures of the catalytic cores of Mre11 and Rad50 homologs from the archaebacterium Pyrococcus furiosus illuminate the essential components of the active sites for both the phosphoesterase and the ATPase (31Hopfner K.P. Karcher A. Shin D.S. Craig L. Arthur L.M. Carney J.P. Tainer J.A. Cell. 2000; 101: 789-800Abstract Full Text Full Text PDF PubMed Scopus (812) Google Scholar, 32Hopfner K.P. Karcher A. Shin D. Fairley C. Tainer J.A. Carney J.P. J. Bacteriol. 2000; 182: 6036-6041Crossref PubMed Scopus (108) Google Scholar). Biochemical studies with the P. furiosus Rad50 protein also indicated that ATP binding induced dimerization of the Walker A/Walker B catalytic unit, and that this dimerization interface promoted ATP-dependent DNA binding by the protein. S. cerevisiae Rad50 had previously been shown to exhibit nucleotide-dependent binding to DNA as well (33Raymond W.E. Kleckner N. Nucleic Acids Res. 1993; 21: 3851-3856Crossref PubMed Scopus (100) Google Scholar). Mutations in the ATP-binding motifs of Rad50 in budding yeast have been shown to be equivalent to null mutations with respect to meiotic recombination, mitotic recombination, and growth rate (3Alani E. Padmore R. Kleckner N. Cell. 1990; 61: 419-436Abstract Full Text PDF PubMed Scopus (479) Google Scholar), so ATP binding (and likely also hydrolysis) is essential to Rad50 function. In this study, we have investigated the nucleotide-dependent biochemical properties of the human M/R/N complex, focusing on the role of the Nbs1 protein. Nbs1 stimulates nucleotide-dependent DNA binding by Mre11/Rad50 (M/R), and these complexes are promoted and stabilized by the presence of non-hydrolyzable ATP analogs. Nucleotide-bound M/R/N binds specifically to double-stranded DNA duplexes, but does not show an obvious preference for DNA ends. Association of Nbs1 with the rest of the complex is destabilized in one of the ATLD M/R/N complexes (ATLD 3/4) but not in the other (ATLD 1/2), but both ATLD complexes show reduced levels of endonuclease activity compared with the wild-type enzyme. The M/R/N(p70) complex exhibits enzymatic activities essentially equivalent to the wild-type enzyme. Finally, sedimentation equilibrium analysis of the complex shows that Mre11 is clearly a dimer in solution, whereas both M/R and M/R/N are extremely large protein assemblies of ∼1.2 MDa. Plasmid Expression Constructs—Baculovirus expression constructs for human Mre11, Rad50, and Nbs1 have been described previously (25Paull T.T. Gellert M. Mol. Cell. 1998; 1: 969-979Abstract Full Text Full Text PDF PubMed Scopus (706) Google Scholar, 27Paull T.T. Gellert M. Genes Dev. 1999; 13: 1276-1288Crossref PubMed Scopus (449) Google Scholar): pTP17, pTP11, and pTP36, respectively. The ATLD 1/2 allele of Mre11 was generated by PCR from pTP17, generating a 6-histidine tag and stop codon at arginine 633, to form pTP219. A bacmid was made from this plasmid using the Bac-to-Bac system (Invitrogen), to form pTP221. The ATLD 3/4 allele of Mre11 was generated using the QuikChange system (Stratagene), introducing the N117S mutation into pTP17 to make pTP131 and subsequently the bacmid form, pTP133. The S1202R version of Rad50 was also generated using QuikChange in the hRad50 gene in pFastBac1 to make pTP140, and the bacmid version, pTP141. The p70 version of Nbs1 was constructed in two steps. First, a 5-nucleotide deletion was made at position 657 in the Nbs1 gene using QuikChange to re-create the 657del5 Nbs1 allele. Second, an N-terminal truncated version of this allele was generated by PCR, using the ATG at position 602 of the original gene as the initiator codon. This version