FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1971881511> ?p ?o ?g. }

• W1971881511 endingPage "28541" @default.
• W1971881511 startingPage "28533" @default.
• W1971881511 abstract "A UGA codon and a selenocysteine insertion sequence in the 3′-untranslated region are the only established mRNA elements necessary for selenocysteine (Sec or U) incorporation during translation. These two elements, however, do not universally confer efficient Sec incorporation. The objective of this study was to systematically examine the effect of UGA codon position on efficiency of Sec insertion. In a glutathione peroxidase-1 (F-GPX1) expression vector, the UGA at the native position (U47) was mutated to a cysteine codon, and codons for Ser-7, Ser-12, Ser-18, Ser-29, Ser-45, Ser-93, Cys-154, Val-172, Ser-178, and Ser-195 were individually mutated to UGA and transiently expressed in COS-7 cells. 75Se incorporation at the 11 positions was 31, 72, 54, 105, 90, 100, 146, 135, 13, 11, and 43%, respectively, of 75Se incorporation at U47, suggesting that Sec is more efficiently incorporated at UGA codons positioned in the middle of the coding region rather than close to the 5′ or 3′ ends. Ribonuclease protection showed that these differences were not due to differences in mRNA level. When the green fluorescence protein (GFP) coding region was placed in-frame at the 5′ or 3′ ends of the coding region in F-GPX1 to produce chimeric 50–51-kDa GFP/GPX1 proteins, Sec incorporation at UGA codons, formerly close to the 5′ or 3′ ends, was increased to levels comparable to the UGA at U47. Insertion of GFP after the UAA-stop was just as effective in increasing Sec insertion efficiency as GFP inserted before the stop. These studies used a recombinant expression model that incorporated Sec at non-native UGA codons at rates equal to those of endogenous glutathione peroxidase-1 and showed that the efficiency of Sec incorporation can be modulated by UGA position; Sec incorporation at high efficiency appears to require that the UGA be >21 nucleotides from the AUG-start and >204 nucleotides from the selenocysteine insertion sequence element. A UGA codon and a selenocysteine insertion sequence in the 3′-untranslated region are the only established mRNA elements necessary for selenocysteine (Sec or U) incorporation during translation. These two elements, however, do not universally confer efficient Sec incorporation. The objective of this study was to systematically examine the effect of UGA codon position on efficiency of Sec insertion. In a glutathione peroxidase-1 (F-GPX1) expression vector, the UGA at the native position (U47) was mutated to a cysteine codon, and codons for Ser-7, Ser-12, Ser-18, Ser-29, Ser-45, Ser-93, Cys-154, Val-172, Ser-178, and Ser-195 were individually mutated to UGA and transiently expressed in COS-7 cells. 75Se incorporation at the 11 positions was 31, 72, 54, 105, 90, 100, 146, 135, 13, 11, and 43%, respectively, of 75Se incorporation at U47, suggesting that Sec is more efficiently incorporated at UGA codons positioned in the middle of the coding region rather than close to the 5′ or 3′ ends. Ribonuclease protection showed that these differences were not due to differences in mRNA level. When the green fluorescence protein (GFP) coding region was placed in-frame at the 5′ or 3′ ends of the coding region in F-GPX1 to produce chimeric 50–51-kDa GFP/GPX1 proteins, Sec incorporation at UGA codons, formerly close to the 5′ or 3′ ends, was increased to levels comparable to the UGA at U47. Insertion of GFP after the UAA-stop was just as effective in increasing Sec insertion efficiency as GFP inserted before the stop. These studies used a recombinant expression model that incorporated Sec at non-native UGA codons at rates equal to those of endogenous glutathione peroxidase-1 and showed that the efficiency of Sec incorporation can be modulated by UGA position; Sec incorporation at high efficiency appears to require that the UGA be >21 nucleotides from the AUG-start and >204 nucleotides from the selenocysteine insertion sequence element. glutathione peroxidase-1 phospholipid hydroperoxide glutathione peroxidase green fluorescent protein selenocysteine selenocysteine insertion sequences thioredoxin reductase selenocysteine untranslated region nucleotide polymerase chain reaction polyacrylamide gel electrophoresis. Mammalian glutathione peroxidase-1 (GPX11; H2O2:GSH oxidoreductase, EC 1.11.1.9) was the first identified selenium-containing enzyme (1Rotruck J.T. Pope A.L. Ganther H.E. Swanson A.B. Hafeman D.G. Hoekstra W.G. Science. 