FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1972475548> ?p ?o ?g. }

• W1972475548 endingPage "2200" @default.
• W1972475548 startingPage "2193" @default.
• W1972475548 abstract "α1-Syntrophin is a member of the family of dystrophin-associated proteins and is strongly expressed in the sarcolemma and the neuromuscular junctions. All three syntrophin isoforms have a PDZ domain that appears to participate in protein-protein interactions at the plasma membrane. α1-Syntrophin has additionally been shown to associate with neuronal nitric-oxide synthase (nNOS) through PDZ domains in vitro. These observations suggest that α1-syntrophin may work as a modular adaptor protein that can link nNOS or other signaling enzyme to the sarcolemmal dystrophin complex. In the sarcolemma, nNOS regulates the homeostasis of reactive free radical species and may contribute to the oxidative damage to muscle protein in muscle disease such as Duchenne muscular dystrophy. In this study, we generated α1-syntrophin knock-out mice to clarify the interaction between α1-syntrophin and nNOS in the skeletal muscle. We observed that nNOS, normally expressed in the sarcolemma, was largely absent from the sarcolemma, but considerably remained in the cytosol of the knock-out mice. Even though the distribution of nNOS was altered, the knock-out mice displayed no gross histological changes in the skeletal muscle. We also discovered that muscle contractile properties have not been influenced in the knock-out mice. α1-Syntrophin is a member of the family of dystrophin-associated proteins and is strongly expressed in the sarcolemma and the neuromuscular junctions. All three syntrophin isoforms have a PDZ domain that appears to participate in protein-protein interactions at the plasma membrane. α1-Syntrophin has additionally been shown to associate with neuronal nitric-oxide synthase (nNOS) through PDZ domains in vitro. These observations suggest that α1-syntrophin may work as a modular adaptor protein that can link nNOS or other signaling enzyme to the sarcolemmal dystrophin complex. In the sarcolemma, nNOS regulates the homeostasis of reactive free radical species and may contribute to the oxidative damage to muscle protein in muscle disease such as Duchenne muscular dystrophy. In this study, we generated α1-syntrophin knock-out mice to clarify the interaction between α1-syntrophin and nNOS in the skeletal muscle. We observed that nNOS, normally expressed in the sarcolemma, was largely absent from the sarcolemma, but considerably remained in the cytosol of the knock-out mice. Even though the distribution of nNOS was altered, the knock-out mice displayed no gross histological changes in the skeletal muscle. We also discovered that muscle contractile properties have not been influenced in the knock-out mice. Duchenne muscular dystrophy nitric-oxide synthase neuronal NOS embryonic stem nicotinamide adenin dinucleotide phosphate-diaphorace 7-nitroindazole nitrol-arginine methyl ester sodium nitroprusside reverse transcriptase polymerase chain reaction kilobase pair(s). Syntrophins are intracellular peripheral membrane proteins weighing 58 kDa, originally identified in the postsynaptic membrane ofTorpedo (1Froehner S.C. Adams M.E. Peters M.F. Gee S.G. J. Cell Biol. 1987; 104: 1633-1646Crossref PubMed Scopus (121) Google Scholar). In mammalian skeletal muscle, syntrophins co-purify with dystrophin, the protein products of the Duchenne muscular dystrophy (DMD)1gene (2Butler M.H. Douville K. Murnane A.A. Kramarcy N.R. Cohen J.B. Sealock R. Froehner S.C. J. Biol. Chem. 1992; 267: 6213-6218Abstract Full Text PDF PubMed Google Scholar, 3Cartaud A. Stetzkowski-Marden F. Cartaud J. J. Biol. Chem. 1993; 268: 13019-13022Abstract Full Text PDF PubMed Google Scholar), and complex with several other dystrophin-associated proteins. The dystrophin complex appears to link the cytoskeleton to the extracellular matrix in skeletal muscle and stabilize the sarcolemma (4Campbell K.P. Kahl S.D. Nature. 1989; 338: 259-262Crossref PubMed Scopus (611) Google Scholar, 5Yoshida M. Ozawa E. J. Biochem. (Tokyo). 1990; 108: 748-752Crossref PubMed Scopus (451) Google Scholar, 6Ahn A.H. Kunkel L.M. Nat. Genet. 1993; 3: 283-291Crossref PubMed Scopus (577) Google Scholar). In human and mouse, three highly conserved but distinct syntrophin isoforms, α1-, β1-, and β2-syntrophin, are encoded by different genes (7Adams M.E. Dwyer T.M. Dowler L.L. White R.A. Froehner S.C. J. Biol. Chem. 1995; 270: 25859-25865Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 8Ahn A.H. Feener C.A. Gussoni E. Yoshida M. Ozawa E. Kunkel L.M. J. Biol. Chem. 1996; 271: 2724-2730Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar, 9Peters M.F. Adams M.E. Froehner S.C. J. Cell Biol. 1997; 138: 81-93Crossref PubMed Scopus (211) Google Scholar). The β1- and β2-syntrophin transcripts are expressed in wide variety of tissues, whereas α1-syntrophin transcript is predominantly expressed in skeletal and cardiac muscle (7Adams M.E. Dwyer T.M. Dowler L.L. White R.A. Froehner S.C. J. Biol. Chem. 1995; 270: 25859-25865Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 8Ahn A.H. Feener C.A. Gussoni E. Yoshida M. Ozawa E. Kunkel L.M. J. Biol. Chem. 1996; 271: 2724-2730Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar). An immunohistochemical study using specific antibodies revealed that three syntrophins are concentrated at the neuromuscular junction, but α1-syntrophin is also present at the extrasynaptic sarcolemma (9Peters M.F. Adams M.E. Froehner S.C. J. Cell Biol. 1997; 138: 81-93Crossref PubMed Scopus (211) Google Scholar,10Peters M.F. Kramarcy N.R. Sealock R. Froehner S.C. Neuroreport. 