FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1971424198> ?p ?o ?g. }

• W1971424198 endingPage "5317" @default.
• W1971424198 startingPage "5308" @default.
• W1971424198 abstract "Ligand-induced transcriptional activation of gene expression by nuclear receptors is dependent on recruitment of coactivators as intermediary factors. The present work describes the cloning and characterization of RAP250, a novel human nuclear receptor coactivator. The results of in vitro and invivo experiments indicate that the interaction of RAP250 with nuclear receptors is ligand-dependent or ligand-enhanced depending on the nuclear receptor and involves only one short LXXLL motif called nuclear receptor box. Transient transfection assays further demonstrate that RAP250 has a large intrinsic glutamine-rich activation domain and can significantly enhance the transcriptional activity of several nuclear receptors, acting as a coactivator. Interestingly, Northern blot and in situ hybridization analyses reveal that RAP250 is widely expressed with the highest expression in reproductive organs (testis, prostate and ovary) and brain. Together, our data suggest that RAP250 may play an important role in mammalian gene expression mediated by nuclear receptor. Ligand-induced transcriptional activation of gene expression by nuclear receptors is dependent on recruitment of coactivators as intermediary factors. The present work describes the cloning and characterization of RAP250, a novel human nuclear receptor coactivator. The results of in vitro and invivo experiments indicate that the interaction of RAP250 with nuclear receptors is ligand-dependent or ligand-enhanced depending on the nuclear receptor and involves only one short LXXLL motif called nuclear receptor box. Transient transfection assays further demonstrate that RAP250 has a large intrinsic glutamine-rich activation domain and can significantly enhance the transcriptional activity of several nuclear receptors, acting as a coactivator. Interestingly, Northern blot and in situ hybridization analyses reveal that RAP250 is widely expressed with the highest expression in reproductive organs (testis, prostate and ovary) and brain. Together, our data suggest that RAP250 may play an important role in mammalian gene expression mediated by nuclear receptor. nuclear hormone receptor amino acids activation function estrogen receptor glyceraldehyde-3-phosphate dehydrogenase glutathione S-transferase base pair(s) kilobase pair(s) DNA binding domain ligand binding domain mutated polymerase chain reaction peroxisome proliferator-activated receptor rapid amplification of cDNA ends retinoic acid retinoid X receptor thyroid hormone receptor relative light units The nuclear receptor (NR)1 superfamily is a large group of structurally related transcription factors that regulate target gene transcription in response to ligands. The complex genetic programs regulated by NRs include biological processes such as growth, cell differentiation, and homeostasis (1.Mangelsdorf D.J. Thummel C. Beato M. Herrlich P. Schutz G. Umesono K. Blumberg B. Kastner P. Mark M. Chambon P. Evans R.M. Cell. 1995; 83: 835-839Abstract Full Text PDF PubMed Scopus (6110) Google Scholar). They can be divided into several subfamilies on the basis of characteristics such as dimerization status, nature of the ligand, or structure of the DNA response element. NRs are characterized by a common domain structure, including a highly variable N-terminal region that contains a constitutive activation function (AF-1), a highly conserved DNA binding domain (DBD) responsible for recognition of specific DNA response elements, a conserved multifunctional C-terminal ligand binding domain (LBD), containing a dimerization and a ligand-dependent transactivation function (AF-2) (2.Mangelsdorf D.J. Evans R.M. Cell. 1995; 83: 841-850Abstract Full Text PDF PubMed Scopus (2843) Google Scholar). The liganded NRs bind to their cognate hormone response elements, located in the promoter or enhancer regions of target genes, and stimulate transcriptional activation by transmitting signals to the transcriptional machinery via direct protein-protein interactions (3.Beato M. Sanchez-Pacheco A. Endocr. Rev. 1996; 17: 587-609Crossref PubMed Scopus (355) Google Scholar, 4.Hadzic E. Desai-Yajnik V. Helmer E. Guo S. Wu S. Koudinova N. Casanova J. Raaka B.M. Samuels H.H. Mol. Cell. Biol. 1995; 15: 4507-4517Crossref PubMed Google Scholar, 5.Schulman I.G. Chakravarti D. Juguilon H. Romo A. Evans R.