FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1972329523> ?p ?o ?g. }

• W1972329523 endingPage "314" @default.
• W1972329523 startingPage "306" @default.
• W1972329523 abstract "There are five Synechocystis PCC6803 genes encoding polypeptides with similarity to the Lhc polypeptides of plants. Four of the polypeptides, designated HliA–D (Dolganov, N. A. M., Bhaya, D., and Grossman, A. R. (1995)Proc. Natl. Acad. Sci. U. S. A. 92, 636–640) (corresponding to ScpC, ScpD, ScpB, and ScpE in Funk, C., and Vermaas, W. (1999) Biochemistry 38, 9397–9404) contain a single transmembrane domain. The fifth polypeptide (HemH) represents a fusion between a ferrochelatase and an Hli-like polypeptide. By using an epitope tag to identify specifically the different Hli polypeptides, the accumulation of each (excluding HemH) was examined under various environmental conditions. The levels of all of the Hli polypeptides were elevated in high light and during nitrogen limitation, whereas HliA, HliB, and HliC also accumulated to high levels following exposure to sulfur deprivation and low temperature. The temporal pattern of accumulation was significantly different among the different Hli polypeptides. HliC rapidly accumulated in high light, and its level remained high for at least 24 h. HliA and HliB also accumulated rapidly, but their levels began to decline 9–12 h following the imposition of high light. HliD was transiently expressed in high light and was not detected 24 h after the initiation of high light exposure. These results demonstrate that there is specificity to the accumulation of the Hli polypeptides under a diverse range of environmental conditions. Furthermore, mutants for the individual and combinations of the hli genes were evaluated for their fitness to grow in high light. Although all of the mutants grew as fast as wild-type cells in low light, strains inactivated for hliA or hliC/hliD were unable to compete with wild-type cells during co-cultivation in high light. A mutant lacking all four hli genes gradually lost its photosynthesis capacity and died in high light. Hence, the Hli polypeptides are critical for survival when Synechocystis PCC6803 is absorbing excess excitation energy and may allow the cells to cope more effectively with the production of reactive oxygen species. There are five Synechocystis PCC6803 genes encoding polypeptides with similarity to the Lhc polypeptides of plants. Four of the polypeptides, designated HliA–D (Dolganov, N. A. M., Bhaya, D., and Grossman, A. R. (1995)Proc. Natl. Acad. Sci. U. S. A. 92, 636–640) (corresponding to ScpC, ScpD, ScpB, and ScpE in Funk, C., and Vermaas, W. (1999) Biochemistry 38, 9397–9404) contain a single transmembrane domain. The fifth polypeptide (HemH) represents a fusion between a ferrochelatase and an Hli-like polypeptide. By using an epitope tag to identify specifically the different Hli polypeptides, the accumulation of each (excluding HemH) was examined under various environmental conditions. The levels of all of the Hli polypeptides were elevated in high light and during nitrogen limitation, whereas HliA, HliB, and HliC also accumulated to high levels following exposure to sulfur deprivation and low temperature. The temporal pattern of accumulation was significantly different among the different Hli polypeptides. HliC rapidly accumulated in high light, and its level remained high for at least 24 h. HliA and HliB also accumulated rapidly, but their levels began to decline 9–12 h following the imposition of high light. HliD was transiently expressed in high light and was not detected 24 h after the initiation of high light exposure. These results demonstrate that there is specificity to the accumulation of the Hli polypeptides under a diverse range of environmental conditions. Furthermore, mutants for the individual and combinations of the hli genes were evaluated for their fitness to grow in high light. Although all of the mutants grew as fast as wild-type cells in low light, strains inactivated for hliA or hliC/hliD were unable to compete with wild-type cells during co-cultivation in high light. A mutant lacking all four hli genes gradually lost its photosynthesis capacity and died in high light. Hence, the Hli polypeptides are critical for survival when Synechocystis PCC6803 is absorbing excess excitation energy