1994; 5: 1577-1580Crossref PubMed Scopus (123) Google Scholar). The expression of β1-syntrophin at the sarcolemma, however, is reported to be restricted to fast twitch muscle fibers (9Peters M.F. Adams M.E. Froehner S.C. J. Cell Biol. 1997; 138: 81-93Crossref PubMed Scopus (211) Google Scholar). All three syntrophins have four protein domains (7Adams M.E. Dwyer T.M. Dowler L.L. White R.A. Froehner S.C. J. Biol. Chem. 1995; 270: 25859-25865Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar); two pleckstrin homology domains, a PDZ domain, and a carboxyl-terminal syntrophin unique domain. Pleckstrin homology domain is a small domain containing less than 100 residues and originally identified as an internally duplicated motif in pleckstrin (11Gibson T.J. Hyvonen M. Musacchio A. Saraste M. Birney E. Trends. Biochem. Sci. 1994; 19: 349-353Abstract Full Text PDF PubMed Scopus (295) Google Scholar). It was also revealed in a number of intracellular signaling and membrane-associated cytoskeletal proteins. The 57 carboxyl-terminal amino acids of three isoforms, the syntrophin unique domain (7Adams M.E. Dwyer T.M. Dowler L.L. White R.A. Froehner S.C. J. Biol. Chem. 1995; 270: 25859-25865Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar), are highly conserved and may serve in a specific interaction with dystrophin and its relatives, dystrobrevin (8Ahn A.H. Feener C.A. Gussoni E. Yoshida M. Ozawa E. Kunkel L.M. J. Biol. Chem. 1996; 271: 2724-2730Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar, 12Blake D.J. Nawrotzki R. Peters M.F. Froehner S.C. Davies K.E. J. Biol. Chem. 1996; 271: 7802-7810Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Finally, the PDZ domain is composed of 90 amino acids and was originally identified in postsynaptic density-95, discs large, and ZO-1 (13Ponting C.P. Phillips C. Trends. Biochem. Sci. 1995; 20: 102-103Abstract Full Text PDF PubMed Scopus (163) Google Scholar). The PDZ domain is present in diverse families of enzymes and structural proteins, all of which are concentrated at specialized cell-cell junctions, such as neuronal synapses, epithelial zona occludens, and septate junctions. These observations suggest that PDZ domain may participate in protein-protein interactions at the plasma membrane (14Cho K.O. Hunt C.A. Kennedy M.B. Neuron. 1992; 9: 929-942Abstract Full Text PDF PubMed Scopus (1006) Google Scholar). Indeed, in skeletal muscle, the association of neuronal nitric-oxide synthase (nNOS) and α1-syntrophin has been demonstrated using a yeast two-hybrid system (15Brenman J.E. Chao D.S. Gee S.H. McGee A.W. CravenS E. Santillano D.R. Wu Z. Huang F. Xia H. Peters M.F. Froehner S.C. Bredt D.S. Cell. 1996; 84: 757-767Abstract Full Text Full Text PDF PubMed Scopus (1443) Google Scholar). α1-Syntrophin may work as a modular adaptor protein that can link a signaling enzyme and nNOS to the sarcolemmal dystrophin complex. In DMD and its experimental mouse model, mdx, which lacks dystrophin expression, nNOS is absent from the sarcolemma and partially accumulates in the cytosol (16Brenman J.E. Chao D.S. Xia H. Aldape K. Bredt D.S. Cell. 1995; 82: 743-752Abstract Full Text PDF PubMed Scopus (849) Google Scholar). The altered regulation of nNOS in the dystrophic muscle may augment the toxicity of NO or superoxide and therefore contribute to myofiber necrosis (17Haycock J.W. MacNeil S. Jones P. Harris J.B. Mantle D. Neuroreport. 1996; 8: 357-361Crossref PubMed Scopus (119) Google Scholar); the derangement of NO metabolism is responsible for tissue damage in certain diseases (18Nathan C. Xie Q.W. J. Biol. Chem. 1994; 269: 13725-13728Abstract Full Text PDF PubMed Google Scholar,19Huang Z. Huang P.L. Panahian N. Dalkara T. Fishman M.C. Moskowitz M.A. Science. 1994; 265: 1883-1885Crossref PubMed Scopus (1457) Google Scholar). Endogenous NO produced near the sarcolemma has been reported to depress contractile function (20Kobzik L. Reid M.B. Bredt D.S. Stamler J.S. Nature. 1994; 372: 546-548Crossref PubMed Scopus (843) Google Scholar), although the mechanism of NO action in muscle contraction is poorly understood. Galler et al. (21Galler S. Hilber K. Göbesberger A. Eur. J. Physiol. 1997; 434: 242-245Crossref PubMed Scopus (46) Google Scholar) showed NO-depressed muscle contraction in regard to both mechanical properties and myofibrillar ATPase activity using the skinned fibers method. Aghdashi et al. (22Aghdasi B. Reid M.B. Hamilton S.L. J. Biol. Chem. 1997; 272: 25462-25467Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar) hypothesized that oxidants and NO interact directly with Ca2+ release channel (ryanodine receptor 1) in the T-system. The overall magnitude of cGMP-dependent changes appears to be small (20Kobzik L. Reid M.B. Bredt D.S. Stamler J.S. Nature. 