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8288-8292Crossref PubMed Scopus (91) Google Scholar). In addition, another class of proteins, called coactivators, are recruited and serve as bridging molecules between the transcription initiation complex and NRs (for reviews, see Refs. 6.Xu L. Glass C.K. Rosenfeld M.G. Curr. Opin. Genet. Dev. 1999; 9: 140-147Crossref PubMed Scopus (815) Google Scholar and 7.McKenna N.J. Lanz R.B. O'Malley B.W. Endocr. Rev. 1999; 20: 321-344Crossref PubMed Scopus (1658) Google Scholar). Most of the coactivators interact with the AF-2 domain of NRs through one or several LXXLL motifs called NR boxes (8.Le Douarin B. Nielsen A.L. Garnier J.M. Ichinose H. Jeanmougin F. Losson R. Chambon P. EMBO J. 1996; 15: 6701-6715Crossref PubMed Scopus (468) Google Scholar, 9.Torchia J. Rose D.W. Inostroza J. Kamei Y. Westin S. Glass C.K. Rosenfeld M.G. Nature. 1997; 387: 677-684Crossref PubMed Scopus (1108) Google Scholar, 10.Heery D.M. Kalkhoven E. Hoare S. Parker M.G. Nature. 1997; 387: 733-736Crossref PubMed Scopus (1778) Google Scholar, 11.McInerney E.M. Rose D.W. Flynn S.E. Westin S. Mullen T.M. Krones A. Inostroza J. Torchia J. Nolte R.T. Assa-Munt N. Milburn M.V. Glass C.K. Rosenfeld M.G. Genes Dev. 1998; 12: 3357-3368Crossref PubMed Scopus (529) Google Scholar, 12.Shiau A.K. Barstad D. Loria P.M. Cheng L. Kushner P.J. Agard D.A. Greene G.L. Cell. 1998; 95: 927-937Abstract Full Text Full Text PDF PubMed Scopus (2269) Google Scholar). Bona fide AF-2 coactivators include the three related members of the p160/SRC family, as well as the cointegrators CBP and p300 (for review, see Ref. 6.Xu L. Glass C.K. Rosenfeld M.G. Curr. Opin. Genet. Dev. 1999; 9: 140-147Crossref PubMed Scopus (815) Google Scholar). Because these coactivators possess intrinsic histone acetyltransferase activity and function in complex with other acetyltransferases, such as P/CAF, it has been proposed that functional connections exist between NR activation and the histone acetylation status. Evidence for the existence of NR-coactivator complexes came from biochemical studies identifying the TRAP/DRIP complex (13.Fondell J.D. Ge H. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8329-8333Crossref PubMed Scopus (464) Google Scholar, 14.Fondell J.D. Guermah M. Malik S. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1959-1964Crossref PubMed Scopus (133) Google Scholar, 15.Rachez C. Suldan Z. Ward J. Chang C.P. Burakov D. Erdjument-Bromage H. Tempst P. Freedman L.P. Genes Dev. 1998; 12: 1781-1800Crossref PubMed Scopus (332) Google Scholar, 16.Rachez C. Lemon B.D. Suldan Z. Bromleigh V. Gamble M. Näär A.M. Erdjument-Bromage H. Tempst P. Freedman L.P. Nature. 1999; 398: 824-828Crossref PubMed Scopus (637) Google Scholar), which may function more directly through contacts to the basal machinery. In addition to coactivators, other AF-2-binding proteins, such as RIP140 (17.Cavaillès V. Dauvois S. L'Horset F. Lopez G. Hoare S. Kushner P.J. Parker M.G. EMBO J. 1995; 14: 3741-3751Crossref PubMed Scopus (673) Google Scholar, 18.Treuter E. Albrektsen T. Johansson L. Leers J. Gustafsson J.-Å. Mol. Endocrinol. 1998; 12: 864-881Crossref PubMed Scopus (0) Google Scholar) or the nuclear orphan receptor SHP (19.Johansson L. Thomsen J.S. Damdimopoulos A.E. Spyrou G. Gustafsson J.-Å. Treuter E. J. Biol. Chem. 1999; 274: 345-353Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar), may serve important regulatory functions by inhibiting NR activation. To identify new potential coactivators, a mouse embryo cDNA library was screened using the yeast two-hybrid system with PPARα as bait. Here, we report the cloning and characterization of RAP250, a new NR coactivator. All constructs were generated using standard cloning procedures and verified by restriction enzyme analysis and DNA sequencing. Details of each construction are available upon request. The partial mouse RAP250 cDNA fragment encoding amino acids 782–1138 was released from the EcoRI site of the pGAD10 clone isolated by the yeast two-hybrid system and subcloned into theEcoRI site of pGEX-4T1 vector (Amersham Pharmacia Biotech). GST-hERα (aa 249–595) and GST-hTRα (aa 122–410) have been described previously (19.Johansson L. Thomsen J.S. Damdimopoulos A.E. Spyrou G. Gustafsson J.