of Nbs1 was cloned into pFastBac1 (Invitrogen) without an affinity tag, generating pTP270 and the bacmid form, pTP271. GST-Nbs1 was constructed by insertion of the glutathione S-transferase gene from pGEX-4T-1 (Amersham Biosciences) into pTP36 (27Paull T.T. Gellert M. Genes Dev. 1999; 13: 1276-1288Crossref PubMed Scopus (449) Google Scholar) to create a fusion protein with GST at the N terminus of Nbs1. All of the alleles generated by PCR were sequenced in their entirety. Each of the bacmids was used to make recombinant baculovirus according to the instructions from the manufacturer. Substrate DNA—The substrate in the gel mobility shift assays and in the 3′ overhang cutting assay consisted of TP423 (CTGCAGGGTTTTTGTTCCAGTCTGTAGCACTGTGTAAGACAGGCCAGATC) annealed to TP424 (CACAGTGCTACAGACTGGAACAAAAACCCTGCAGTACTCTACTCATCTC). TP423 was labeled with 32P at the 5′ end for the gel mobility shift assays, or at the 3′ end for the 3′ overhang cutting assay. Labeling was performed with T4 polynucleotide kinase on the 5′ end (New England Biolabs) using [γ-32P]ATP, or with terminal deoxynucleotidyltransferase on the 3′ end (Roche Molecular Biochemicals) using [α-32P]cordycepin. The single-stranded DNA used in Fig. 2A consisted of labeled TP423 only. The plasmid DNA used as a competitor in Fig. 2 was a derivative of the topo 2.1 vector (Invitrogen), unrelated in sequence to the substrate oligonucleotides. The substrate used in Fig. 6A for the exonuclease assay consisted of TP74 annealed to TP124 (34Paull T.T. Gellert M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6409-6414Crossref PubMed Scopus (167) Google Scholar), with TP74 labeled with 32P at the 5′ end. The hairpin substrate consisted of TP355 (CATCCATGCCTACCTGAGTACCAGTAGCTACTGGTACTCAGGTAGGCATGGATGCCAGATCGAC), labeled with 32P at the 5′ end.Fig. 6Sedimentation equilibrium profiles for Mre11 (H217Y) (A), the Mre11(ATLD1/2)/Nbs1 complex (B), the Mre11/Rad50 complex (C), and the M/R/N triple complex (D) shown as a distribution of A 280 at equilibrium. A, data were collected at 10,000 rpm. The best single component fit for Mre11 is shown as a solid line, and the corresponding distribution of the residuals is shown above the plot. B, data were collected at 6,000 rpm and analyzed in terms of two non-interacting ideal solutes to account for the presence of the Mre11/Rad50/Nbs1 triple complex. The best fit is shown as a solid line. The contributions of the double (M/N) and triple (M/R/N) complexes are indicated as dashed and dotted lines, respectively. The corresponding distribution of the residuals is shown above the plot. C, data were collected at 3,000 rpm. The best single component fit for the Mre11/Rad50 complex is shown as a solid line, and the distribution of the residuals is shown above the plot. D, base-line corrected data for the triple M/R/N complex shown were collected at 3,500 rpm. The best single component data fit is shown as a solid line. The corresponding distribution of the residuals is shown above.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Proteins—M/R/N complexes were purified as previously described (25Paull T.T. Gellert M. Mol. Cell. 1998; 1: 969-979Abstract Full Text Full Text PDF PubMed Scopus (706) Google Scholar). The mutant M/R/N complexes were purified using the same protocol as with the wild-type complex. All of the Mre11 proteins and Rad50 contain a C-terminal histidine tag. Nbs1 (wild-type and p70) expressed with Mre11 or with both Mre11 and Rad50 did not contain an affinity tag. GST-Nbs1 was expressed by itself in the baculovirus system and purified over a glutathione-Sepharose column, followed