1994; 372: 546-548Crossref PubMed Scopus (843) Google Scholar). To investigate the role of α1-syntrophin in skeletal muscle and the interaction between α1-syntrophin and nNOS in vivo, we generated α1-syntrophin knock-out mice. The deficiency of α1-syntrophin in these mice causes the decrease of nNOS expression at the sarcolemma, indicating the direct interaction of α1-syntrophin and nNOS in vivo. Very interestingly, the absence of nNOS at the sarcolemma did not result in an overt degeneration of skeletal muscle in this mutant mouse. Therefore, the absence of nNOS at the sarcolemma may not be the major causative factor of muscle degeneration in DMD or in mdx mice. In addition, the force-frequency relationship between wild-type and α1-syntrophin knock-out mice showed no significant difference in muscle contractile properties. We also examined the effects of the NOS inhibitors, 7-nitroindazole (7-NI) and nitro l-arginine methyl ester (l-NAME), and the exogenous NO donor, sodium nitroprusside (NP), on muscle contraction. Treatment by NOS inhibitors caused the shift of stimulation-tension curves in the mutant mice, suggesting that muscle contractile properties of α1-syntrophin knock-out mice are regulated by the nNOS activity in the cytosol. The mouse α1-syntrophin gene was isolated from a mouse genomic library prepared from 129/SvJ mice DNA (Stratagene). It was probed with a 164-base pair RT-PCR product from exon 2 (7Adams M.E. Dwyer T.M. Dowler L.L. White R.A. Froehner S.C. J. Biol. Chem. 1995; 270: 25859-25865Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). The targeting vector, as shown in Fig. 1 a, consisted of the 6.0-kb genomic DNA containing the 1.2-kb neomycin resistance gene (BbsI site of exon 2) derived from pMC1neopoly(A) (24Thomas K.R. Capecchi M.R. Cell. 1987; 51: 503-512Abstract Full Text PDF PubMed Scopus (1826) Google Scholar). A 1.8-kb herpes simplex virus thymidine kinase gene was attached to the 5′ end of the α1-syntrophin-neomycin construction. Finally, the targeting vector was linearized using the restriction enzyme,NotI, before transfection by electroporation into E14 embryonic stem cells obtained from the inbred mouse strain 129/SvJ (23Nabeshima Y. Hanaoka K. Hayasaka M. Esumi E. Li S. Nonaka I. Nabeshima Y. Nature. 1993; 364: 532-535Crossref PubMed Scopus (729) Google Scholar). After detaching the ES cells (107) from their plates using trypsin, they were suspended in 3.2 ml of cold Hanks′ solution and then mixed with the targeting vector DNA at a concentration of 25 μg/ml in an electroporation cuvette. The electroporation was carried out at 200 V and 500 microfarads using Gene Pulser (Bio-Rad) apparatus. Two days following the electroporation, we added 300 μg/ml Neomycin (G418) to the cultures. On day 4 after electroporation, gancyclovir was added to the cultures to a concentration of 2 μm to isolate the cells containing a targeted disruption by positive-negative selection. Then surviving colonies were cloned after a 10-day selection period. Homologous recombinants were screened by PCR using the primers described below. The forward primer (P1), designed from neomycin resistance gene, was ATTCGCCAATGACAAGAC (24Thomas K.R. Capecchi M.R. Cell. 1987; 51: 503-512Abstract Full Text PDF PubMed Scopus (1826) Google Scholar), and the reverse primer (P2), outside the targeting vector, was CCTCTTTACATCTGTGTCATC. PCR was carried out for 40 cycles at 95 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min by a DNA thermal cycler (Perkin-Elmer). We generated chimeric mice using the blastocyst injection (23Nabeshima Y. Hanaoka K. Hayasaka M. Esumi E. Li S. Nonaka I. Nabeshima Y. Nature. 1993; 364: 532-535Crossref PubMed Scopus (729) Google Scholar) and aggregation (25Nagy A. Rossant J. Nagy R. Abramow-Newerly W. Roder J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8424-8428Crossref PubMed Scopus (1987) Google Scholar) methods. Blastocysts were recovered from a mating of B6C3F1 (F1 of C57BL/6 and C3H/He) and C57BL/6 mice. ES-injected blastocysts were transplanted into uteri of pseudopregnant ICR mice. The resulting chimeric mice were mated with BALB/c mice, and homozygous mutant mice were generated by an inter-crossing of heterozygotes. The aggregation method was performed as described previously, with some modifications to suit our experimental conditions (25Nagy A. Rossant J. Nagy R. Abramow-Newerly W. Roder J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8424-8428Crossref PubMed Scopus (1987) Google Scholar). Chimeric mice were mated with C57BL/6 mice, and homozygous mutant mice were generated by inter-crossing of heterozygotes. We isolated genomic DNA from ES cells or mouse tails by phenol extraction and ethanol precipitation. The genomic DNA was digested by EcoRI, fractionated using electrophoresis through 0.8% agarose gels, and transferred to Hybond N+ nylon membrane (Amersham Pharmacia Biotech). The blots were hybridized to the 32P-labeledNaeI-SpeI fragment of genomic DNA produced using a Random primer DNA labeling kit (Takara). Total RNA was isolated by using RNAzol B (Tel-Test, Inc.). We purified the poly(A)+RNA using the mRNA Purification Kit (Amersham Pharmacia Biotech). Poly(A)+ RNA was electrophoresed in a 1.0% denaturing agarose-formaldehyde gels and transferred to Hybond N+nylon membrane (Amersham Pharmacia Biotech). The hybrydization was carried out using 32P-labeled DNA probes constructed by employing a random primer DNA labeling kit (Takara). The density of the detected band were calculated using BAS-2000 (Fuji). Mouse α1-syntrophin cDNA (nucleotides 1180–1355) (26Adams M.E. Butler M.H. Dwyer T.M. Peters M.F. Murnane A.A. Froehner S.C. Neuron. 