1973; 179: 588-590Crossref PubMed Scopus (6207) Google Scholar), and this discovery provided a biochemical role for selenium. The selenium is present as selenocysteine (Sec or U) incorporated into the peptide backbone, and Sec is located at the active site of GPX1 (2Chambers I. Frampton J. Goldfarb P. Affara N. McBain W. Harrison P.R. EMBO J. 1986; 5: 1221-1227Crossref PubMed Scopus (528) Google Scholar, 3Epp O. Ladenstein R. Wendel A. Eur. J. Biochem. 1983; 133: 51-69Crossref PubMed Scopus (612) Google Scholar). In the intervening years, three additional members of the glutathione peroxidase family have been shown to be selenoenzymes (4Schuckelt R. Brigelius-Flohé R. Maiorino M. Roveri A. Reumkens J. Strassburger W. Flohé L. Free Radical Res. Commun. 1991; 14: 343-361Crossref PubMed Scopus (115) Google Scholar, 5Sunde R.A. Dyer J.A. Moran T.V. Evenson J.K. Sugimoto M. Biochem. Biophys. Res. Commun. 1993; 193: 905-911Crossref PubMed Scopus (62) Google Scholar, 6Chu F.F. Doroshow J.H. Esworthy R.S. J. Biol. Chem. 1993; 268: 2571-2576Abstract Full Text PDF PubMed Google Scholar, 7Maiorino M. Chu F.F. Ursini F. Davies K.J. Doroshow J.H. Esworthy R.S. J. Biol. Chem. 1991; 266: 7728-7732Abstract Full Text PDF PubMed Google Scholar, 8Akasaka M. Mizoguchi J. Takahashi K. Nucleic Acids Res. 1990; 18: 4619Crossref PubMed Scopus (28) Google Scholar). In addition, the three mammalian deiodinases are now known to be selenoenzymes (9Larsen P.R. Berry M.J. Annu. Rev. Nutr. 1995; 15: 323-352Crossref PubMed Scopus (158) Google Scholar); thioredoxin reductase (TR) was recently shown to contain Sec as the penultimate amino acid (10Gladyshev V.N. Jeang K. Stadtman T.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6146-6151Crossref PubMed Scopus (410) Google Scholar, 11Tamura T. Stadtman T.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1006-1011Crossref PubMed Scopus (477) Google Scholar), and one isoform of the enzyme responsible for activating selenium, selenophosphate synthetase-2, also contains Sec (12Guimaraes M.J. Peterson D. Vicari A. Cocks B.G. Copeland N.G. Gilbert D.J. Jenkins N.A. Ferrick D.A. Kastelein R.A. Bazan J.F. Zlotnik A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15086-15091Crossref PubMed Scopus (197) Google Scholar, 13Kim I.Y. Guimaraes M.J. Zlotnik A. Bazan J.F. Stadtman T.C. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 418-421Crossref PubMed Scopus (54) Google Scholar). Sec is the active cofactor for these catalytic reactions (3Epp O. Ladenstein R. Wendel A. Eur. J. Biochem. 1983; 133: 51-69Crossref PubMed Scopus (612) Google Scholar, 14Berry M.J. Kieffer J.D. Larsen P.R. Endocrinology. 1991; 129: 550-552Crossref PubMed Scopus (68) Google Scholar, 15Berry M.J. Kieffer J.D. Harney J.W. Larsen P.R. J. Biol. Chem. 1991; 266: 14155-14158Abstract Full Text PDF PubMed Google Scholar, 16Rocher C. Lalanne J.L. Chaudiere J. Eur. J. Biochem. 1992; 205: 955-960Crossref PubMed Scopus (136) Google Scholar). Finally, selenoprotein W (17Vendeland S.C. Beilstein M.A. Yeh J.Y. Ream W. Whanger P.D. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8749-8753Crossref PubMed Scopus (105) Google Scholar) with one Sec and plasma selenoprotein P (18Hill K.E. Lloyd R.S. Burk R.F. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 537-541Crossref PubMed Scopus (159) Google Scholar) with up to 10 Sec residues are selenoproteins with unknown function. Selenoproteins and selenoenzymes are also found in the prokaryotic and archae kingdoms (19Stadtman T.C. Annu. Rev. Biochem. 1996; 65: 83-100Crossref PubMed Scopus (813) Google Scholar, 20Axley M.J. Stadtman T.C. Annu. Rev. Nutr. 1989; 9: 127-137Crossref PubMed Scopus (28) Google Scholar, 21Sunde R.A. O'Dell B.L. Sunde R.A. Handbook of Nutritionally Essential Mineral Elements. Marcel Dekker, Inc., New York1997: 493-556Google Scholar, 22Low S.C. Berry M.J. Trends Biochem. Sci. 1996; 21: 203-208Abstract Full Text PDF PubMed Scopus (392) Google Scholar), showing the ubiquitous distribution of Sec-containing translation products. For all known selenoproteins, selenium is present as Sec and is incorporated during translation at specific positions encoded by in-frame UGA codons (19Stadtman T.C. Annu. Rev. Biochem. 