by ion exchange chromatography on Q Sepharose (Amersham Biosciences). GST-Nbs1 eluted from the Q Sepharose at ∼0.2 m NaCl. Protein concentrations were determined by Bradford assay (Pierce) and confirmed by comparison with protein standards in Coomassie-stained SDS-PAGE gels. Western blotting of Mre11, Rad50, and Nbs1 was performed with antibodies PC388 (Oncogene), MS-RAD10 (Genetex), and MS-NBS10 (Genetex), respectively, on polyvinylidene difluoride membrane (Millipore) using standard immunoblotting techniques. Assay Conditions—Gel mobility shift assays were performed in a volume of 10 μl with 25 mm MOPS, pH 7.0, 50 mm NaCl, 1 mm dithiothreitol, 0.1% Tween 20, 100 μg/ml bovine serum albumin, 5 mm magnesium chloride, 0.5 mm AMP-PNP or ATP as indicated, and 1 nm oligonucleotide substrate, with M/R/N complex added as indicated in the figure legends (between 20 and 120 ng, which is 1.7–10 nm assuming 1.2 × 106 g/mol for M/R/N). In Fig. 2 (B and C), unlabeled plasmid DNA or single-stranded DNA (TP423) was added to the reaction before the addition of protein. M/R/N was incubated with the DNA and other reaction components for 15 min at room temperature before the addition of 1 μl of 50% glycerol and separation on a 0.7% agarose, 0.5× Tris borate-EDTA (TBE) gel at 5.7 V/cm for 100 min. Gels were dried and analyzed using a phosphorimager (Amersham Biosciences). In the competitor assays, the amount of complex formed by M/R/N in the absence of competitor was considered 100%, and the decreases in complex formation relative to that amount were determined by quantitative phosphorimager analysis. Nuclease assays were performed in a volume of 10 μl with 25 mm MOPS (pH 7.0), 50 mm NaCl, 1 mm dithiothreitol, 1 mm manganese chloride, 1 nm oligonucleotide substrate, with M/R/N complex added as indicated at 20–25 nm (hairpin and 3′ overhang assays) or 2.0–2.5 nm (exonuclease assays). M/R/N was incubated with the DNA and other reaction components at 37 °C for 90 min (hairpin and 3′ overhang assays) or 15–30 min (exonuclease assays) before the addition of 1 μl of 2% SDS, 0.1 m EDTA. ATP (0.5 mm) was included in the 3′ overhang nuclease assays as indicated in Fig. 5C. Reactions were lyophilized, resuspended in 7 μl of formamide loading buffer, separated on a denaturing, 20% polyacrylamide sequencing gel, and analyzed by phosphorimager. Analytical Ultracentrifugation—Mre11, Rad50, and Nbs1 protein complexes were dialyzed overnight against buffer A (50 mm NaCl, 25 mm Tris, pH 8.0, and 5 mm 2-mercaptoethanol) (Mre11) or buffer B (100 mm NaCl, 25 mm Tris, pH 8.0, 5 mm 2-mercaptoethanol, and 5% (v/v) glycerol) (Mre11/Rad50, Mre11 ATLD 1/2/Nbs1 and Mre11/Rad50/Nbs1) at 4 °C. Samples were loaded and studied at nominal loading concentrations of 0.35 (Mre11), 0.11 (Mre11/Rad50), 0.31 (Mre11 ATLD1/2/Nbs1), and 0.08–0.20 (Mre11/Rad50/Nbs1) A 280. In the case of the double (Mre11/Rad50) and triple complexes loaded at 0.11 and 0.08 A 280, respectively, data were also collected at shorter wavelengths of 230 and 225 nm. Sedimentation equilibrium experiments were conducted at 4.0 °C on a Beckman Optima XL-A analytical ultracentrifuge. Mre11 samples were studied at 6,000, 8,000, and 10,000 rpm. Complexes of Mre11 with Rad50 and with both Nbs1 and Rad50 were studied at rotor speeds of 3,000, 3,500, and 4,000 rpm, whereas complexes of Mre11 ATLD1/2 with Nbs1 were studied at rotor speeds of 6,000, 7,000, and 8,000 rpm. Data were acquired as an average of eight absorbance measurements at 280 nm and a radial spacing of 0.001 cm. Scans were collected at 6-h intervals until equilibrium was reached. Data were analyzed