-Å. Treuter E. J. Biol. Chem. 1999; 274: 345-353Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar, 20.Leers J. Treuter E. Gustafsson J.-Å. Mol. Cell. Biol. 1998; 18: 6001-6013Crossref PubMed Scopus (93) Google Scholar). Mutated variant of RAP250 was constructed by two independent PCRs with the flanking primers and two mutagenesis primers: 5′-TTAACGAGCCCATTGGCGGTCAACGCACTACAGAGTGAC-3′ and 5′-GTCACTCTGTAGTGCGTTGACCGCCAATGGGCTCGTTAA-3′. The corresponding PCR products were isolated and combined together by an additional PCR with the flanking primers. The product of this PCR was digested byEcoRI and cloned into the corresponding site of pGEX-4T1. GST-RAP250 (aa 818–931) was generated by PCR and cloned into theEcoRI/SalI sites of pGEX-4T1. NRs for in vitro translation have been expressed from the following previously described plasmids: pBKCMVrPPARα (T3), pSG5mPPARγ2 (T7), pCMVhTRα (T3), pCMVhTRβ (T7) (18.Treuter E. Albrektsen T. Johansson L. Leers J. Gustafsson J.-Å. Mol. Endocrinol. 1998; 12: 864-881Crossref PubMed Scopus (0) Google Scholar), pBKCMVrRXRα (T3) (21.Wiebel F.F. Gustafsson J.-Å. Mol. Cell. Biol. 1997; 17: 3977-3986Crossref PubMed Google Scholar), pT7hERα (aa 1–595), and pT3hERβ (aa 1–485) (19.Johansson L. Thomsen J.S. Damdimopoulos A.E. Spyrou G. Gustafsson J.-Å. Treuter E. J. Biol. Chem. 1999; 274: 345-353Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar). Plasmids with mutated forms of TRα and RXRα have been described previously (21.Wiebel F.F. Gustafsson J.-Å. Mol. Cell. Biol. 1997; 17: 3977-3986Crossref PubMed Google Scholar, 22.Saatcioglu F. Bartunek P. Deng T. Zenke M. Karin M. Mol. Cell. Biol. 1993; 13: 3675-3685Crossref PubMed Scopus (95) Google Scholar). RAP250 deletion constructs were made by PCR and subcloned into the NotI/NheI sites of the plasmid pSG5Gal4(GBT9J). These plasmids were used both for transient transfection experiments and/or to in vitro translate RAP250 partial fragments. The following eukaryotic expression vectors were used to express NRs: pSG5mPPARγ2, pSG5-cTRα (22.Saatcioglu F. Bartunek P. Deng T. Zenke M. Karin M. Mol. Cell. Biol. 1993; 13: 3675-3685Crossref PubMed Scopus (95) Google Scholar), and pCMX-rRXRα (21.Wiebel F.F. Gustafsson J.-Å. Mol. Cell. Biol. 1997; 17: 3977-3986Crossref PubMed Google Scholar). pVP16-mRAP250 (aa 782–1138) was made by subcloning anEcoRI fragment from pGAD10-mRAP250 into pCMV-VP16. The luciferase reporter plasmids used were DR4-tk-Luc (21.Wiebel F.F. Gustafsson J.-Å. Mol. Cell. Biol. 1997; 17: 3977-3986Crossref PubMed Google Scholar), UAS-tk-Luc, PPRE-tk-Luc (18.Treuter E. Albrektsen T. Johansson L. Leers J. Gustafsson J.-Å. Mol. Endocrinol. 1998; 12: 864-881Crossref PubMed Scopus (0) Google Scholar), and DR1-tk-Luc (23.Feltkamp D. Wiebel F.F. Alberti S. Gustafsson J.-Å. J. Biol. Chem. 1999; 274: 10421-10429Abstract Full Text Full Text PDF PubMed Scopus (13) Google Scholar). pSG5-RAP250 plasmid used to transfect mammalian cells in the coactivation assay was obtained by subcloning the human full-length RAP250 cDNA (obtained by fusion of the 5′end cDNA to the KIAA0181 plasmid) into pSG5 vector. To isolate cDNAs encoding proteins that interact with PPARα, yeast two-hybrid screening was carried out as described previously for the isolation of hRIP140 (18.Treuter E. Albrektsen T. Johansson L. Leers J. Gustafsson J.-Å. Mol. Endocrinol. 1998; 12: 864-881Crossref PubMed Scopus (0) Google Scholar). As bait, Gal4-PPARα LBD/AF-2 was used to screen a mouse embryo cDNA library (CLONTECH) in the vector pGAD10. One clone revealed no homology with any characterized proteins but a strong homology with a human EST sequence of 6504 bp named KIAA0181 (24.Nagase T. Seki N. Ishikawa K. Tanaka A. Nomura N. DNA Res. 1996; 3: 17-24Crossref PubMed Scopus (143) Google Scholar). The Kazusa DNA Research Institute provided us the human homologue cDNA. We used RACE PCR to obtain the remaining 5′end sequence of the human RAP250. This PCR amplification was performed using human testis Marathon-ready cDNA (CLONTECH) as template. The first amplification was performed using the adaptor primer 1 and the gene-specific primer 5′-ATAGGAAATCCCGCCTCCATCCTA-3′ for 30 cycles followed by a final elongation of 7 min. Each cycle consisted of 10 s at 94 °C, 10 s at 63 °C, and 1 min 30 s at 68 °C; 1 μl of the PCR product was used as a template