1996; 65: 83-100Crossref PubMed Scopus (813) Google Scholar, 21Sunde R.A. O'Dell B.L. Sunde R.A. Handbook of Nutritionally Essential Mineral Elements. Marcel Dekker, Inc., New York1997: 493-556Google Scholar, 23Low S.C. Harney J.W. Berry M.J. J. Biol. Chem. 1995; 270: 21659-21664Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 24Böck A. Burk R.F. Selenium in Biology and Human Health. Springer-Verlag Inc., New York1994: 9-25Crossref Google Scholar, 25Burk R.F. Hill K.E. Annu. Rev. Nutr. 1993; 13: 65-81Crossref PubMed Scopus (267) Google Scholar). A selenocysteine insertion sequence (SECIS) element stem-loop has been shown to be necessary for recognition of the UGA as a Sec codon rather than a nonsense codon (24Böck A. Burk R.F. Selenium in Biology and Human Health. Springer-Verlag Inc., New York1994: 9-25Crossref Google Scholar,26Berry M.J. Banu L. Chen Y. Mandel S.J. Kieffer J.D. Harney J.W. Larsen P.R. Nature. 1991; 353: 273-276Crossref PubMed Scopus (528) Google Scholar). In eukaryotes, the SECIS element is located in the 3′-UTR, whereas in prokaryotes, the SECIS element is located immediately downstream of the UGA codon. Together the UGA and SECIS elements appear to be the two necessary cis-acting mRNA elements that confer recognition of UGA as a Sec codon during translation (24Böck A. Burk R.F. Selenium in Biology and Human Health. Springer-Verlag Inc., New York1994: 9-25Crossref Google Scholar, 27Berry M.J. Banu L. Harney J.W. Larsen P.R. EMBO J. 1993; 12: 3315-3322Crossref PubMed Scopus (348) Google Scholar, 28Shen Q. Chu F.-F. Newburger P.E. J. Biol. Chem. 1993; 268: 11463-11469Abstract Full Text PDF PubMed Google Scholar). The carbon skeleton of the Sec is provided by serine (29Sunde R.A. Evenson J.K. J. Biol. Chem. 1987; 262: 933-937Abstract Full Text PDF PubMed Google Scholar); serine, esterified to a unique tRNAUCASer→Sec in both eukaryotes and prokaryotes, and selenophosphate, synthesized by selenophosphate synthetase, are the substrates used to form Sec-tRNAUCASer→Sec (24Böck A. Burk R.F. Selenium in Biology and Human Health. Springer-Verlag Inc., New York1994: 9-25Crossref Google Scholar, 30Hatfield D.L. Choi I.S. Ohama T. Jung J. Diamond A.M. Burk R.F. Selenium in Biology and Human Health. Springer-Verlag Inc., New York1994: 25-44Crossref Google Scholar). This reaction is catalyzed by selenocysteine synthetase (SELA) in bacteria (31Forchhammer K. Leinfelder W. Boesmiller K. Veprek B. Böck A. J. Biol. Chem. 1991; 266: 6318-6323Abstract Full Text PDF PubMed Google Scholar, 32Forchhammer K. Böck A. J. Biol. Chem. 1991; 266: 6324-6328Abstract Full Text PDF PubMed Google Scholar), but the enzyme is yet to be characterized in eukaryotes. The remaining steps for translational insertion of Sec into selenoproteins must be inferred from the known bacterial reactions wherein a unique elongation factor (SELB) with affinity for the SECIS element promotes the formation of a quaternary mRNA·Sec-tRNAUCASer→Sec·SELB·GTP complex that leads to translational incorporation of Sec into the nascent polypeptide chain (33Kromayer M. Wilting R. Tormay P. Böck A. J. Mol. Biol. 1996; 202: 413-420Crossref Scopus (98) Google Scholar, 34Tormay P. Sawers A. Böck A. Mol. Microbiol. 1996; 21: 1253-1259Crossref PubMed Scopus (47) Google Scholar). Several eukaryotic candidates for SELB have recently been reported (35Hubert N. Walczak R. Carbon P. Krol A. Nucleic Acids Res. 1996; 24: 464-469Crossref PubMed Google Scholar, 36Lesoon A. Mehta A. Singh R. Chisolm G.M. Driscoll D.M. Mol. Cell. Biol. 1997; 17: 1977-1985Crossref PubMed Scopus (75) Google Scholar, 37Shen Q. McQuilkin P.A. Newburger P.E. J. Biol. Chem. 1995; 270: 30448-30452Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar, 38Shen Q. Wu R. Leonard J.L. Newburger P.E. J. Biol. Chem. 1998; 273: 5443-5446Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). To study Sec incorporation, a good experimental model is needed.75Se is readily incorporated into selenoproteins when animals are injected with 75Se or when cells are cultured