1993; 11: 531-540Abstract Full Text PDF PubMed Scopus (194) Google Scholar) and mouse nNOS cDNA (nucleotides 1547–2105) (27Ogura T. Yokoyama T. Fujisawa H. Kurashima Y. Esumi H. Biochem. Biophys. Res. Commun. 1993; 193: 1014-1022Crossref PubMed Scopus (108) Google Scholar) were used to detect the mRNA of α1-syntrophin and nNOS. For RT-PCR, first strand cDNA was synthesized using random hexamer primers. The forward primer (F1) and (F2), from exon 1 of α1-syntrophin gene (7Adams M.E. Dwyer T.M. Dowler L.L. White R.A. Froehner S.C. J. Biol. Chem. 1995; 270: 25859-25865Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar) was AGCTGCCAGAAGCGCTGCTG and GCTGGGCATCAGCATCAAGG, respectively. The reverse primer (R1), from exon 3 of the α1-syntrophin gene (7Adams M.E. Dwyer T.M. Dowler L.L. White R.A. Froehner S.C. J. Biol. Chem. 1995; 270: 25859-25865Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar) was GAGGTGAGTCCCAGCCAACG. The total cellular protein was extracted from mouse hind-limb muscle for Western blot analysis. We used Bradford method and Coomassie Brilliant Blue G-250 (Bio-Rad) to determine the protein concentrations. The protein fractions were extracted with a reducing sample buffer (10% SDS, 70 mm Tris-HCl, 5% β-mercaptoethanol, 10 mmEDTA). 15 μg protein/lane was separated on a SDS-polyacrylamide gel (8%). The resulting gel was subsequently transferred to a polyvinylidene difluoride membrane (Millipore) employing an amperage of 242 mA for 2 h. The blot was later incubated with anti-α1-syntrophin antibody. α1-Syntrophin polyclonal antibody was prepared by injecting purified synthetic peptides into rabbits according to standard protocols. Anti-α1-syntrophin antibody was raised against the peptides CRQPSSPGPQPRNLSEA (amino acids 191–206 (26Adams M.E. Butler M.H. Dwyer T.M. Peters M.F. Murnane A.A. Froehner S.C. Neuron. 1993; 11: 531-540Abstract Full Text PDF PubMed Scopus (194) Google Scholar) of α1-syntrophin plus an amino-terminal cysteine). The antibody was used at a 1:40 dilution, and its signal was detected using the enhanced chemiluminescence method (Amersham Pharmacia Biotech) and a 1:5000 dilution of the anti-rabbit secondary antibody (Tago Immunologicals). The skeletal muscle of mice were excised postmortem and then rapidly frozen in liquid nitrogen-cooled isopentane. 6-μm frozen sections were cut and placed on poly-l-lysine-coated slides. The slides were brought to room temperature, air dried, and acetone-fixed for 10 min. For histological analysis, the fixed sections were stained with hematoxylin and eosin. For immunostaining, the sections were incubated with anti-α1-syntrophin antibody at a dilution of 1:40 and then stained using fluorescein isothiocyanate-conjugated anti-rabbit goat antibody (Tago Immunologicals). An NDP activity assay was performed as described previously by Kusner and Kaminski (28Kusner L.L. Kaminski H.J. Brain. Res. 1996; 730: 238-242Crossref PubMed Scopus (86) Google Scholar). For this assay, 10-μm frozen sections were postfixed in 2% paraformaldehyde in phosphate-buffered saline, pH 7.4, at 2 h. After rinsing in phosphate-buffered saline, the sections were incubated in 0.2% Triton X-100 for 10 min at 37 °C. The subsequent reaction was carried out for 1 h in a dark, humidified chamber at 37 °C in 0.2% Triton X-100, 0.1 mm NADPH, and 0.16 mg/ml nitro blue tetrazolium. The reaction was terminated by washing with water. The extraction of nNOS was performed according to the method described by Brenman et al. (16Brenman J.E. Chao D.S. Xia H. Aldape K. Bredt D.S. Cell. 1995; 82: 743-752Abstract Full Text PDF PubMed Scopus (849) Google Scholar). To isolate nNOS, the quadriceps muscle was homogenized in 10 volumes (w/v) of buffer A (25 mmTris-HCl, pH 7.4, 100 mm NaCl, 1 mm EDTA, 1 mm EGTA). The nuclei of the muscle were pelleted by centrifugation at 1000 × g. The supernatant was then centrifuged at 20,000 × g to yield the supernatant S1. The resulting heavy microsomal pellet was resuspended in buffer B (500 mm NaCl added to buffer A), incubated for 30 min at 4 °C with agitation, and centrifuged at 15,000 × g, yielding supernatant S2. The pellet from this last centrifugation was resuspended in buffer B containing 0.5% Triton X-100, incubated for 30 min at 4 °C with agitation, and centrifuged at 15,000 ×g to create supernatant S3 and the final pellet, P. The fractions were resolved using the sample buffer and analyzed by SDS-polyacrylamide gel electrophoresis (6% polyacrylamide). The proteins were transferred to a polyvinylidene difluoride membrane (Millipore), which was later incubated with anti-nNOS antibody (Transduction Laboratories). NOS catalytic assay were carried out according to the method described by Brenman et al. (16Brenman J.E. Chao D.S. Xia H. Aldape K. Bredt D.S. Cell. 1995; 82: 743-752Abstract Full Text PDF PubMed Scopus (849) Google Scholar). The quadriceps muscle from wild-type, mdx, and homozygous mutant mice were homogenized in 10 volumes of buffer containing 25 mm Tris-HCl, pH 7.4, 1 mm EDTA, 1 mm EGTA, and 0.1 mm NaCl. The homogenate was centrifuged at 20,000 × g to reveal the soluble fraction. The pellet was extracted in the same buffer containing 0.5m NaCl and centrifuged at 20,000 × g to create a particulate fraction. To perform the catalytic assay, aliquots from these fractions were assayed in 125-μl reactions containing 1.8 × 105 cpm of [3H]arginine (53.0 