in terms of a single ideal solute to obtain the buoyant molecular mass, M 1(1 – vρ), using the Optima XL-A data analysis software (Beckman, Microcal Origin 3.78). In the case of Mre11 ATLD1/2 with Nbs1, data were analyzed in terms of two non-interacting solutes. Residuals were calculated. A random distribution of the residuals around zero was obtained as a function of the radius. A global analysis in terms of a single ideal solute performed in Sigma Plot 2001 as described (49Ghirlando R. Keown M.B. Mackay G.A. Lewis M.S. Unkeless J.C. Gould H.J. Biochemistry. 1995; 34: 13320-13327Crossref PubMed Scopus (58) Google Scholar) yields similar results. Values of the molecular mass, M, were obtained from the buoyant molecular mass, M 1(1 – vρ), and calculated using densities, ρ, at 4.0 °C obtained from standard tables. Values of v = 0.7303, 0.7326, and 0.7339 ml g–1 were calculated for Mre11, ATLD1/2, and Nbs1, respectively, based on the amino acid composition using consensus data for the partial specific molar volumes of amino acids (50Perkins S.J. Eur. J. Biochem. 1986; 15: 169-180Crossref Scopus (546) Google Scholar). Otherwise, a consensus protein value of 0.73 ml g–1 was utilized. Nucleotide-dependent DNA Binding by M/R/N—The crystallographic structure of the P. furiosus Rad50 enzyme suggested that heterodimeric Rad50 catalytic domains further dimerize into a tetrameric unit in the presence of ATP (31Hopfner K.P. Karcher A. Shin D.S. Craig L. Arthur L.M. Carney J.P. Tainer J.A. Cell. 2000; 101: 789-800Abstract Full Text Full Text PDF PubMed Scopus (812) Google Scholar). This change in multimeric state, stabilized by ATP, was hypothesized to facilitate DNA binding by the enzyme. Rad50 from S. cerevisiae has also been reported to bind DNA in an ATP-dependent manner (33Raymond W.E. Kleckner N. Nucleic Acids Res. 1993; 21: 3851-3856Crossref PubMed Scopus (100) Google Scholar). Despite this compelling evidence, we have not observed any significant ATP dependence in DNA binding by the human M/R/N enzyme (Fig. 1A, lanes 4 and 5 and data not shown). When we measured DNA binding by wild-type M/R/N in the presence of magnesium and the non-hydrolyzable ATP analog AMP-PNP, however, we observed ∼20–40-fold higher levels of DNA binding compared with reactions with ATP or without added nucleotides (Fig. 1A, lanes 6 and 7). The protein concentrations used here are 2–3-fold lower than the concentrations previously used to demonstrate M/R/N binding of DNA in the absence of nucleotides (27Paull T.T. Gellert M. Genes Dev. 1999; 13: 1276-1288Crossref PubMed Scopus (449) Google Scholar). We have also observed a similar phenomenon with the non-hydrolyzable ATP analog ATPγS, and in each case, magnesium is absolutely required for formation of the protein-DNA complex (data not shown). We also tested subcomplexes of M/R/N for AMP-PNP-dependent DNA binding and found that Mre11/Rad50 (M/R) was incapable of binding DNA under these conditions, suggesting that the presence of Nbs1 in the complex is necessary for nucleotide-dependent DNA binding (Fig. 1B). We confirmed this to be the case by performing DNA-binding assays with M/R plus varying amounts of GST-Nbs1, which was expressed and purified in the absence of Mre11 and Rad50. As shown in Fig. 1C, the addition of GST-Nbs1 restored AMP-PNP-dependent DNA binding to the M/R complex (Fig. 1C, lanes 5 and 6), yet did not exhibit any DNA-binding capability alone (lane 7). The Rad50 protein is the only component of the complex that contains ATP-binding motifs and is therefore the likely source of nucleotide-dependent DNA binding by M/R/N. To confirm this, we