and may allow the cells to cope more effectively with the production of reactive oxygen species. high light nonphotochemical quenching early light inducible proteins transmembrane helices low light 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid 4-morpholineethanesulfonic acid polymerase chain reaction fast protein liquid chromatography methyl viologen polyacrylamide gel electrophoresis kilobase kilobase pairs Light serves as an environmental signal that regulates physiological and developmental processes and provides energy that fuels the reduction of inorganic carbon. However, when photosynthetic organisms absorb excess excitation energy (more than can be used in photosynthesis), the light energy can cause damage to the cell (3Melis A. Trends Plant Sci. 1999; 4: 130-135Abstract Full Text Full Text PDF PubMed Scopus (582) Google Scholar, 4Niyogi K.K. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999; 50: 333-359Crossref PubMed Scopus (1619) Google Scholar). There are several ways in which excess, absorbed, light energy can be harmful to photosynthetic organisms. It can accumulate in light-harvesting antenna complexes and reaction centers and promote the formation of singlet oxygen, superoxides, and hydroxyl radicals, all of which are highly reactive and potentially toxic. Reactive oxygen species could modify proteins, lipids, and nucleic acids, ultimately causing a loss of cell viability (5Halliwell B. Gutteridge J.M.C. Free Radicals in Biology and Medicine. Oxford University Press Inc., New York1999: 1-104Google Scholar). The photosynthetic reaction center polypeptide D1, or the 32-kDa polypeptide, is particularly susceptible to damage as a consequence of absorption of excess excitation energy (3Melis A. Trends Plant Sci. 1999; 4: 130-135Abstract Full Text Full Text PDF PubMed Scopus (582) Google Scholar, 6Andersson B. Salter A.H. Virgin I. Vass I. Syring S. J. Photochem. Photobiol. B Biol. 1992; 15: 15-31Crossref Scopus (83) Google Scholar, 7Aro E.M. McCaffery S. Anderson J.M. Plant Physiol. 1993; 103: 835-843Crossref PubMed Scopus (260) Google Scholar, 8Ohad I. Kyle D.J. Arntzen C.J. J. Cell Biol. 1984; 99: 481-485Crossref PubMed Scopus (371) Google Scholar); this was first recognized by Kyle et al. (9Kyle D.J. Ohad I. Arntzen C.J. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 4070-4074Crossref PubMed Google Scholar). The 32-kDa polypeptide, together with the D2 polypeptide, forms the heterodimeric reaction center of photosystem II that binds all of the redox components involved in photosynthetic charge separation. The rapid restoration of photosystem II function following photodamage indicates the existence of a tightly regulated repair system (3Melis A. Trends Plant Sci. 1999; 4: 130-135Abstract Full Text Full Text PDF PubMed Scopus (582) Google Scholar). Repair processes include the degradation of damaged D1 polypeptide, de novo synthesis of D1 on chloroplast ribosomes, processing of newly synthesized D1, association of D1 with chlorophyll and its reaction center partner (D2), and assembly of the heterodimeric complex with other photosystem II polypeptides (3Melis A. Trends Plant Sci. 1999; 4: 130-135Abstract Full Text Full Text PDF PubMed Scopus (582) Google Scholar, 7Aro E.M. McCaffery S. Anderson J.M. Plant Physiol. 1993; 103: 835-843Crossref PubMed Scopus (260) Google Scholar, 10Critchley C. Russell A.W. Physiol. Plant. 1994; 92: 188-196Crossref Scopus (120) Google Scholar). Both algae and vascular plants have evolved mechanisms for photo-acclimation that favor survival in high light (HL)1 (4Niyogi K.K. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999; 50: 333-359Crossref PubMed Scopus (1619) Google Scholar, 11Durnford D.G. Falkowski P.G. Photosynth. Res. 1997; 53: 229-241Crossref Google Scholar). These mechanisms involve changes in the composition of light-harvesting and/or reaction center pigment-protein complexes (reviewed in Ref. 12Demmig-Adams B. Adams W.W. Annu. Rev. Plant Physiol. 1992; 43: 599-626Crossref Scopus (2081) Google Scholar), redistribution of excitation energy between the photosystems (state transitions) (13Biggins J. Bruce D. Photosynth. Res. 1989; 20: 1-34Crossref PubMed Scopus (123) Google Scholar, 14Fujita Y. Photosynth. Res. 1997; 53: 83-93Crossref Google Scholar), and stabilization of photosynthetic membranes (15Havaux M. Niyogi K.K. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8762-8767Crossref PubMed Scopus (568) Google Scholar). Plants have also developed the capacity to efficiently transform excess absorbed light energy into heat, thereby dissipating the energy in a harmless manner. This thermal dissipation is measured as quenching of chlorophyll fluorescence or nonphotochemical quenching (NPQ) (4Niyogi K.K. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999; 50: 333-359Crossref PubMed Scopus (1619) Google Scholar, 16Gilmore A.M. Physiol. Plant. 1997; 99: 197-209Crossref Google Scholar,17Horton P. Ruban A.V. Walters R.G. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1996; 47: 655-684Crossref PubMed Scopus (1421) Google Scholar). NPQ is primarily a consequence of the operation of the xanthophyll cycle, which is required for the generation of zeaxanthin in HL (4Niyogi K.K. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999; 50: 333-359Crossref PubMed Scopus (1619) Google Scholar,18Bartley G.E. Scolnik P.A. Plant Cell. 1995; 7: 1027-1038Crossref PubMed Scopus (492) Google Scholar, 19Demmig-Adams B. Adams W.W. Trends Biochem. Sci. 1996; 1: 21-26Abstract Full Text PDF Scopus (1368) Google Scholar, 20Ruban A.V. Horton P. Plant Physiol. 1995; 108: 721-726Crossref PubMed Scopus (80) Google Scholar). The PsbS polypeptide, which has four membrane-spanning helices and shows homology to Lhc polypeptides, is also needed for NPQ (21Li X.P. Bjorkman O. Shih C. Grossman A.R. Rosenquist M. Jansson S. Niyogi K.K. Nature. 2000; 403: 391-395Crossref PubMed Scopus (1177) Google Scholar). It has been postulated that quenching of singlet excited chlorophyll occurs by direct energy transfer to zeaxanthin (22Frank H.A. Cua A. Chynwat V. Young A. Gosztola D. Wasielewski M.R. Photosynth. Res. 1994; 41: 389-395Crossref PubMed Scopus (334) Google Scholar). However, recent evidence (23Frank H.A. Bautista J.A. Josue J.S. Young A.J. Biochemistry. 2000; 39: 2831-2837Crossref PubMed Scopus (158) Google Scholar, 24Polivka T. Herek J.L. Zigmantas D. Akerlund H.E. Sundstrom V. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 4914-4917Crossref PubMed Scopus (198) Google Scholar) suggests that xanthophyll-dependent quenching is more likely the result of conformational changes within the antennae complex (17Horton P. Ruban A.V. Walters R.G. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1996; 47: 655-684Crossref PubMed Scopus (1421) Google Scholar, 25Crofts J. Horton P. Biochim. Biophys. Acta. 1991; 1058: 187-193Crossref Scopus (39) Google Scholar, 26Ruban A.V. Horton P. Young A.J. J. Photochem. Photobiol. B Biol. 1993; 21: 229-234Crossref Scopus (125) Google Scholar, 27Ruban A.B. Young A. Horton P. Biochim. Biophys. Acta. 1994; 1186: 123-127Crossref Scopus (113) Google Scholar, 28Ruban A.V. Horton P. Plant Physiol. 1999; 119: 531-542Crossref PubMed Scopus (145) Google Scholar). Energy dissipation within the reaction center itself (29De Las Rivas J. Telfer A. Barber J. Biochim. Biophys. Acta. 1993; 1142: 155-164Crossref Scopus (97) Google Scholar, 30Schweitzer R.H. Brudvig G.W. Biochemistry. 1997; 36: 11351-11359Crossref PubMed Scopus (57) Google Scholar) and cyclic electron flow around photosystem II that involves a low potential form of cytochrome b559 (31Allakhverdiev S.I. Klimov V.V. Carpentier R. Biochemistry. 1997; 36: 4149-4154Crossref PubMed Scopus (63) Google Scholar) may also contribute to photoprotection. Finally, reaction centers that are rendered nonfunctional via the absorption of excess excitation energy may continue to dissipate absorbed light energy as heat and serve a photoprotective role with respect to neighboring, functional photosystem II reaction centers (32Öquist G. Chow W.S. Anderson J.M. J. Biol. Chem. 1992; 267: 16745-16754Google Scholar). Other acclimation responses include the synthesis and recruitment of enzymes with antioxidant function such as superoxide dismutase (33Bowler C. Van Camp W. Van Montagu M. Inze D. Crit. Rev. Plant Sci. 1994; 13: 199-218Crossref Scopus (473) Google Scholar), catalase (34Hertig B. Streb P. Feierabend J. Plant Physiol. 1992; 100: 1547-1553Crossref PubMed Scopus (193) Google Scholar, 35Holtman W.L. deGraaff A.M. Lea P.J. Kijne J.W. J. Exp. Bot. 1998; 49: 1303-1306Crossref Scopus (5) Google Scholar, 36Hwang S.Y. Lin H.W. Chern R.H. Lo H.F. Li L. Plant Growth Regul. 