Ci/mmol), 1 mm NADPH, 640 μmCaCl2, 1 μm calmodulin, 3 μmeach of tetrahydrobiopterin, FAD, and FMN. After incubation for 25 min at 22 °C, the assays were terminated with 2 ml of 20 mmHEPES, pH 5.5, 2 mm EDTA. The samples were then applied to 1-ml columns of Dowex AG50WX-8 (Na+ form), which were eluted with 2 ml of water. [3H]citrulline was quantified by liquid scintillation spectroscopy of the 4-ml flow-through. Differences of activity of soluble or particulate fractions between wild-type and knock-out or mdx mice were calculated using Student'st test. We dissected the muscle fiber bundles from the diaphragms and extensor digitorum longus of mice and tied them at both ends with silk filaments. The bundles were then mounted in a small bath between a pair of stainless steel rods, one of which was attached to a force transducer. We then immersed the bundles in physiological salt solution containing: 150 mm NaCl, 4 mm KCl, 2 mmCaCl2, 1 mm MgCl2, 5 mmHEPES, 5.6 mm glucose, pH 7.4. Electrical stimulation was applied through a pair of platinum wires placed on both sides of the bundles. The stimulus lasted 0.5 ms and measured a voltage of 20 V. The relative force was calculated by counting the force recorded at a stimulus frequency of 125 Hz as 100%. In the experiments using bundles from diaphragm, to assess the effects of NOS inhibitor and NO donor on contraction, 1 mm 7-NI, 5 mml-NAME, or 1 μm NP was added to the physiological salt solution. We cloned and mapped the mouse α1-syntrophin gene and used that information to disrupt it in the E14 ES cell line, a line derived from the 129/SvJ mouse strain. Homologous recombination between the targeting vector and the α1-syntrophin gene resulted in the replacement of the second exon of the gene with the neomycin resistance gene, thus knocking out the α1-syntrophin gene (Fig.1 a). Five positive clones were identified from 288 G418- and GANC-resistant clones. Southern blot analysis using a probe that recognizes an 7.0-kb band in the wild-type allele and a 3.6-kb band in the targeted allele confirmed our results (Fig. 1 b). Two germline-transmitting mice from the two independently derived E14 ES cell clones were obtained and further studied. Heterozygous animals identified by Southern blot analysis were bred with each other to obtain homozygous animals. Heterozygous and homozygous mice are indistinguishable from wild-type mice and develop normally in nearly all respects. Our Northern blot analysis revealed the expression of α1-syntrophin mRNA in the skeletal muscle of wild-type mice through strong signals at 2.2 and 2.6 kb (Fig.2 a). This result is consistent with a previous report regarding α1-syntrophin expression (7Adams M.E. Dwyer T.M. Dowler L.L. White R.A. Froehner S.C. J. Biol. Chem. 1995; 270: 25859-25865Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). The size of α1-syntrophin mRNA of heterozygous mutant mice was identical to that of wild-type mice, but the amount of α1-syntrophin mRNA was about 70% of that in wild-type mice. The mRNA of homozygous mutant mice included a 1.9-kb band and light smears in the vicinity of 1.5 kb. The amounts were 20% that of wild-type mice. Our RT-PCR analysis of the skeletal muscle mRNA of wild-type and homozygous mutant mice employed pairs of primers that spanned exon 1 and 3 of the α1-syntrophin gene. Wild-type mice revealed a PCR product with an expected size, but homozygous mutant mice had a shorter than expected product (Fig. 2 c). We cloned the PCR product from homozygous mutant mice and found that the entire exon 2 of the α1-syntrophin gene was missing. To investigate the expression of α1-syntrophin at the protein level, we prepared an anti-α1-syntrophin antibody. The polyclonal antibody was raised against synthetic peptide corresponding to α1-syntrophin (amino acids 191–206). Using this antibody, we carried out Western blot analysis of the skeletal muscle lysates of wild-type, heterozygous mutant, and homozygous mutant mice (Fig. 2 d). Wild-type mice revealed a 59-kDa band that corresponds to α1-syntrophin, whereas homozygous mutant mice showed no detectable α1-syntrophin. In addition, we could not detect any truncated fragments that could have been derived from the exon 2-lacking transcript. Heterozygous mutant mice produced nearly half the amount of α1-syntrophin compared with wild-type mice. We examined frozen sections of the tibialis anterior and soleus muscles of wild-type and homozygous mutant mice using hematoxylin and eosin staining (Fig.3, a–d). There were no striking morphologic changes in these skeletal muscles. We could detect neither degeneration and regeneration of muscle fibers nor cellular infiltrations and proliferation of connective tissues in the α1-syntrophin knock-out mice. Histochemical analysis using Myosin-ATPase staining indicated that the differentiation of muscle fiber types has not been affected. Using anti-α1-syntrophin antibody, we examined adult skeletal muscle immunohistochemically (Fig. 3, e and f). In wild-type mice, the expression of α1-syntrophin was detected at the sarcolemma and was particularly enriched at the neuromuscular junction, as already reported (10Peters M.F. Kramarcy N.R. Sealock R. Froehner S.C. Neuroreport. 