with 75Se (21Sunde R.A. O'Dell B.L. Sunde R.A. Handbook of Nutritionally Essential Mineral Elements. Marcel Dekker, Inc., New York1997: 493-556Google Scholar). Insertion of intact selenoprotein cDNAs or genes into conventional expression vectors, however, typically results at best in 2–5-fold overexpression of GPX1 activity when the host endogenously expresses the selenoprotein (39Brigelius-Flohe R. Friedrichs B. Maurer S. Schultz M. Streicher R. Biochem. J. 1998; 328: 199-203Crossref Scopus (133) Google Scholar, 40Kretz-Remy C. Mehlen P. Mirault M.E. Arrigo A.P. J. Cell Biol. 1996; 133: 1083-1093Crossref PubMed Scopus (237) Google Scholar, 41Weiss S.L. Sunde R.A. J. Nutr. 1997; 127: 1304-1310Crossref PubMed Scopus (30) Google Scholar, 42Weiss S.L. Sunde R.A. RNA (NY). 1998; 4: 816-827Crossref PubMed Scopus (67) Google Scholar). Cysteine-substituted GPX1 has been synthesized in bacteria using mutant Sec→Cys constructs, but synthesis of eukaryotic selenoproteins in bacterial systems does not occur due to disparate ribosomal and translational factors (16Rocher C. Lalanne J.L. Chaudiere J. Eur. J. Biochem. 1992; 205: 955-960Crossref PubMed Scopus (136) Google Scholar, 43Rocher C. Faucheu C. Hervë F. Bënicourt C. Lalanne J.L. Gene (Amst.). 1991; 98: 193-200Crossref PubMed Scopus (16) Google Scholar, 44Tormay P. Böck A. J. Bacteriol. 1997; 179: 576-582Crossref PubMed Google Scholar). By using transfection in oocytes as well as in several different mammalian cell lines, a number of researchers have studied the effect of various SECIS elements and the effect of primary and secondary SECIS structure on Sec incorporation into selenoproteins. SECIS elements from type I deiodinase, GPX1, GPX4, selenoprotein P (with two SECIS elements), and selenoprotein W all confer the ability of an UGA-containing mRNA to incorporate Sec during translation (22Low S.C. Berry M.J. Trends Biochem. Sci. 1996; 21: 203-208Abstract Full Text PDF PubMed Scopus (392) Google Scholar, 26Berry M.J. Banu L. Chen Y. Mandel S.J. Kieffer J.D. Harney J.W. Larsen P.R. Nature. 1991; 353: 273-276Crossref PubMed Scopus (528) Google Scholar, 27Berry M.J. Banu L. Harney J.W. Larsen P.R. EMBO J. 1993; 12: 3315-3322Crossref PubMed Scopus (348) Google Scholar, 45Berry M.J. Maia A.L. Kieffer J.D. Harney J.W. Larsen P.R. Endocrinology. 1992; 131: 1848-1852Crossref PubMed Scopus (108) Google Scholar, 46Martin G.W.I. Harney J.W. Berry M.J. RNA (NY). 1996; 2: 171-182Crossref PubMed Scopus (5) Google Scholar, 47Kollmus H. Flohé L. McCarthy J.E.G. Nucleic Acids Res. 1996; 24: 1195-1201Crossref PubMed Scopus (75) Google Scholar). The efficiency of Sec incorporation occurs at 1/400th to 1/20th of the rate for Cys incorporation, and this efficiency varies markedly depending on the nature of the SECIS element (13Kim I.Y. Guimaraes M.J. Zlotnik A. Bazan J.F. Stadtman T.C. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 418-421Crossref PubMed Scopus (54) Google Scholar, 27Berry M.J. Banu L. Harney J.W. Larsen P.R. EMBO J. 1993; 12: 3315-3322Crossref PubMed Scopus (348) Google Scholar, 45Berry M.J. Maia A.L. Kieffer J.D. Harney J.W. Larsen P.R. Endocrinology. 1992; 131: 1848-1852Crossref PubMed Scopus (108) Google Scholar, 47Kollmus H. Flohé L. McCarthy J.E.G. Nucleic Acids Res. 1996; 24: 1195-1201Crossref PubMed Scopus (75) Google Scholar). Far fewer studies have directly examined the effect of the UGA position on the efficiency of Sec incorporation. Mutation of four codons to UGA at other positions throughout type I deiodinase demonstrated that a specific UGA context was not required for Sec incorporation (27Berry M.J. Banu L. Harney J.W. Larsen P.R. EMBO J. 1993; 12: 3315-3322Crossref PubMed Scopus (348) Google Scholar). Deletion of nucleotide sequences adjacent to the UGA codon of GPX1 resulted in translational incorporation of 75Se into recombinant GPX1, although relative 75Se incorporation was reduced for at least four of the constructs (28Shen Q. Chu F.