1999; 27: 167-172Crossref Scopus (82) Google Scholar), and ascorbate peroxidase (37Asada K. Physiol. Plant. 1992; 85: 235-241Crossref Scopus (1260) Google Scholar, 38Asada K. Photosynth. Res. 1992; 34: 105Google Scholar). Additionally, abundant soluble antioxidants in the chloroplast such as ascorbate and glutathione can act as quenchers of triplet chlorophyll and singlet oxygen (39Foyer C.H. Descourvieres P. Kunert K.J. Plant Cell Environ. 1994; 17: 507-523Crossref Scopus (1085) Google Scholar). One group of proteins that accumulates upon exposure of plants to HL is the ELIPs, or early light-inducibleproteins. These were originally characterized as polypeptides that transiently accumulated in etiolated seedlings of pea and barley following HL treatment (40Adamska I. Kloppstech K. Ohad I. J. Biol. Chem. 1992; 267: 24732-24737Abstract Full Text PDF PubMed Google Scholar, 41Adamska I. Ohad I. Kloppstech K. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 2610-2613Crossref PubMed Scopus (127) Google Scholar, 42Green B.R. Pichersky E. Kloppstech K. Trends Biochem. Sci. 1991; 16: 81-186Abstract Full Text PDF PubMed Scopus (234) Google Scholar, 43Kolanus W. Scharnhorst C. Kuhne U. Herzfeld F. Mol. Gen. Genet. 1987; 209: 234-239Crossref PubMed Scopus (38) Google Scholar, 44Potter E. Kloppstech K. Eur. J. Biochem. 1993; 214: 779-786Crossref PubMed Scopus (89) Google Scholar). This transient accumulation also occurred when plants were exposed to blue light, suggesting a role for the blue light photoreceptor in the induction process (45von Lintig J. Welsch R. Bonk M. Giuliano G. Batschauer A. Kleinig H. Plant J. 1997; 12: 625-634Crossref PubMed Scopus (202) Google Scholar); other studies suggest that phytochrome may be involved in ELIPexpression (46Adamska I. Plant Physiol. 1995; 107: 1167-1175Crossref PubMed Scopus (40) Google Scholar). In addition, ELIPs accumulate transiently under a variety of stress conditions (47Adamska I. Physiol. Plant. 1997; 100: 794-805Crossref Google Scholar, 48Montane M.H. Dreyer S. Triantaphylides C. Kloppstech K. Planta. 1997; 202: 293-302Crossref Scopus (73) Google Scholar, 49Montane M.H. Petzold B. Kloppstech K. Planta. 1999; 208: 519-527Crossref Scopus (33) Google Scholar, 50Neale A.D. Blomstedt C.K. Bronson P. Le T.N. Guthridge K. Evans J. Gaff D.F. Hamill J.D. Plant Cell Environ. 2000; 23: 265-277Crossref Scopus (82) Google Scholar) that would cause photoinhibition. This raises the possibility that the ELIPs function to protect plants from photooxidative damage and that expression of ELIP genes may be controlled by the redox state of the cell and/or the accumulation of reactive oxygen species. ELIP genes from a number of different organisms have been cloned and sequenced (43Kolanus W. Scharnhorst C. Kuhne U. Herzfeld F. Mol. Gen. Genet. 1987; 209: 234-239Crossref PubMed Scopus (38) Google Scholar, 51Grimm B. Kloppstech K. Eur. J. Cell Biol. 1987; 43: 21Google Scholar, 52Yamagata H. Bowler C. Biosci. Biotechnol. Biochem. 1997; 61: 2143-2144Crossref PubMed Scopus (4) Google Scholar, 53Kloppstech K. Physiol. Plant. 1997; 100: 739-747Crossref Google Scholar). Sequence comparisons have revealed that they are members of the chlorophyll a/b-binding protein or Lhc superfamily of proteins (54Kruse E. Grimm B. Kloppstech K. Biol. Chem. Hoppe-Seyler. 1989; 370: 925Google Scholar). The ELIPs have three transmembrane helices (TMH I–III) that correspond to the TMHs of the Lhc polypeptides (55Green B.R. Kuhlbrandt W. Photosynth. Res. 1995; 44: 39-148Crossref Scopus (112) Google Scholar). Although pigment binding by ELIPs has not been directly demonstrated, all ELIPs contain conserved residues that could potentially bind chlorophyll a (55Green B.R. Kuhlbrandt W. Photosynth. Res. 1995; 44: 39-148Crossref Scopus (112) Google Scholar). Even though it has been suggested that the ELIPs function as “pigment-carrier” proteins involved in the turnover and/or redistribution of pigment molecules under conditions when photosystem II components are being rapidly degraded and repaired (47Adamska I. Physiol. Plant. 1997; 100: 794-805Crossref Google Scholar), the exact role of ELIPs under light stress conditions is not clear. Recently, the Cbr protein of Dunaliella was shown to be associated with light-harvesting antenna complexes II and preferentially associated with specific pigment-protein subcomplexes that contain high levels of lutein and other xanthophylls (56Banet G. Pick U. Zamir A. Planta. 