1994; 5: 1577-1580Crossref PubMed Scopus (123) Google Scholar). In homozygous mutant mice, the expression of α1-syntrophin was completely absent in both the sarcolemma and the neuromuscular junction. The labeling pattern for the α1-syntrophin of heterozygous mutant mice was indistinguishable from that of wild-type mice. To investigate the expression of dystrophin-glycoprotein complex in α1-syntrophin knock-out mice, we performed immunohistochemical analysis of adult skeletal muscles using anti-dystrophin and anti-α-sarcoglycan antibody. The expression of dystrophin and α-sarcoglycan appeared to be not altered in homozygous mutant skeletal muscle (data not shown). Recent research has suggested that α1-syntrophin anchors nNOS to the sarcolemma (14Cho K.O. Hunt C.A. Kennedy M.B. Neuron. 1992; 9: 929-942Abstract Full Text PDF PubMed Scopus (1006) Google Scholar). We investigated the influence of the loss of α1-syntrophin on the expression of nNOS in the homozygous mutant muscle. We did this by performing a Northern blot analysis of adult skeletal muscle (Fig. 4 a). In wild-type mice, a single 10-kb band corresponding to nNOS mRNA was detected. Homozygous mutant mice produced an equal amount of nNOS mRNA. In mdx skeletal muscle, the amount of nNOS mRNA was decreased to 50% in accord with the previous report (29Chang W.J. Iannaccone S.T. Lau K.S. Masters B.S.S. McCabe T.J. McMillan K. Padre R.C. Spencer M.J. Tidball J.G. Stull J.T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9142-9147Crossref PubMed Scopus (313) Google Scholar). In DMD and mdx mice, nNOS is absent from the sarcolemma but expressed in the cytosol although in small amounts. Like nNOS, NDP activity in skeletal muscle fibers is also concentrated in the sarcolemma and colocalizes with nNOS (28Kusner L.L. Kaminski H.J. Brain. Res. 1996; 730: 238-242Crossref PubMed Scopus (86) Google Scholar) (Fig. 4 c). In α1-syntrophin knock-out mice, however, NDP activity was completely absent in the sarcolemma (Fig. 4 d). We also investigated the subcellular distribution of nNOS in the quadriceps muscle of α1-syntrophin knock-out mice (Fig. 4,e and f). In wild-type mice, significant amounts of nNOS remained in the insoluble pellet (P) even after the sequential S1, S2, and S3 extractions of skeletal muscle homogenates. By contrast, nNOS was largely removed with 100 mm NaCl (S1) and did not remain in the pellet (P) fraction in α1-syntrophin knock-out mice. Our study of nNOS catalytic activity demonstrated that this activity for nNOS was strongest in the particulate fractions of skeletal muscle homogenates in wild-type mice in accord with previous report (15Brenman J.E. Chao D.S. Gee S.H. McGee A.W. CravenS E. Santillano D.R. Wu Z. Huang F. Xia H. Peters M.F. Froehner S.C. Bredt D.S. Cell. 1996; 84: 757-767Abstract Full Text Full Text PDF PubMed Scopus (1443) Google Scholar) (Table I). In mdx mice, some nNOS activity remained in the soluble fractions, whereas activity in the particulate fractions was decreased. Homozygous mutant has decreased nNOS activity in the particulate fraction but maintained the activity in the soluble fractions, compared with wild-type mice. In addition, the total nNOS activity for homozygous mutant mice was 59% that of wild-type mice; the activity for mdx mice was only 27% when calculated using the mean value.Table INOS catalytic assayFractionSolubleSignificanceParticulateSignificance+/+3.77 ± 0.447.60 ± 1.34−/−4.42 ± 1.35NS2.28 ± 0.82p < 0.02mdx2.33 ± 0.58NS0.74 ± 0.40p < 0.005nNOS catalytic activity was enriched in the particulate fractions of skeletal muscle homogenates in wild-type mice. In mdx mice and homozygous mutant, nNOS activities were decreased in particulate fractions. Differences between wild-type and knock-out ormdx mice were calculated by t test. The values are the means ± S.E. (n = 4 in all comparisons; ×105 cpm mg−1 protein). NS, not significant. Open table in a new tab nNOS catalytic activity was enriched in the particulate fractions of skeletal muscle homogenates in wild-type mice. In mdx mice and homozygous mutant, nNOS activities were decreased in particulate fractions. Differences between wild-type and knock-out ormdx mice were calculated by t test. The values are the means ± S.E. (n = 4 in all comparisons; ×105 cpm mg−1 protein). NS, not significant. To examine the influence of intracellular distribution of nNOS in knock-out mice on muscle contraction, we measured contractile properties of the diaphragm and the extensor digitorum longus muscles (Fig. 5). We first measured the relative forces exerted during submaximal contractions to determine the steady state force-frequency relationship in the diaphragm of the wild-type and α1-syntrophin knock-out mice. No significant difference was observed between wild-type and α1-syntrophin knock-out mice at any stimulus frequency measured. Extensor digitorum longus muscle was also investigated but again did not produce any differences between wild-type and knock-out mice (data not shown). In diaphragm, we further investigated the influence of NOS inhibitors and NO donor on muscle contractions (Fig. 5). Exposure to the NOS inhibitor 7-NI shifted the force-frequency relationship up and to the left at both wild-type and α1-syntrophin knock-out mice, and the relative forces showed no significant difference between the mice. Exposure to the NOS inhibitor, l-NAME also shifted the force-frequency relationship up and to the left at both wild-type and α1-syntrophin knock-out mice. However, l-NAME had a relatively weak effect on contraction