expressed a mutant form of Rad50 containing a single amino acid change (S1202R) that is equivalent to the mutation made in the P. furiosus enzyme (S793R), which was previously shown to abolish ATP-driven dimerization of the ATP-binding domain (31Hopfner K.P. Karcher A. Shin D.S. Craig L. Arthur L.M. Carney J.P. Tainer J.A. Cell. 2000; 101: 789-800Abstract Full Text Full Text PDF PubMed Scopus (812) Google Scholar). The S1202R Rad50 mutant in association with wild-type Mre11 and Nbs1 failed to bind DNA in the presence of AMP-PNP, verifying that the ATP-binding domain of the Rad50 protein is required for the protein-DNA complex observed with the wild-type enzyme (Fig. 1D). The AMP-PNP-dependent M/R/N complex is only formed on double-stranded DNA duplexes and not on single-stranded oligonucleotides, as shown in Fig. 2A. Addition of increasing amounts of M/R/N to the labeled double-stranded DNA in the presence of magnesium and AMP-PNP actually generates two types of protein-DNA complex; the low mobility species previously indicated (complex I), and a higher mobility species that migrates close to the unbound DNA (complex II). Formation of each complex is highly cooperative, normally appearing at a threshold of ∼30–60 ng of M/R/N per 10-μl reaction (equivalent to 2.5–5nm, considering a molecular mass of 1.2 MDa). The relative amounts of labeled DNA in the two species do not change with increasing M/R/N concentration, although the mobility of both complexes decreases, suggesting that more protein can be incorporated into each complex with additional M/R/N. Under these conditions, essentially 100% of the DNA is incorporated into one or the other of these forms, with a majority of the DNA in complex II. Preliminary off-rate experiments suggest that complex I has an off-rate on the order of several minutes, whereas the off-rate of complex II is less than 30 s (data not shown). Competition studies with M/R/N on DNA duplexes indicated that both linear and uncut plasmid DNA could compete effectively with short DNA duplexes for M/R/N binding in complex I (Fig. 2B). Thus, DNA ends are not essential for nucleotide-dependent binding by M/R/N. Single-stranded oligonucleotide (Fig. 2B) and tRNA (data not shown) did not compete for binding. In contrast, single-stranded DNA was able to partially compete with the double-stranded duplex in complex II (Fig. 2C), indicating that complex II is less specific for duplex DNA. Mre11 protein alone is capable of forming a complex similar to complex II in gel mobility shift assays (27Paull T.T. Gellert M. Genes" @default.
• W1971294629 created "2016-06-24" @default.
• W1971294629 creator A5000713072 @default.
• W1971294629 creator A5024968631 @default.
• W1971294629 creator A5027987017 @default.
• W1971294629 creator A5048476466 @default.
• W1971294629 creator A5065867383 @default.
• W1971294629 creator A5074374757 @default.
• W1971294629 date "2003-11-01" @default.
• W1971294629 modified "2023-10-09" @default.
• W1971294629 title "Regulation of Mre11/Rad50 by Nbs1" @default.
• W1971294629 cites W1505902561 @default.
• W1971294629 cites W1511602705 @default.
• W1971294629 cites W1541806623 @default.
• W1971294629 cites W1618806168 @default.
• W1971294629 cites W1633875338 @default.
• W1971294629 cites W1850362640 @default.
• W1971294629 cites W1969008019 @default.
• W1971294629 cites W1969282814 @default.
• W1971294629 cites W1970984376 @default.
• W1971294629 cites W1974224833 @default.
• W1971294629 cites W1978876322 @default.
• W1971294629 cites W1979587131 @default.
• W1971294629 cites W1992632955 @default.
• W1971294629 cites W2000627172 @default.