2000; 210: 947-955Crossref PubMed Scopus (21) Google Scholar). Members of the Lhc gene family have also been identified that encode proteins with one and two TMHs. In Arabidopsis, two ELIP-like genes that encode thylakoid membrane polypeptides with two TMHs (the proteins are called Seps, stressenhanced proteins) were isolated (57Heddad M. Adamska I. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 3741-3746Crossref PubMed Scopus (130) Google Scholar). Expression of Sep genes increased in HL but not during other stress conditions. An ELIP-like protein with a single TMH has also been isolated from Arabidopsis (58Jansson S. Andersson J. Jung-Kim S. Jackowski G. Plant Mol. Biol. 2000; 42: 345-351Crossref PubMed Scopus (82) Google Scholar). These single TMH polypeptides, designated Hli or Scp (1Dolganov N.A.M. Bhaya D. Grossman A.R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 636-640Crossref PubMed Scopus (156) Google Scholar, 2Funk C. Vermaas W. Biochemistry. 1999; 38: 9397-9404Crossref PubMed Scopus (124) Google Scholar), were first discovered in cyanobacteria. The single TMH in these polypeptides resembles TMH I or III of the Lhc polypeptides. Expression of the genes is strikingly similar to that of ELIP genes, suggesting that they have similar functions. There are five monocistronic hli genes on the Synechocystis PCC6803 genome (59Kaneko T. Tabata S. Plant Cell Physiol. 1997; 38: 1171-1176Crossref PubMed Scopus (149) Google Scholar, 60Kaneko T. Sato S. Kotani H. Tanaka A. Asamizu E. Nakamura Y. Miyajima M. Hirosawa M. Sugiura M. Sasamoto S. Kimura T. Hosouchi T. Matsuno A. Muraki A. Nakazaki N. Naruo K. Okumura S. Shimpo S. Takeuchi C. Wada T. Watanabe A. Yamada M. Yasuda M. Tabata S. DNA Res. 1996; 3: 109-136Crossref PubMed Scopus (2133) Google Scholar) that compose an hli multigene family (Ref. 2Funk C. Vermaas W. Biochemistry. 1999; 38: 9397-9404Crossref PubMed Scopus (124) Google Scholar, CyanoBase); one of these represents a fusion with the ferrochelatase gene. We have examined accumulation of the four Hli proteins (the ferrochelatase was excluded) of Synechocystis PCC6803 under several conditions that would result in the absorption of excess excitation energy by the photosynthetic apparatus, and we have investigated the phenotypes of hli deletion mutants. Our results indicate that Hli polypeptides accumulate when cyanobacteria are exposed to HL or other stress conditions and that they may form distinct protein complexes in the thylakoid membranes. Furthermore, mutants that cannot synthesize Hli polypeptides show growth characteristics similar to that of wild-type cells in low light (LL) but are unable to compete with wild-type cells during exposure to HL. A strain deleted for all four of the hli genes gradually loses photosynthetic function and dies following exposure to HL. Synechocystis PCC6803 was cultivated in BG-11 medium (61Rippka R. Deruelles J. Waterbury J.B. Herdman M. Stanier R.Y. J. Gen. Microbiol. 1979; 111: 1-61Crossref Google Scholar) buffered with 10 mm TES, pH 8.2, at 30 °C. Cultures were bubbled with 3% CO2 in air and illuminated with 40 μmol photon m−2s−1 from incandescent bulbs. BG-11 medium lacking nitrogen (−N) or sulfur (−S) was prepared by replacing the NaNO3 for −N medium and MgSO4, ZnSO4, and CuSO4 for −S medium with equimolar amounts of the corresponding chloride salts (NaCl, MgCl2, ZnCl2, and CuCl2, respectively). For nutrient starvation experiments, cells grown in BG-11 medium were pelleted by centrifugation (5,000 × g, 5 min) and re-suspended in −N or −S medium. This step was repeated prior to allowing cells to grow in −N or −S medium. Procedures for initiating nutrient deprivation have been described previously (62Collier J.L. Grossman A.R. J. Bacteriol. 