-F. Newburger P.E. J. Biol. Chem. 1993; 268: 11463-11469Abstract Full Text PDF PubMed Google Scholar). One study, which focused directly on the base following the UGA, reported that Sec incorporation could change as much as 3-fold depending on the identity of the fourth base. These reports suggest that additional cis-elements may be required for efficient Sec translation or that the assembly of the required components at the UGA in combination with competition with release factors may be inefficient relative to the incorporation of other amino acids. Thus we conducted these studies to systematically investigate the effect of UGA position on Sec incorporation. We constructed a genomic GPX1 expression vector that overexpressed 75Se-labeled recombinant protein at levels greater than the endogenously encoded selenoproteins. Mutation of 10 separate codons to UGA indicated that UGA codons located in the middle of the open reading frame efficiently direct Sec incorporation. Codons located close to the 5′-start or 3′-termination codons were much less efficient, but insertion of a green fluorescent protein (GFP) coding region as a spacer increased the efficiency of Sec incorporation at these positions to that of the wild-type UGA position. These studies suggest that for optimum Sec incorporation the UGA must be >21 nt from the AUG-start and >204 nt from the SECIS element. The oligonucleotides uses are as follows: 57, cgactacaaagatgacgatgacaaagc (for inserting FLAG-epitope); 58, tttgtcatcgtcatctttgtagtcggc (for inserting FLAG-epitope); 59, cgtggtgccgcagagagacgc (for changing U47 to Cys); 73, gtagtcggctcagagccgag (for changing Ser-7 to U); 76, catacacggttcactgtgccg (for changing Ser-12 to U); 77, gcgggcgcgctcagaaggcat (for changing Ser-18 to U); 74, gagcccagtcacacaggctc (for changing Ser-29 to U); 65, tgccgcagagtcacgcgaca (for changing Ser-45 to U); 63, gtacttgagtcaattcagaatc (for changing Ser-93 to U); 64, gtcgttgcgtcacaccggag (for changing Cys-154 to U); 78, gcgcacgggtcaaccgtcggg (for changing Val-172 to U); 72, aagcggcgtcagtacctgcg (for changing Ser-178 to U); 79, cagactgctgtcacagcaggg (for changing Ser-195 to U); 80, agctgtacaagtgtgctgctcggctc (5′-PCR primer for GFP-GPX1); 81, attgtacaatgacacaggacacacaaac (3′-PCR primer for GFP-GPX1); 104, gtgagcaagggcgaggag (5′-PCR primer for GPX1-GFP and GPX1-taa-gfp); 105, ttacttgtacagctcgtc (3′-PCR primer for GPX1-GFP and GPX1-taa-gfp). The gpx1 expression vector (Fig. 1 a) was constructed by inserting theXbaI/HindIII fragment of the mouse genomicgpx1 gene (2Chambers I. Frampton J. Goldfarb P. Affara N. McBain W. Harrison P.R. EMBO J. 1986; 5: 1221-1227Crossref PubMed Scopus (528) Google Scholar) at the corresponding sites in the multiple cloning region in pRc/CMV vector (Invitrogen, Carlsbad CA) as described previously (42Weiss S.L. Sunde R.A. RNA (NY). 1998; 4: 816-827Crossref PubMed Scopus (67) Google Scholar). The f-gpx1 expression construct (Fig. 1 b) was prepared by annealing complementary 27-nt oligomers (oligo-57 and -58) encoding the FLAG epitope (48Hopp T.P. Prickett K.S. Price V.L. Libby R.T. March C.J. Cerretti D.P. Urdal D.L. Conlon P.J. Bio/Technology. 1988; 6: 1204-1210Crossref Scopus (752) Google Scholar) with SacII restriction site overhangs and ligating this insert into theSacII site of mouse gpx1 in pRc/CMV vector. The construct was confirmed by restriction digestion and by DNA sequencing. The f-gpx1 was then subcloned to the pBluescript II SK(−) (Stratagene, La Jolla, CA) vector at the XbaI site in the multiple cloning region for use as a template for site-directed mutagenesis. Site-directed mutagenesis was conducted according to standard procedures (49Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1989Google Scholar) to change TGA for the native U47 to TGC for Cys. The resulting U47C containing f-gpx1 was used as a common template for changing 10 different codons into TGA by site-directed mutagenesis. These codons were TCC for Ser-7, TCC for Ser-12, TCC for Ser-18, AGC for Ser-29, TCT for Ser-45, TCC for Ser-93, TGC for Cys-154, GTT for Val-172, AGC for Ser-178, and TCC for Ser-195 as indicated in Fig. 1 d. Amino acid numbers refer to the original residue position in murine GPX1 (2Chambers I. Frampton J. Goldfarb P. Affara N. McBain W. Harrison P.R. EMBO J. 1986; 5: 1221-1227Crossref PubMed Scopus (528) Google Scholar). All mutants were confirmed by DNA sequencing at the DNA Core Facility at the University of Missouri, Columbia. In total, one wild-type f-gpx1 and 10 mutant f-gpx1 constructs were prepared. Each construct was made and tested independently at least twice. The