for the second amplification with the adaptor primer 2 and the nested gene-specific primer 5′-CTGGTTGTTGCTCTGAGCAAGGAT-3′ for 30 cycles, using essentially the same conditions as those used for the first amplification. The PCR product was cloned into pGEM-T (Promega), and 10 independent clones were sequenced. Human multiple tissue Northern blots with approximately 2 μg of poly(A)+ RNA per lane were hybridized according to the protocol of the manufacturer (CLONTECH). The probe used to detect RAP250 expression was a 0.8-kb EcoRI fragment (nucleotides 1104–1828) of hRAP250 cDNA radioactively labeled by the random-prime method (Rediprime, Amersham Pharmacia Biotech). GAPDH cDNA was also used as a control probe. Some variations of the control GAPDH levels were observed, showing a strong expression in skeletal muscle and heart, as it is often the case with these two tissues. Nevertheless, according to manufacturer, these variations in GAPDH expression reflect a tissue-specific expression rather than a nonequal loading of the samples. Adult male and female Harlan Sprague-Dawley rats, NMRI mice, and postnatal mice (1.5, 4, 8, and 14 days) were decapitated, and the tissues were excised and frozen on dry ice. Embryonic mice (e9–e17) and rats (e12–e21) were excised from pregnant females and frozen. The tissues were sectioned with Microm HM-500 cryostat at 14 μm and thawed on Polysine glasses (Menzel, Germany). In situ hybridization was carried out as described previously. Two oligonucleotide probes directed against the mouse RAP250 mRNA (nucleotides 3185–3219 and 3448–3479 as numbered on human sequence) were used. The sequences had 100% (3185GCACCCCCACCACAGCCACCACAGCAGCAGCCACA3219) and 96% (3448GCAAGGACCTGCCTCTGTGCCACCATCACCTG3479) homology to human RAP250 and less than 70% homology with any other known gene compared with the known sequences in the GenBankTM data base. Both probes produced similar results when used separately and were usually combined to intensify the hybridization signal. Several probes to nonrelated mRNAs with known expression patterns, with similar length and GC content, were used as controls to verify the specificity of the hybridizations. The human full-length RAP250 cDNA cloned in pSG5 was in vitrotranscribed and translated using rabbit reticulocyte lysate (TNT coupled in vitro system Promega) according to the manufacturer's recommendations with [35S]methionine. The radiolabeled protein was separated by 7% SDS-polyacrylamide gel electrophoresis, and the gel was then dried and autoradiographed. Cultures of Escherichia coli BL21(pLys) carrying the pGEX fusion constructs (RAP250, ERα, and TRα) were grown at 37 °C in Luria-Bertani medium containing 100 μg/ml ampicillin and 34 μg/ml chloramphenicol and supplemented with 2% glucose. AtA 600 0.6, the cultures were induced with 0.5 mm isopropyl-β-d-thiogalactopyranoside for 2–3 h at 30 °C. GST and GST-RAP250 proteins were purified as described previously (18.Treuter E. Albrektsen T. Johansson L. Leers J. Gustafsson J.-Å. Mol. Endocrinol. 1998; 12: 864-881Crossref PubMed Scopus (0) Google Scholar), and the bacteria expressing GST fused to NRs were harvested by centrifugation and resuspended in STE buffer (10 mm Tris-HCl (pH 8), 150 mm NaCl, 1 mm EDTA) and frozen on dry ice. After thawing, lysozyme were added to a final concentration of 0.1 mg/ml, and the suspension was rotated at 4 °C for 15 min. Then, dithiothreitol was added to a final concentration of 5 mm and Sarcosyl to 1.5%. After centrifugation at 10,000 × g for 30 min at 4 °C the lysates were added to glutathione-Sepharose 4B (Amersham Pharmacia Biotech) for 2 h at 4 °C and washed three times with phosphate-buffered saline (PBS). To produce pure GST fusion protein for electrophoretic mobility shift assay, the proteins were eluted with 4 volumes of 20 mm glutathione in 50 mm Tris-HCl (pH 8). Protein concentrations were determined by the Bradford dye binding procedure (Bio-Rad). All the NRs that we tested in pull-down assays werein vitro transcribed and translated using rabbit reticulocyte lysate (TNT-coupled in vitro system Promega) according to manufacturer's recommendations with [35S]methionine. Approximately 5 μg of GST fusion protein bound to glutathione-Sepharose 4B beads (Amersham Pharmacia Biotech) was used in each assay. The beads were incubated for 3 h with rotation at +4 °C with 2 μl of [35S]methionine-labeled protein in the presence of 2 μl of the appropriate ligand in dimethyl sulfoxide (Me2SO) or ethanol at final concentrations of 100 μm Wy14643 (PPARα), 200 nm T3 (TRs), 1 μmE2 (ERs), 100 μm BRL 49653 (PPARγ), or vehicle alone in a total volume of 200 μl of incubation buffer (20 mm Hepes KOH (pH 7.9), 20% (v/v) glycerol, 100 mm KCl, 5 mm MgCl2, 0.2 mm EDTA, 0.01% Nonidet P-40, 1.5% bovine serum albumin, 1 mm dithiothreitol, 0.2 mm phenylmethylsulfonyl fluoride) supplemented with a protease inhibitor mixture (Complete, Roche Molecular Biochemicals). Beads were separated by centrifugation (2000 × g) and washed three times for 15 min with incubation buffer without bovine serum albumin. Washed beads were resuspended in 60 μl of 1× SDS sample buffer, and an aliquot was subject to SDS-polyacrylamide gel electrophoresis. Before autoradiography, gels were stained with Coomassie Blue to control for the stability of the GST fusion proteins and equal loading. TRα and RXRα were synthesized in rabbit reticulocyte lysate by using the TNT-coupled in vitro transcription-translation system (Promega). Double-stranded synthetic oligonucleotides DR4-TRE 5′-TCGATCAGGTCATTTCAGGTCAGAG-3′ were radioactively labeled with [α-32P]dCTP. Binding reactions were performed in a total volume of 20 μl in 1× reaction buffer (5% glycerol, 5 mm dithiothreitol, 5 mm EDTA, 250 mm KCl, 100 mm HEPES (pH 7.5), 1 μg of poly(dI-dC), 25 mm MgCl2, 1 mg of bovine serum albumin per ml, 1 μg of salmon sperm DNA, 0.05% Triton X-100), 0.5 ng of labeled probe, 2 μl of each in vitro translated receptor protein, and, when indicated, 2 μl of the appropriate ligand in Me2SO. Finally, 0.5 μg per reaction of the purified GST-RAP250 was added as indicated in results. The binding reaction was allowed to proceed for 20 min on ice before the reaction mixtures were loaded on a 4% nondenaturing polyacrylamide gel. After 3 h of electrophoresis in 0.5× Tris-borate-EDTA (TBE) buffer at 4 °C, the gels were dried and autoradiographed. COS-7 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 100 μg/ml penicillin, and 100 μg/ml streptomycin (Life Technologies Inc.). For transient transfection assays, COS-7 cells were plated onto 6-well plates (Falcon) 24 h prior to transfection. Cells were transfected using Lipofectin as instructed by the manufacturer (Life Technologies Inc.). For each well, 0.5 μg of reporter plasmid and 0.5 μg of Gal4 expression plasmid were transfected. 24 h after transfection, cells were harvested and cell extracts were analyzed for luciferase activity as described (18.Treuter E. Albrektsen T. Johansson L. Leers J. Gustafsson J.-Å. Mol. Endocrinol. 1998; 12: 864-881Crossref PubMed Scopus (0) Google Scholar). Nuclear extracts were prepared from transfected cells, and Western blotting using a mouse anti-Gal4-DBD monoclonal antibody (Santa Cruz Biotechology) was carried out as described previously (19.Johansson L. Thomsen J.S. Damdimopoulos A.E. Spyrou G. Gustafsson J.-Å. Treuter E. J. Biol. Chem. 1999; 274: 345-353Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar). In the mammalian interaction and/or coactivation assays, 100 ng of wild type NR plasmids (TRs, RXR, and PPARs) and 0.5 μg of VP16 or VP16-mRAP250 plasmid (interaction assay) or 0.5 μg of pSG5 or pSG5-hRAP250 plasmid (coactivation assay) were transfected into COS-7 cells together with 0.5 μg of the appropriate reporter plasmid. Transfections were carried out for 4–6 h; the cells were then grown in presence of appropriate ligand or Me2SO for 36 h and then harvested and analyzed as described previously (18.Treuter E. Albrektsen T. Johansson L. Leers J. Gustafsson J.-Å. Mol. Endocrinol. 1998; 12: 864-881Crossref PubMed Scopus (0) Google Scholar). The human RAP250 nucleotide and protein sequences have been submitted to GenBankTM data base with accession number AF128458, and the partial mouse RAP250 nucleotide and protein sequences have been submitted with accession number AF135169. We used the yeast two-hybrid system to screen a mouse embryo cDNA library with PPARα-LBD as a bait as described previously (18.Treuter E. Albrektsen T. Johansson L. Leers J. Gustafsson J.-Å. Mol. Endocrinol. 1998; 12: 864-881Crossref PubMed Scopus (0) Google Scholar, 20.Leers J. Treuter E. Gustafsson J.