1992; 174: 4718-4726Crossref PubMed Scopus (235) Google Scholar). For HL treatments, cells in mid-logarithmic growth phase (OD730 ∼0.8) were diluted with fresh medium to an OD730 of ∼0.3. The cells (in 50-ml culture tubes) were then placed in a temperature-controlled glass chamber (maintained at 30 °C) and exposed to 500 μmol photon m−2s−1 white light for various lengths of time, as indicated in the text. For cold treatment, cultures were diluted with BG-11 medium chilled to 4 °C and then allowed to incubate at 4 °C with constant shaking for 6 h. To construct cell lines in which each of the Hli polypeptides was tagged with the His6epitope, coding regions of individual hli genes were cloned in frame into the pQE expression vectors (Qiagen) (pQE-60 for ssl1633 (hliC); pQE-70 for ssr2595 (hliB), ssr1789 (hliD), ssl2542 (hliA)). Each hlipromoter plus coding region (with the C-terminal His6 tag) was ligated sequentially to the 5 S t1t2prokaryotic terminator, a drug-resistant cartridge, and the DNA sequences downstream of each of the corresponding hli genes. Fig. 1 shows a linear drawing of each plasmid containing an epitope-tagged chimeric hli gene, and the legend of the figure provides the sequences of the primers that were used to make the constructs. Each of the chimeric genes was sequenced to ensure that no errors were generated during gene construction. The constructs were transformed into Synechocystis PCC6803; the wild-type hli sequence was replaced by the chimeric hli-His6sequence. Plasmids containing the hliA and hliB genes interrupted by erythromycin and spectinomycin resistance cassettes, respectively, were gifts from Wim Vermaas (Arizona State University). The hliA gene was interrupted at a SalI site located 72 base pairs downstream of the translation start site. The hliB gene was interrupted at a SacII site located 12 base pairs downstream of its translation start site. These constructs were generated by Funk and Vermaas 2C. Funk and W. Vermaas, unpublished data. and generously given to us. The gene disruptions were confirmed by PCR. 3Q. He, N. Dolganov, O. Björkman, and A. R. Grossman, unpublished data. The plasmids in which hliC and hliD were deleted (ΔhliC and ΔhliD) were generated by ligating a PCR fragment upstream of each gene (0.3 kb for hliC; 0.4 kb for hliD), a drug-resistant cartridge (kanamycin for hliC; chloramphenicol for hliD), and a PCR fragment generated to sequences downstream of each gene (0.4 kb for hliC; 0.5 kb for hliD), all in the proper orientation. Primers used for PCR amplifications, given in the legend of Fig. 1, incorporated different restriction endonuclease sites to facilitate cloning. A detailed representation of the constructs is depicted in Fig. 1. The plasmids containing the interruptions/deletions were transformed into Synechocystis PCC6803, and transformants were selected on appropriate antibiotics. Single, double, and quadruple mutants (all of the hli genes were either disrupted or deleted) were constructed. Transformants were continuously subcultured until each mutant line contained homoplasmic interruptions of hligenes. Segregation of the altered gene(s) in each of the mutants was monitored by PCR of isolated genomic DNA using specific primers as follows: hliA, GATGGCTTGGGGAGCTTTAC at position 701,108–701,127 and GTGTTACAATAGTTAACATAG at position 701,375–701,395; hliB, CTCTTTTGGTCAACAGACTTGAC at position 982,862–982,884 and GCCCTGGTTCAGTAGATTGCTTG at position 983,198–983,220; hliC, ACTACAGGTACCCCAGGCCAG at position 1,141,750–1,141,770 and TGAAACCTGATGAATGACGACG at position 1,142,194–1,142,215; hliD, TTGGTGTGGCAATGGCTGGATG at position 398,000–398,021 and ATTGTACGCAAGCAGCAATAAGC at position 398,369–398,391. Preparation of Synechocystis PCC6803 genomic DNA was as described previously (63He Q.F. Vermaas W. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5830-5835Crossref PubMed Scopus (68) Google Scholar). Cyanobacterial cell pellets derived from cells grown to mid-logarithmic phase were resuspended in thylakoid buffer (1/100 of the original culture volume) which contained 20 mm MES/NaOH, pH 6.4, 5 mmMgCl2, 5 mm CaCl2, 20% glycerol (v/v), 1 mm freshly made phenylmethylsulfonyl fluoride, and 5 mm benzamidine HCl. The cell suspensions (0.4–0.6 ml) were transferred to a chilled microcentrifuge tube with approximately 0.5 ml of glass beads pre-wetted by thylakoid buffer and broken in a MiniBeadBeater by six breakage cycles at full speed (30 s for each cycle, followed by 3–5 min of chilling in ice water). After centrifugation at 1,600 × g for 10 min to remove unbroken cells and cellular debris, the supernatant was diluted 30–50-fold in thylakoid buffer, and thylakoid and cytoplasmic membranes were pelleted at 4 °C by centrifugation (20 min, 40,000 rpm in a Ti 50.2 rotor). The membranes