coding region of enhanced GFP was obtained in the pEGFP-N1 vector (CLONTECH, Palo Alto, CA). To make GFP-GPX1 fusion constructs, the F-GPX1 coding region without Met-1 and the GPX1 3′-UTR (nt 41–1234) (2Chambers I. Frampton J. Goldfarb P. Affara N. McBain W. Harrison P.R. EMBO J. 1986; 5: 1221-1227Crossref PubMed Scopus (528) Google Scholar) were PCR-amplified with oligo-80 (5′ primer) and oligo-81 (3′ primer). Both primers contained BsrgI recognition sequences at the 5′ end. The amplified fragment was digested with BsrgI and inserted at the BsrgI site of GFP. Clones with GPX1 inserted in sense orientation with GFP were identified by restriction digestion analysis. The resulting GFP-GPX1 constructs had GFP coding region inserted in-frame in front of the F-GPX1 coding region (without Met-1) followed by the GPX1 3′-UTR. To make GPX1-GFP fusion constructs, the GFP coding region without Met-1 was PCR-amplified with oligo-104 (5′ primer) and oligo-105 (3′ primer). The PCR products were blunted by mung bean nuclease. The F-GPX1 constructs were digested with Bsu36I restriction enzyme, blunted with mung bean nuclease, and ligated with the GFP coding region. Clones with GFP inserted in sense orientation with GPX1 were identified by restriction digestion analysis. The resulting GPX1-GFP constructs had GFP coding region without Met-1 inserted in-frame downstream of the entire GPX1 coding region but before the UAA stop codon. The GPX1/TAA/GFP constructs were made in a similar way as GPX1-GFP except that after the F-GPX1 constructs were digested withBsu36I enzyme, the TAA overhang was filled in by Klenow fragment. The resulting GPX1/TAA/GFP fusion constructs had GFP coding region without Met-1 inserted immediately downstream from the GPX1 UAA stop codon. For these three sets of fusion constructs, at least two independently constructed fusion genes were examined. The 3′ 477-base pairApaI/EcoRI fragment of mouse genomicgpx1 was subcloned into pBluescript II SK(−) vector and then linearized with Bsu36I to make the gpx1 probe template. A 228-base pair EcoRV/PstI fragment of the neomycin resistance gene (neo) was removed from the pRc/CMV vector, subcloned into the pBluescript II SK(−) vector, and then linearized with SalI to make theneo probe template. In vitro transcription of antisense RNA probes was performed according to the manufacturer's protocol (Promega, Madison. WI) using 40 μCi of [32P]UTP (3000 Ci/mmol) (NEN Life Science Products) and 4 μl of 100 μm cold UTP per reaction. The full-length probes were purified by electrophoresis through a 6% polyacrylamide gel, eluted in 2 m ammonium acetate + 1% SDS, and ethanol-precipitated. Total RNA was isolated from Se-adequate (10−7mNa2SeO3) transiently transfected COS-7 cells 48 h after transfection as described previously (41Weiss S.L. Sunde R.A. J. Nutr. 1997; 127: 1304-1310Crossref PubMed Scopus (30) Google Scholar). Two plates of transfected cells were pooled for each sample to provide an adequate yield of RNA. RNA samples from each transfection pool (20 μg total RNA) were hybridized overnight at 45 °C with the single-stranded antisense RNA probes for mouse GPX1 mRNA and neomRNA and then treated with RNase (40 μg/ml RNase A, 2 μg/ml RNase T1) for 45 min at 30 °C. After RNase inactivation, the protected probe fragments were ethanol-precipitated, and samples were analyzed on a 5% denaturing polyacrylamide gel. Control samples containing 20 μg of yeast tRNA did not protect any detectable probe fragments from the RNase digestion. The experiments were repeated three times with RNA samples from three individual transfections for each construct. Within each sample, the protected GPX1 mRNA signal was normalized to the protected neo mRNA. Analysis of variance was used to determine that GPX1 mRNA levels were not significantly different among COS-7 cells transfected with the various F-GPX1 constructs. COS-7 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 2 mml-glutamine according to standard cell culture procedures (50William B.J. Pastan I.H. Methods Enzymol. 1979; 58: 1-642Google Scholar). For transient expression, 24 h before transfection, 1 × 106 cells were seeded in each 100-mm plate. Twenty micrograms of each plasmid DNA were transfected into cells in each plate by calcium phosphate-mediated method (51Maniatis T. Fritsch E.F. Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1982: 1-545Google Scholar). As a control for transfection efficiency, 3 μg of pSV-β-galactosidase control vector (Promega) was co-transfected for each plate. For75Se labeling, 5 μCi of 75Se as Na2SeO3 (100–400 μCi of 75Se/μg of selenium, pH 7.0, University of Missouri Research Reactor) were added to each plate 24 h after transfection. Forty-eight hours after transfection, cells were harvested and lysed in 900 μl of lysis buffer per plate (50 mm Tris, pH 8.0, 150 mmNaCl, 10 mm MgCl, 5 mm EDTA, 1% Triton X-100, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 20 μg/ml leupeptin). The lysed cell suspension was centrifuged at 14,000 × g at 4 °C for 2 min to remove cell debris, and the lysate supernatant was used for subsequent analysis. Protein concentration was quantitated by the method of Lowry et al. (52Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). β-Galactosidase activity was determined with the β-galactosidase enzyme assay system according to the manufacturer's instructions (65Promega Corp. (1993) Technical Bulletin, No. 097, Madison, WIGoogle Scholar). GPX1 activity was determined as described (53Lawrence R.A. Sunde R.A. Schwartz G.L. Hoekstra W.G. Exp. Eye Res. 1974; 18: 563-569Crossref PubMed Scopus (130) Google Scholar). Immunoprecipitation was conducted with 50 μl of anti-FLAG M2 affinity gel for each aliquot of lysate according to the manufacturer's protocol (Anti-FLAG M2 Affinity Gel, Scientific Imaging Systems, Eastman Kodak Co.). Quantitation of75Se incorporation into transfected F-GPX1 was obtained by immunoprecipitation of 200 μg of lysate protein followed by counting of the washed precipitate. Selenoproteins were separated by 10% SDS-PAGE using 0.75-mm gels (51Maniatis T. Fritsch E.F. Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1982: 1-545Google Scholar).75Se incorporation into selenoprotein bands was quantitated by autoradiography (X-Omat Blue XB-1 film, Kodak) followed by densitometric scanning (LKB 2222 UltraScan, Pharmacia LKB, Uppsala).75Se incorporation into transfected F-GPX1 or GPX1 was expressed as a percentage of total 75Se incorporated into all the selenoproteins. These values were normalized relative to co-expressed β-galactosidase activity. For each transfection experiment, the normalized value of each transfected recombinant GPX1 was expressed as a percentage of the level of expression of the wild-type GPX1 in the same transfection experiment. Each construct was examined in at least three independent transfection experiments with at least three replicates for each experiment. Analysis of variance was used to determine differences due to UGA position in mRNA levels and 75Se incorporation. Differences were considered significant at the probability level p < 0.05. To develop a model selenoprotein to study 75Se incorporation during translation, the 1497-base pair murine genomic GPX1 sequence was inserted into the pRc/CMV vector (Fig. 1 a), transiently transfected into COS-7 cells, and labeled for 24 h with 75Se. As shown in Fig. 2 a, wild-type COS-7 cells prominently label thioredoxin reductase (TR) (10Gladyshev V.N. Jeang K. Stadtman T.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6146-6151Crossref PubMed Scopus (410) Google Scholar, 11Tamura T. Stadtman T.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1006-1011Crossref PubMed Scopus (477) Google Scholar), GPX1, and the 18-kDa glutathione peroxidase-4 (GPX4) (5Sunde R.A. Dyer J.A. Moran T.V. Evenson J.K. Sugimoto M. Biochem. Biophys. Res. Commun. 1993; 193: 905-911Crossref PubMed Scopus (62) Google Scholar, 7Maiorino M. Chu F.F. Ursini F. Davies K.J. Doroshow J.H. Esworthy R.S. J. Biol. Chem. 1991; 266: 7728-7732Abstract Full Text PDF PubMed Google Scholar, 54Brigelius-Flohé R. Aumann K.D. Blocker H. Gross G. Kiess M. Kloppel K.D. Maiorino M. Roveri A. Schuckelt R. Ursini F. Wingender E. Flohé L. J. Biol. Chem. 1994; 269: 7342-7348Abstr" @default.
• W1971881511 created "2016-06-24" @default.
• W1971881511 creator A5014545839 @default.
• W1971881511 creator A5042262615 @default.
• W1971881511 creator A5090320142 @default.
• W1971881511 date "1998-10-01" @default.
• W1971881511 modified "2023-10-03" @default.