-Å. Mol. Cell. Biol. 1998; 18: 6001-6013Crossref PubMed Scopus (93) Google Scholar). Of the isolated clones, more than 50% were isoforms of RXR, and a majority of the other clones were interacting parts of SMRT, N-CoR, TIF-2, and TRAP220 as described by Treuter et al. (18.Treuter E. Albrektsen T. Johansson L. Leers J. Gustafsson J.-Å. Mol. Endocrinol. 1998; 12: 864-881Crossref PubMed Scopus (0) Google Scholar). However, one of the interacting clones revealed no homology with any described protein, and data base searches revealed a strong homology with a human EST sequence of 6504 bp named KIAA0181 (24.Nagase T. Seki N. Ishikawa K. Tanaka A. Nomura N. DNA Res. 1996; 3: 17-24Crossref PubMed Scopus (143) Google Scholar). Compared with the human clone, this positive mouse clone only contained a partial cDNA sequence of 1.1 kb encoding 355 amino acids, corresponding to amino acids 782–1138 of the human sequence (Fig. 1 A) and showing 90% identity with the human protein (Fig. 1 C). The human clone contained a long open reading frame starting at nucleotide position 60 and a stop codon at nucleotide 6020. A downstream polyadenylation signal was also present in this cDNA, indicating that the 3′-end of the gene was intact. However, the first in-frame ATG codon of this human clone was not in an optimal context for translational initiation (no perfect Kozak site (26.Kozak M. J. Cell Biol. 1989; 108: 229-241Crossref PubMed Scopus (2810) Google Scholar) and no in-frame stop codon upstream of this first methionine), suggesting that it perhaps was not the real initiation codon. In order to get a longer 5′-end sequence, we performed a 5′-RACE PCR and amplified an additional sequence of 433 nucleotides, which included 231 nucleotides encoding 77 additional amino acids. The nucleotide sequence of the reconstituted full-length cDNA is 6878 bp in length. It contains a short 5′-untranslated region of 202 bp with an upstream stop codon in frame with the first methionine, a longer 3′-untranslated region of 484 bp, and a 6189-bp open reading frame that encodes a protein of 2063 amino acids with a calculated mass of 220 kDa (Fig. 1 A). The beginning of the coding sequence was defined by the first ATG downstream of an in-frame stop codon at position −51. The sequence (ACCATGGTTTTG) surrounding the ATG essentially conforms to the Kozak site ((A/G)cc ATG Gat) (26.Kozak M. J. Cell Biol. 1989; 108: 229-241Crossref PubMed Scopus (2810) Google Scholar). To determine the size of the protein, we performed an in vitrotranslation after synthesis of mRNA via a bacteriophage DNA-dependent RNA polymerase. As shown in Fig.1 B, the estimated M r of the most prevalent in vitro synthesized protein is 250,000, which is consistent with the calculated size. This protein was designated RAP250 (nuclear receptor-activating protein 250) to signify both its potential coactivation function and its size in kilodaltons. The human RAP250 shows some specific features such as a Gln-rich region flanked by two poly-Gln stretches in the N-terminal region (see Fig. 1 A) and two copies of the LXXLL motif (LVNLL, aa 887–891, and LSQLL, aa 1494–1495) that are consistent with a coactivator function. Of the two LXXLL motifs present in the human sequence, the mouse partial clone only contains the first one (Fig.1 C). Northern blot analysis of human RNAs revealed a widespread major RAP250 transcript of approximately 7.5 kb in length, which was present at different levels depending on the tissue (Fig.2 A). High levels were detected in reproductive organs, such as ovary, testis, and prostate, as well as in peripheral blood leukocytes, brain, and heart, and intermediate levels were observed in pancreas, kidney, liver, colon, spleen, and placenta. RAP250 mRNA levels were low but still detectable in small intestine, thymus, and skeletal muscle. Interestingly, in testis, a second transcript of approximately 4.5 kb in length was also detected. cDNA cloning and sequence analysis of this shorter mRNA indicated that it was an alternatively spliced form of RAP250 with an open reading frame encoding a 1070-amino acid-protein and encompassing amino acids 1–971 and 1965–2063 (data not shown). Thus, considering mRNA levels, testis appears to be the main RAP250 expressing organ. In peripheral blood leukocytes, a second 6-kb transcript was also detected that might represent either another alternatively spliced mRNA or a closely related but different gene product. The levels of RAP250 mRNA in