were washed once and resuspended in thylakoid buffer (1 ml of buffer to 200 ml of the original culture volume). Sucrose density gradient centrifugation (64Wolfe G.R. Cunningham F.X. Grabowski B. Gantt E. Biochim. Biophys. Acta. 1994; 1188: 357-366Crossref Scopus (39) Google Scholar) was used to purify thylakoid membranes. Purified membranes were resuspended in 0.1m sodium phosphate buffer, pH 7.5, containing 0.3m sodium chloride. Solubilization of thylakoid membranes and SDS-PAGE were performed as described by Peter and Thornber (65Peter G.F. Thornber J.P. J. Biol. Chem. 1991; 266: 16745-16754Abstract Full Text PDF PubMed Google Scholar). Approximately 30 μg/lane membrane proteins were resolved by SDS-PAGE in a 10–16% polyacrylamide gel. Polypeptides were transferred onto nitrocellulose membranes (66Towbin H. Staehelin T. Gordon J. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 4350-4354Crossref PubMed Scopus (44939) Google Scholar), and immunodetection of polypeptides containing the His6 epitope tag was performed using commercial antibodies, as recommended by the suppliers of the antibodies (Santa Cruz Biotechnology; Qiagen). Concentrations of soluble polypeptides and thylakoid membrane polypeptides solubilized by incubation in 2% SDS at 37 °C for 15 min were determined. Protein extracts were centrifuged at 16,000 × g for 2 min to remove insoluble debris; the supernatants were diluted 10-fold with water, and the protein content was measured using BCA protein assay reagents (Pierce) according to the manufacturer's instructions. A thylakoid membrane suspension at a concentration of 0.6 mg of chlorophyll/ml was solubilized with a surfactant mixture composed of 0.6% octyl glucoside and 0.6% decyl maltoside, at 4 °C for 30 min. The material that remained insoluble was removed by centrifugation at 26,000 rpm (Beckman TL 100 rotor, ∼30,000 × g) for 20 min at 4 °C. The supernatant (100 μl) was loaded onto a Superose column (type 6 HR 10/30, Amersham Pharmacia Biotech) that was connected to an FPLC system (Millipore Waters, model 650E). The column was pre-equilibrated with elution buffer (0.1 m sodium phosphate, pH 7.5, 0.3 msodium chloride, 0.1% octyl glucoside, 0.1% decyl maltoside) and eluted with the same buffer at a flow rate of 0.4 ml/min. Fractions (0.4 ml) were collected, and the polypeptides in the fractions were concentrated by precipitation by making the samples 10% trichloroacetic acid. Growth of the cultures was monitored as a change in optical density at 730 nm. Competition experiments were performed at 30 °C under LL (40 μmol photon m−2 s−1) or HL (500 μmol photon m−2s−1). Wild-type SynechocystisPCC6803 cells and mutant strains were mixed at approximately equal densities (OD730 ∼0.6) and diluted to an OD730 of approximately 0.05. An aliquot (5 μl) of the culture was diluted in 0.5 ml, and 50 μl (about 400 cells) was spread onto each BG-11 agar plate, both with and without antibiotics, to determine the initial proportion of wild-type and mutant cells. The mixed cultures were diluted ∼10-fold with fresh medium containing appropriate antibiotics when the OD730 of the culture approached 0.8. Aliquots from the culture were sampled at various times following the initiation of the experiment and diluted, and approximately 400 cells were spread on each plate either containing or lacking the appropriate antibiotic. The yield of chlorophyll fluorescence was continuously monitored using a pulse-amplitude-modulation chlorophyll fluorometer (Walz) with a pulse-amplitude-modulation 103 accessory, a water-jacketed cuvette, and a Schott KL 1500 lamp, which provided the actinic light. The cells were diluted to a chlorophyll concentration of 2 μg ml−1 prior to analysis. The minimal fluorescence level (F0) was monitored with red-modulated light (1.6 kHz) at 0.030 μmol photon m−2 s−1. The maximum fluorescence level of dark adapted (Fm) or light-adapted (Fm ′) cells was assessed by a 600 ms high intensity white pulse at 3400 μmol photon m−2 s−1. This light pulse transiently closes all of the photosystem II reaction centers (67El Bissati K. Delphin E. Murat" @default.
• W1972329523 created "2016-06-24" @default.
• W1972329523 creator A5003629735 @default.
• W1972329523 creator A5007996521 @default.
• W1972329523 creator A5037438141 @default.
• W1972329523 creator A5054625957 @default.