• W1971881511 title "UGA Codon Position Affects the Efficiency of Selenocysteine Incorporation into Glutathione Peroxidase-1" @default.
• W1971881511 cites W1208971950 @default.
• W1971881511 cites W1505425247 @default.
• W1971881511 cites W1506594192 @default.
• W1971881511 cites W1507184493 @default.
• W1971881511 cites W1545965226 @default.
• W1971881511 cites W1571092378 @default.
• W1971881511 cites W1604280960 @default.
• W1971881511 cites W1604789505 @default.
• W1971881511 cites W1610318839 @default.
• W1971881511 cites W1646990139 @default.
• W1971881511 cites W1775749144 @default.
• W1971881511 cites W1901479422 @default.
• W1971881511 cites W1919117533 @default.
• W1971881511 cites W1966323059 @default.
• W1971881511 cites W1969239709 @default.
• W1971881511 cites W1970057765 @default.
• W1971881511 cites W1979098238 @default.
• W1971881511 cites W1981458029 @default.
• W1971881511 cites W1987338970 @default.
• W1971881511 cites W1994014613 @default.
• W1971881511 cites W1996950251 @default.
• W1971881511 cites W1997685804 @default.
• W1971881511 cites W1999014341 @default.
• W1971881511 cites W2002209113 @default.
• W1971881511 cites W2015837249 @default.
• W1971881511 cites W2027300388 @default.
• W1971881511 cites W2033675931 @default.
• W1971881511 cites W2036760836 @default.
• W1971881511 cites W2036954969 @default.
• W1971881511 cites W2037617638 @default.
• W1971881511 cites W2045015402 @default.
• W1971881511 cites W2050760780 @default.
• W1971881511 cites W2057887750 @default.
• W1971881511 cites W2060194897 @default.
• W1971881511 cites W2066634806 @default.
• W1971881511 cites W2067864809 @default.
• W1971881511 cites W2070218110 @default.
• W1971881511 cites W2072616434 @default.
• W1971881511 cites W2074933980 @default.
• W1971881511 cites W2090180026 @default.
• W1971881511 cites W2091794936 @default.
• W1971881511 cites W2107129827 @default.
• W1971881511 cites W2122690964 @default.
• W1971881511 cites W2135057047 @default.
• W1971881511 cites W2139850491 @default.
• W1971881511 cites W2142125747 @default.
• W1971881511 cites W2146661675 @default.
• W1971881511 cites W2148207815 @default.
• W1971881511 cites W2165449806 @default.
• W1971881511 cites W2168548331 @default.
• W1971881511 cites W2173725245 @default.
• W1971881511 cites W2179025276 @default.
• W1971881511 cites W258569422 @default.
• W1971881511 cites W4251440173 @default.
• W1971881511 cites W4252371903 @default.
• W1971881511 cites W4379379423 @default.
• W1971881511 doi "https://doi.org/10.1074/jbc.273.43.28533" @default.
• W1971881511 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9774484" @default.
• W1971881511 hasPublicationYear "1998" @default.
• W1971881511 type Work @default.
• W1971881511 sameAs 1971881511 @default.
• W1971881511 citedByCount "43" @default.
• W1971881511 countsByYear W19718815112013 @default.
• W1971881511 countsByYear W19718815112014 @default.
• W1971881511 countsByYear W19718815112017 @default.
• W1971881511 countsByYear W19718815112018 @default.
• W1971881511 countsByYear W19718815112019 @default.
• W1971881511 countsByYear W19718815112021 @default.
• W1971881511 countsByYear W19718815112023 @default.
• W1971881511 crossrefType "journal-article" @default.
• W1971881511 hasAuthorship W1971881511A5014545839 @default.
• W1971881511 hasAuthorship W1971881511A5042262615 @default.
• W1971881511 hasAuthorship W1971881511A5090320142 @default.
• W1971881511 hasBestOaLocation W19718815111 @default.
• W1971881511 hasConcept C10138342 @default.
• W1971881511 hasConcept C158086472 @default.
• W1971881511 hasConcept C162008176 @default.
• W1971881511 hasConcept C162324750 @default.
• W1971881511 hasConcept C181199279 @default.
• W1971881511 hasConcept C185592680 @default.
• W1971881511 hasConcept C198082294 @default.
• W1971881511 hasConcept C203663253 @default.
• W1971881511 hasConcept C2776087148 @default.
• W1971881511 hasConcept C2778760513 @default.
• W1971881511 hasConcept C2779201268 @default.
• W1971881511 hasConcept C538909803 @default.
• W1971881511 hasConcept C55493867 @default.
• W1971881511 hasConceptScore W1971881511C10138342 @default.
• W1971881511 hasConceptScore W1971881511C158086472 @default.
• W1971881511 hasConceptScore W1971881511C162008176 @default.

• next