mouse and rat embryos were quite similar. RAP250 mRNA was widely detected during ontogeny. At embryonic day 9 (e9), clear signal was present in placenta, and lower expression could be seen in uterus (Fig. 2, Ba). At this stage, neural tube expressed high levels of RAP250 mRNA and the expression in central nervous system was high throughout ontogeny (Fig. 2, Ba–Bc). The expression in spinal cord and in cerebrum was high and became more restricted during later stages of development (e17 onwards) and postnatal life. High expression was seen in cerebellum during development of this subregion of the brain (Fig. 2, Bc). Also, sensory ganglia and retina showed high expression from e11 onwards (Fig. 2, Bd). In the alimentary tract (oral cavity, stomach, and intestine), expression was seen from e13 and thereafter (Fig. 2, Bb and Bc). The developing teeth and salivary gland were also labeled (Fig. 2, Bc). Olfactory epithelium was strongly labeled from e13 onwards (Fig. 2, Bband Bc). Strong expression was present in liver (from e11) and kidney (from e13 onwards), and these levels decreased at later stages of development (Fig. 2, Bb and Bc). Lung had moderate signal from e13 and this level decreased during postnatal life (Fig. 2, Bc). Prominent signal was seen in thymus from e15 onwards, and in spleen from e17 and during early postnatal life, and subsequently, the expression decreased (Fig. 2, Bb andBc). Low to moderate signal was seen in brown fat, as well as developing muscles, bones, and intervertebral discs. In adult mouse and rat, expression of RAP250 mRNA was more restricted than during embryonic development. High expression was observed in male and female rat genital organs. In testis, seminiferous tubules exhibited a strong signal and expression in separate tubules varied, indicating that RAP250 may be expressed in a stage-specific manner during spermatogenesis (Fig. 2, Be). In dipped sections, RAP250 mRNA could be seen in primary spermatocytes. Prominent expression was also seen in the epithelium of prostate, whereas epididymis and seminal vesicles had low signals (Fig. 2, Bf). In ovary, the strongest signal was seen in interstitial cells and in the granulosa cells of different size follicles (Fig. 2, Bg). In the central nervous system, high expression was present in olfactory bulb, piriform cortex, hippocampus and cerebellar cortex, whereas other areas exhibited lower levels of RAP250 mRNA (Fig. 2, Bh). The partial mouse RAP250 clone was originally isolated via its interaction with the PPARα-LBD bait in the yeast two-hybrid system. To determine whether the mouse RAP250 could interact with other NRs, we set up an in vitro protein-protein interaction assay with the mouse partial RAP250 clone (aa 782–1138) fused to GST, referred to here as GST-RAP250, and radioactively labeled in vitro translated NRs. As shown in Fig.3, PPARs, TRs and ERs specifically interacted with GST-RAP250 but not with GST. The addition of appropriate ligands in the binding buffer increased the interaction between GST-RAP250 and most of NRs (Fig. 3 B, lanes 3, and Fig. 4), indicating a ligand-dependent interaction in the cases of TRs, and a ligand-enhanced interaction for ERs and PPARs. To investigate whether the LXXLL motif (LVNLL, aa 891–895) of mouse RAP250 was responsible for the interaction with NRs, the leucine core motif was mutated to AVNAL, as shown in Fig. 3 A. Mutation of this motif abolished the interaction of GST-RAP250 with all tested NRs both in absence or presence of ligands (Fig. 3, lanes 5 and6), indicating that the interaction between RAP250 and NRs was mediated by an LXXLL motif, the integrity of which is required to function as an NR box.Figure 4The NR interaction domain of RAP250 contains only" @default.
• W1971424198 created "2016-06-24" @default.
• W1971424198 creator A5021011106 @default.
• W1971424198 creator A5033325644 @default.
• W1971424198 creator A5082190458 @default.
• W1971424198 creator A5083465668 @default.
• W1971424198 creator A5085801141 @default.
• W1971424198 date "2000-02-01" @default.
• W1971424198 modified "2023-10-18" @default.
• W1971424198 title "Cloning and Characterization of RAP250, a Novel Nuclear Receptor Coactivator" @default.
• W1971424198 cites W1487669901 @default.
• W1971424198 cites W1501286679 @default.
• W1971424198 cites W1593089530 @default.
• W1971424198 cites W1596796792 @default.