• W1972329523 date "2001-01-01" @default.
• W1972329523 modified "2023-10-16" @default.
• W1972329523 title "The High Light-inducible Polypeptides in Synechocystis PCC6803" @default.
• W1972329523 cites W118039522 @default.
• W1972329523 cites W1511806377 @default.
• W1972329523 cites W1521615423 @default.
• W1972329523 cites W1546735466 @default.
• W1972329523 cites W1566566328 @default.
• W1972329523 cites W1600738747 @default.
• W1972329523 cites W1601113496 @default.
• W1972329523 cites W1968654522 @default.
• W1972329523 cites W1970006933 @default.
• W1972329523 cites W1970513328 @default.
• W1972329523 cites W1977136027 @default.
• W1972329523 cites W1984368848 @default.
• W1972329523 cites W1988139674 @default.
• W1972329523 cites W2000765714 @default.
• W1972329523 cites W2003616946 @default.
• W1972329523 cites W2011793601 @default.
• W1972329523 cites W2014204017 @default.
• W1972329523 cites W2018698734 @default.
• W1972329523 cites W2022134934 @default.
• W1972329523 cites W2026771608 @default.
• W1972329523 cites W2030274299 @default.
• W1972329523 cites W2030756294 @default.
• W1972329523 cites W2031796423 @default.
• W1972329523 cites W2032010803 @default.
• W1972329523 cites W2034493707 @default.
• W1972329523 cites W2037060582 @default.
• W1972329523 cites W2040547149 @default.
• W1972329523 cites W2041010281 @default.
• W1972329523 cites W2043641785 @default.
• W1972329523 cites W2044135848 @default.
• W1972329523 cites W2045114441 @default.
• W1972329523 cites W2049156976 @default.
• W1972329523 cites W2053910388 @default.
• W1972329523 cites W2056247311 @default.
• W1972329523 cites W2056285407 @default.
• W1972329523 cites W2056417779 @default.
• W1972329523 cites W2056650938 @default.
• W1972329523 cites W2060308263 @default.
• W1972329523 cites W2062266446 @default.
• W1972329523 cites W2062946194 @default.
• W1972329523 cites W2063137066 @default.
• W1972329523 cites W2064507577 @default.
• W1972329523 cites W2071007378 @default.
• W1972329523 cites W2075361492 @default.
• W1972329523 cites W2079976147 @default.
• W1972329523 cites W2081464599 @default.
• W1972329523 cites W2087070741 @default.
• W1972329523 cites W2090209129 @default.
• W1972329523 cites W2093411211 @default.
• W1972329523 cites W2093861840 @default.
• W1972329523 cites W2098529460 @default.
• W1972329523 cites W2100488588 @default.
• W1972329523 cites W2101108802 @default.
• W1972329523 cites W2101651903 @default.
• W1972329523 cites W2104237015 @default.
• W1972329523 cites W2104805237 @default.
• W1972329523 cites W2112264730 @default.
• W1972329523 cites W2145927163 @default.
• W1972329523 cites W2147766323 @default.
• W1972329523 cites W2147824138 @default.
• W1972329523 cites W2148658874 @default.
• W1972329523 cites W2151346096 @default.
• W1972329523 cites W2152295451 @default.
• W1972329523 cites W2155025987 @default.
• W1972329523 cites W2155436298 @default.
• W1972329523 cites W2156312783 @default.
• W1972329523 cites W2166785267 @default.
• W1972329523 cites W2172272955 @default.
• W1972329523 cites W325258877 @default.
• W1972329523 cites W4233143649 @default.
• W1972329523 cites W4234242724 @default.
• W1972329523 cites W4295127969 @default.
• W1972329523 cites W4376596095 @default.
• W1972329523 doi "https://doi.org/10.1074/jbc.m008686200" @default.
• W1972329523 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11024039" @default.
• W1972329523 hasPublicationYear "2001" @default.
• W1972329523 type Work @default.
• W1972329523 sameAs 1972329523 @default.
• W1972329523 citedByCount "210" @default.
• W1972329523 countsByYear W19723295232012 @default.
• W1972329523 countsByYear W19723295232013 @default.
• W1972329523 countsByYear W19723295232014 @default.
• W1972329523 countsByYear W19723295232015 @default.
• W1972329523 countsByYear W19723295232016 @default.
• W1972329523 countsByYear W19723295232017 @default.
• W1972329523 countsByYear W19723295232018 @default.
• W1972329523 countsByYear W19723295232019 @default.
• W1972329523 countsByYear W19723295232020 @default.
• W1972329523 countsByYear W19723295232021 @default.

• next