• W1971294629 cites W2003411878 @default.
• W1971294629 cites W2010376303 @default.
• W1971294629 cites W2021845150 @default.
• W1971294629 cites W2022433764 @default.
• W1971294629 cites W2034902271 @default.
• W1971294629 cites W2036823301 @default.
• W1971294629 cites W2040838669 @default.
• W1971294629 cites W2043279147 @default.
• W1971294629 cites W2044298031 @default.
• W1971294629 cites W2052714004 @default.
• W1971294629 cites W2059385397 @default.
• W1971294629 cites W2082981258 @default.
• W1971294629 cites W2087110475 @default.
• W1971294629 cites W2093928080 @default.
• W1971294629 cites W2099234372 @default.
• W1971294629 cites W2107419622 @default.
• W1971294629 cites W2107554748 @default.
• W1971294629 cites W2119817377 @default.
• W1971294629 cites W2120365943 @default.
• W1971294629 cites W2120486350 @default.
• W1971294629 cites W2123909581 @default.
• W1971294629 cites W2124837740 @default.
• W1971294629 cites W2133491083 @default.
• W1971294629 cites W2133993902 @default.
• W1971294629 cites W2137428107 @default.
• W1971294629 cites W2140289804 @default.
• W1971294629 cites W2142834965 @default.
• W1971294629 cites W2145157145 @default.
• W1971294629 cites W2151606470 @default.
• W1971294629 cites W2152054208 @default.
• W1971294629 cites W2157451489 @default.
• W1971294629 cites W2161234276 @default.
• W1971294629 cites W2163784018 @default.
• W1971294629 cites W2164518522 @default.
• W1971294629 cites W2169830490 @default.
• W1971294629 cites W2170122994 @default.
• W1971294629 doi "https://doi.org/10.1074/jbc.m308705200" @default.
• W1971294629 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12966088" @default.
• W1971294629 hasPublicationYear "2003" @default.
• W1971294629 type Work @default.
• W1971294629 sameAs 1971294629 @default.
• W1971294629 citedByCount "93" @default.
• W1971294629 countsByYear W19712946292012 @default.
• W1971294629 countsByYear W19712946292013 @default.
• W1971294629 countsByYear W19712946292014 @default.
• W1971294629 countsByYear W19712946292015 @default.
• W1971294629 countsByYear W19712946292016 @default.
• W1971294629 countsByYear W19712946292017 @default.
• W1971294629 countsByYear W19712946292018 @default.
• W1971294629 countsByYear W19712946292019 @default.
• W1971294629 countsByYear W19712946292020 @default.
• W1971294629 countsByYear W19712946292021 @default.
• W1971294629 countsByYear W19712946292022 @default.
• W1971294629 crossrefType "journal-article" @default.
• W1971294629 hasAuthorship W1971294629A5000713072 @default.
• W1971294629 hasAuthorship W1971294629A5024968631 @default.
• W1971294629 hasAuthorship W1971294629A5027987017 @default.
• W1971294629 hasAuthorship W1971294629A5048476466 @default.
• W1971294629 hasAuthorship W1971294629A5065867383 @default.
• W1971294629 hasAuthorship W1971294629A5074374757 @default.
• W1971294629 hasBestOaLocation W19712946291 @default.
• W1971294629 hasConcept C104317684 @default.
• W1971294629 hasConcept C2775984157 @default.
• W1971294629 hasConcept C41008148 @default.
• W1971294629 hasConcept C54355233 @default.
• W1971294629 hasConcept C70721500 @default.
• W1971294629 hasConcept C86339819 @default.
• W1971294629 hasConcept C86803240 @default.
• W1971294629 hasConcept C94966510 @default.
• W1971294629 hasConcept C95444343 @default.
• W1971294629 hasConceptScore W1971294629C104317684 @default.
• W1971294629 hasConceptScore W1971294629C2775984157 @default.
• W1971294629 hasConceptScore W1971294629C41008148 @default.

• next