in knock-out mice compared with the effect in wild-type mice. Treatment by the NO donor NP did not result in any significant changes from the steady state. Our α1-syntrophin knock-out mice produce a truncated transcript that lacks 186 base pairs of exon 2 of the α1-syntrophin gene. This missing segment could cause an in-frame deletion and produce a truncated α1-syntrophin lacking the PDZ domain. However, Western blot analysis detected no truncated α1-syntrophin in the knock-out mice. We conclude that a truncated α1-syntrophin probably is unstable and therefore difficult to detect, although small amount of truncated α1-syntrophin mRNA is identified. In α1-syntrophin knock-out mice, there is no NDP activity in the sarcolemma and a considerable amount of nNOS remains at the soluble fraction. The interaction of α1-syntrophin and nNOS has been demonstrated in vitro by using the yeast two-hybrid system, pull-down assay, and protein overlay assay (15Brenman J.E. Chao D.S. Gee S.H. McGee A.W. CravenS E. Santillano D.R. Wu Z. Huang F. Xia H. Peters M.F. Froehner S.C. Bredt D.S. Cell. 1996; 84: 757-767Abstract Full Text Full Text PDF PubMed Scopus (1443) Google Scholar). Although there is an altered distribution of nNOS in DMD and mdx mice, it is not known which protein among the dystrophin-associated proteins is responsible for the disappearance of nNOS from the sarcolemma. Our data strongly suggest that α1-syntrophin interacts with nNOS in vivo via the PDZ domain and anchors nNOS to the submembranous dystrophin complex. The role of NO in skeletal muscle is not clear. Altering the regulation of nNOS in dystrophic muscle can augment the toxic interaction of NO and superoxide with the cell and contribute to myofiber necrosis (17Haycock J.W. MacNeil S. Jones P. Harris J.B. Mantle D. Neuroreport. 1996; 8: 357-361Crossref PubMed Scopus (119) Google Scholar). In DMD and mdx mice, the preferential degeneration of fast twitch fiber can be explained by the selective enrichment of nNOS in fast twitch muscle fibers (20Kobzik L. Reid M.B. Bredt D.S. Stamler J.S. Nature. 1994; 372: 546-548Crossref PubMed Scopus (843) Google Scholar). Our knock-out mice have no obvious degeneration of their muscle fibers despite the disappearance of α1-syntrophin and nNOS from the sarcolemma. This suggests that the degeneration process does not arise merely from the altered distribution of nNOS. NO produced by nNOS near the sarcolemma of fast twitch muscle fibers appears to regulate the muscle contraction by opposing the generation of contractile force (20Kobzik L. Reid M.B. Bredt D.S. Stamler J.S. Nature. 1994; 372: 546-548Crossref PubMed Scopus (843) Google Scholar). Our functional analysis of the contractile properties of wild-type and α1-syntrophin knock-out mice revealed no significant changes when tested at steady state. This observation shows that the muscles of the knock-out mice still retain enough NO to regulate muscle contraction by depressing the contractile force. This was also supported by the findings that treatment with a NOS inhibitor, 7-NI, shifted the force-frequency relationship to the left not only in wild-type mice but also in α1-syntrophin knock-out mice. However, another NOS inhibitor, l-NAME, had a comparatively weak effect on muscle contraction of α1-syntrophin knock-out mice than the effect on that of wild-type mice. We cannot exclude the possibility that the modest response to l-NAME reflects reduced expression of nNOS and/or the altered distribution of nNOS in α1-syntrophin knock-out mice. Although Kobzik et al. (20Kobzik L. Reid M.B. Bredt D.S. Stamler J.S. Nature. 1994; 372: 546-548Crossref PubMed Scopus (843) Google Scholar) showed that the exogenous NO donor, sodium nitroprusside, could depress the development of tension, our findings reveal that sodium nitroprusside has no significant effect on contraction. Because the effect of the exogenous NO donor was relatively modest compared with the NOS inhibitor in the previous study, the exogenous NO donor might have a weak effect on contraction in our particular assay. The biochemical nNOS catalytic activity assay showed that α1-syntrophin knock-out mice maintained 59% of nNOS activity compared with wild-type mice and that certain activities were still retained at the cytosol fraction. We believe that the remaining nNOS activity in the cytosol regulates the contractile properties of α1-syntrophin knock-out mice. Although the target of NO in skeletal muscle contraction has not yet been assigned to either myofibrillar proteins, the Ca2+release channel, or any other factors, our results suggest that cytosolic nNOS could compensate for the lost activity of membrane-associated nNOS and provide enough NO to depress the excessive contraction. α1-Syntrophin transcript is also expressed in tissues other than skeletal and cardiac muscles. The amount of mRNA in tissues other than striated muscle is very low, and its expression in other tissues has not yet been fully verified and therefore must be investigated. Although we have demonstrated an important role for α1-syntrophin in the function of nNOS within the sarcolemma, further study will be needed to gain a deeper understanding of the function of α1-syntrophin in the contraction and maintenance of the structure of skeletal muscle. We thank Dr. Hideo Sugita and Daniel North for review of this manuscript." @default.