• W1971424198 cites W1602722523 @default.
• W1971424198 cites W1613446635 @default.
• W1971424198 cites W1954999733 @default.
• W1971424198 cites W1965886467 @default.
• W1971424198 cites W1971657931 @default.
• W1971424198 cites W1973517906 @default.
• W1971424198 cites W1995754186 @default.
• W1971424198 cites W2008632158 @default.
• W1971424198 cites W2008698762 @default.
• W1971424198 cites W2026237709 @default.
• W1971424198 cites W2026291162 @default.
• W1971424198 cites W2029725115 @default.
• W1971424198 cites W2056635197 @default.
• W1971424198 cites W2070526380 @default.
• W1971424198 cites W2073353512 @default.
• W1971424198 cites W2083914903 @default.
• W1971424198 cites W2084722787 @default.
• W1971424198 cites W2085792867 @default.
• W1971424198 cites W2091322528 @default.
• W1971424198 cites W2098464529 @default.
• W1971424198 cites W2111650618 @default.
• W1971424198 cites W2134623365 @default.
• W1971424198 cites W2141686420 @default.
• W1971424198 cites W2158268923 @default.
• W1971424198 cites W2160402926 @default.
• W1971424198 cites W2165762583 @default.
• W1971424198 cites W2168847939 @default.
• W1971424198 cites W2172256092 @default.
• W1971424198 cites W25692858 @default.
• W1971424198 cites W4235753716 @default.
• W1971424198 doi "https://doi.org/10.1074/jbc.275.8.5308" @default.
• W1971424198 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10681503" @default.
• W1971424198 hasPublicationYear "2000" @default.
• W1971424198 type Work @default.
• W1971424198 sameAs 1971424198 @default.
• W1971424198 citedByCount "133" @default.
• W1971424198 countsByYear W19714241982012 @default.
• W1971424198 countsByYear W19714241982013 @default.
• W1971424198 countsByYear W19714241982014 @default.
• W1971424198 countsByYear W19714241982015 @default.
• W1971424198 countsByYear W19714241982016 @default.
• W1971424198 countsByYear W19714241982017 @default.
• W1971424198 countsByYear W19714241982018 @default.
• W1971424198 countsByYear W19714241982019 @default.
• W1971424198 countsByYear W19714241982020 @default.
• W1971424198 countsByYear W19714241982021 @default.
• W1971424198 countsByYear W19714241982022 @default.
• W1971424198 countsByYear W19714241982023 @default.
• W1971424198 crossrefType "journal-article" @default.
• W1971424198 hasAuthorship W1971424198A5021011106 @default.
• W1971424198 hasAuthorship W1971424198A5033325644 @default.
• W1971424198 hasAuthorship W1971424198A5082190458 @default.
• W1971424198 hasAuthorship W1971424198A5083465668 @default.
• W1971424198 hasAuthorship W1971424198A5085801141 @default.
• W1971424198 hasBestOaLocation W19714241981 @default.
• W1971424198 hasConcept C104317684 @default.
• W1971424198 hasConcept C121050878 @default.
• W1971424198 hasConcept C167625842 @default.
• W1971424198 hasConcept C170493617 @default.
• W1971424198 hasConcept C171250308 @default.
• W1971424198 hasConcept C185592680 @default.
• W1971424198 hasConcept C192562407 @default.
• W1971424198 hasConcept C19924922 @default.
• W1971424198 hasConcept C199360897 @default.
• W1971424198 hasConcept C203966977 @default.
• W1971424198 hasConcept C2780841128 @default.
• W1971424198 hasConcept C41008148 @default.
• W1971424198 hasConcept C54355233 @default.
• W1971424198 hasConcept C70721500 @default.
• W1971424198 hasConcept C77445288 @default.
• W1971424198 hasConcept C86339819 @default.
• W1971424198 hasConcept C86803240 @default.
• W1971424198 hasConcept C95444343 @default.
• W1971424198 hasConceptScore W1971424198C104317684 @default.
• W1971424198 hasConceptScore W1971424198C121050878 @default.
• W1971424198 hasConceptScore W1971424198C167625842 @default.
• W1971424198 hasConceptScore W1971424198C170493617 @default.
• W1971424198 hasConceptScore W1971424198C171250308 @default.
• W1971424198 hasConceptScore W1971424198C185592680 @default.
• W1971424198 hasConceptScore W1971424198C192562407 @default.
• W1971424198 hasConceptScore W1971424198C19924922 @default.
• W1971424198 hasConceptScore W1971424198C199360897 @default.
• W1971424198 hasConceptScore W1971424198C203966977 @default.
• W1971424198 hasConceptScore W1971424198C2780841128 @default.

• next