• W1972475548 created "2016-06-24" @default.
• W1972475548 creator A5001477991 @default.
• W1972475548 creator A5005197742 @default.
• W1972475548 creator A5010497034 @default.
• W1972475548 creator A5018277239 @default.
• W1972475548 creator A5046127849 @default.
• W1972475548 creator A5048464313 @default.
• W1972475548 creator A5049591524 @default.
• W1972475548 creator A5078853742 @default.
• W1972475548 date "1999-01-01" @default.
• W1972475548 modified "2023-10-18" @default.
• W1972475548 title "α1-Syntrophin Gene Disruption Results in the Absence of Neuronal-type Nitric-oxide Synthase at the Sarcolemma but Does Not Induce Muscle Degeneration" @default.
• W1972475548 cites W1519147845 @default.
• W1972475548 cites W1520797038 @default.
• W1972475548 cites W1590744420 @default.
• W1972475548 cites W1883425081 @default.
• W1972475548 cites W1966697925 @default.
• W1972475548 cites W1974473484 @default.
• W1972475548 cites W1974543599 @default.
• W1972475548 cites W1977394169 @default.
• W1972475548 cites W1984111138 @default.
• W1972475548 cites W1993834457 @default.
• W1972475548 cites W1999153785 @default.
• W1972475548 cites W2010469212 @default.
• W1972475548 cites W2018248908 @default.
• W1972475548 cites W2021135182 @default.
• W1972475548 cites W2022269855 @default.
• W1972475548 cites W2042054187 @default.
• W1972475548 cites W2044358861 @default.
• W1972475548 cites W2056884826 @default.
• W1972475548 cites W2059155059 @default.
• W1972475548 cites W2062368768 @default.
• W1972475548 cites W2062746471 @default.
• W1972475548 cites W2073360590 @default.
• W1972475548 cites W2073981358 @default.
• W1972475548 cites W2074187719 @default.
• W1972475548 cites W2081550861 @default.
• W1972475548 cites W2081920111 @default.
• W1972475548 cites W2092094211 @default.
• W1972475548 cites W2140246888 @default.
• W1972475548 cites W2169126683 @default.
• W1972475548 doi "https://doi.org/10.1074/jbc.274.4.2193" @default.
• W1972475548 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9890982" @default.
• W1972475548 hasPublicationYear "1999" @default.
• W1972475548 type Work @default.
• W1972475548 sameAs 1972475548 @default.
• W1972475548 citedByCount "174" @default.
• W1972475548 countsByYear W19724755482012 @default.
• W1972475548 countsByYear W19724755482013 @default.
• W1972475548 countsByYear W19724755482014 @default.
• W1972475548 countsByYear W19724755482015 @default.
• W1972475548 countsByYear W19724755482016 @default.
• W1972475548 countsByYear W19724755482018 @default.
• W1972475548 countsByYear W19724755482019 @default.
• W1972475548 countsByYear W19724755482020 @default.
• W1972475548 countsByYear W19724755482021 @default.
• W1972475548 countsByYear W19724755482022 @default.
• W1972475548 countsByYear W19724755482023 @default.
• W1972475548 crossrefType "journal-article" @default.
• W1972475548 hasAuthorship W1972475548A5001477991 @default.
• W1972475548 hasAuthorship W1972475548A5005197742 @default.
• W1972475548 hasAuthorship W1972475548A5010497034 @default.
• W1972475548 hasAuthorship W1972475548A5018277239 @default.
• W1972475548 hasAuthorship W1972475548A5046127849 @default.
• W1972475548 hasAuthorship W1972475548A5048464313 @default.
• W1972475548 hasAuthorship W1972475548A5049591524 @default.
• W1972475548 hasAuthorship W1972475548A5078853742 @default.
• W1972475548 hasBestOaLocation W19724755481 @default.
• W1972475548 hasConcept C104317684 @default.
• W1972475548 hasConcept C112243037 @default.
• W1972475548 hasConcept C142724271 @default.
• W1972475548 hasConcept C178790620 @default.
• W1972475548 hasConcept C185592680 @default.
• W1972475548 hasConcept C199096232 @default.
• W1972475548 hasConcept C207200792 @default.
• W1972475548 hasConcept C2777622882 @default.
• W1972475548 hasConcept C2779354088 @default.
• W1972475548 hasConcept C519581460 @default.
• W1972475548 hasConcept C55493867 @default.
• W1972475548 hasConcept C71924100 @default.
• W1972475548 hasConcept C86803240 @default.
• W1972475548 hasConcept C95444343 @default.
• W1972475548 hasConceptScore W1972475548C104317684 @default.
• W1972475548 hasConceptScore W1972475548C112243037 @default.
• W1972475548 hasConceptScore W1972475548C142724271 @default.
• W1972475548 hasConceptScore W1972475548C178790620 @default.
• W1972475548 hasConceptScore W1972475548C185592680 @default.
• W1972475548 hasConceptScore W1972475548C199096232 @default.
• W1972475548 hasConceptScore W1972475548C207200792 @default.
• W1972475548 hasConceptScore W1972475548C2777622882 @default.
• W1972475548 hasConceptScore W1972475548C2779354088 @default.
• W1972475548 hasConceptScore W1972475548C519581460 @default.
• W1972475548 hasConceptScore W1972475548C55493867 @default.
• W1972475548 hasConceptScore W1972475548C71924100 @default.
• W1972475548 hasConceptScore W1972475548C86803240 @default.
• W1972475548 hasConceptScore W1972475548C95444343 @default.
• W1972475548 hasIssue "4" @default.

• next