FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1972647860> ?p ?o ?g. }

• W1972647860 endingPage "73" @default.
• W1972647860 startingPage "66" @default.
• W1972647860 abstract "αβ T cells constitute an important component in the first line of immunologic defense in human skin. In order to determine the local selection forces driving T cell diversity, we studied the T cell receptor repertoire in normal human skin and compared it with that of matched blood samples. Using semiquantitative reverse transcription–polymerase chain reaction the expression of T cell receptor β-chain V genes was determined. The majority of skin, but not blood T cells, revealed a bias towards usage of T cell receptor β-chain V2 and V6. Whereas sequencing of T cell receptor β-chain V2 and V6 polymerase chain reaction products showed a heterogeneous clonal distribution within these β-chain V gene families, the analysis of other selected either over- or underrepresented β-chain V gene families (BV3, BV12, BV13S1, BV17) revealed numerous identical T cell receptor β-chain V transcript sequences that were not detected in blood. Restricted T cell receptor diversity in terms of β-chain V gene preferences or clonal expansion was observed in skin samples of donors from all ages (0.5–87 y). Hence, the repertoire of T cells in normal human skin is apparently subjected to skin-specific selection throughout life. According to our data, this process could involve superantigens, which favor polyclonal accumulation of T cells using certain β-chain V genes, as well as antigens, which induce clonal T cell expansion. Our results furthermore indicate, that T cell receptor β-chain V repertoire restrictions do not necessarily result from disease-associated activation of the skin immune system, but could reflect regular mechanisms of immunologic homeostasis within the epithelial surface of the body. αβ T cells constitute an important component in the first line of immunologic defense in human skin. In order to determine the local selection forces driving T cell diversity, we studied the T cell receptor repertoire in normal human skin and compared it with that of matched blood samples. Using semiquantitative reverse transcription–polymerase chain reaction the expression of T cell receptor β-chain V genes was determined. The majority of skin, but not blood T cells, revealed a bias towards usage of T cell receptor β-chain V2 and V6. Whereas sequencing of T cell receptor β-chain V2 and V6 polymerase chain reaction products showed a heterogeneous clonal distribution within these β-chain V gene families, the analysis of other selected either over- or underrepresented β-chain V gene families (BV3, BV12, BV13S1, BV17) revealed numerous identical T cell receptor β-chain V transcript sequences that were not detected in blood. Restricted T cell receptor diversity in terms of β-chain V gene preferences or clonal expansion was observed in skin samples of donors from all ages (0.5–87 y). Hence, the repertoire of T cells in normal human skin is apparently subjected to skin-specific selection throughout life. According to our data, this process could involve superantigens, which favor polyclonal accumulation of T cells using certain β-chain V genes, as well as antigens, which induce clonal T cell expansion. Our results furthermore indicate, that T cell receptor β-chain V repertoire restrictions do not necessarily result from disease-associated activation of the skin immune system, but could reflect regular mechanisms of immunologic homeostasis within the epithelial surface of the body. complementarity determining region 3 superantigen TCR β chain As a physical barrier and as immune organ, the skin protects the body against infections and other hazards. Accordingly, skin resident T cells are confronted with many different immunologic challenges. They include bacterial and fungal infections as well as dermatotropic viruses such as human papilloma or herpes simplex viruses. Also, systemic viral infections like measles, varicella, rubeola, and parvovirus B19 manifest their lesions predominantly in the skin. Another vital function of the skin T cells becomes evident in immunosuppressed transplant patients. Here, the loss of tumor immunosurveillance is often followed by rapid formation of aggressive cutaneous malignancies (Walder et al., 1971Walder B.K. Robertson M.R. Jeremy D. Skin cancer and immunosuppression.Lancet. 1971; 2: 1282Abstract PubMed Scopus (251) Google Scholar;Blohme and Larko, 1984Blohme I. Larko O. Premalignant and malignant skin lesions in renal transplant patients.Transplantation. 1984; 37: 165Crossref PubMed Scopus (71) Google Scholar). The skin, furthermore, contacts and reacts to an extensive variety of environmental allergens and systemically administered drugs. In order to comply with this multitude of immunologic challenges, the skin is equipped with a dense network of antigen-presenting cells and with T cells, that seem to represent a select population which has differentiated to meet the local requirements (Bos and Kapsenberg, 1993Bos J.D. Kapsenberg M.L. The skin immune system: progress in cutaneous biology.Immunol Today. 1993; 14: 75Abstract Full Text PDF PubMed Scopus (330) Google Scholar). According to their particular organization and activity the cellular components of the skin-associated lymphoid tissue (SALT) (Streilein, 1978Streilein J.W. Lymphocyte traffic, T-cell malignancies and the skin.J Invest Dermatol. 1978; 71: 167Crossref PubMed Scopus (140) Google Scholar) were recognized as a separate functional entity of the immune system and termed skin immune system (Bos and Kapsenberg, 1993Bos J.D. Kapsenberg M.L. The skin immune system: progress in cutaneous biology.Immunol Today. 1993; 14: 75Abstract Full Text PDF PubMed Scopus (330) Google Scholar). Within the skin immune system residing antigen-presenting cells, such as epidermal Langerhans cells, dermal dendritic cells and macrophages are endowed with a particularly high capacity to capture antigens from the environment and circulation (Bos, 1997Bos J.D. The skin as an organ of immunity.Clin Exp Immunol. 1997; 107: 3PubMed Google Scholar). They are carried to draining lymph nodes where primary immune responses against these antigens occur, and where T cells become activated and acquire the selective ability to enter the skin and initiate immune responses (Picker et al., 1993Picker L.J. Treer J.R. Ferguson Darnell B. Collins P.A. Bergstresser P.R. Terstappen L.W. Control of lymphocyte recirculation in man. II. Differential regulation of the cutaneous lymphocyte-associated antigen, a tissue-selective homing receptor for skin-homing T cells.J Immunol. 1993; 150: 1122PubMed Google Scholar;Butcher and Picker, 1996Butcher E.C. Picker L.J. Lymphocyte homing and homeostasis.Science. 1996; 272: 60Crossref PubMed Scopus (2457) Google Scholar). The majority of the skin resident T cells express the skin-selective homing receptor, cutaneous lymphocyte associated antigen (CLA) (Picker et al., 1990Picker L.J. Michie S.A. Rott L.S. Butcher E.C. A unique phenotype of skin-associated lymphocytes in humans. Preferential expression of the HECA-452 epitope by benign and malignant T cells at cutaneous sites.Am J Pathol. 1990; 136: 1053PubMed Google Scholar;Bos et al., 1993Bos J.D. de Boer O.J. Tibosch E. Das P.K. Pals S.T. Skin-homing T lymphocytes: detection of cutaneous lymphocyte-associated antigen (CLA) by HECA-452 in normal human skin.Arch Dermatol Res. 1993; 285: 179Crossref PubMed Scopus (58) Google Scholar). Most of them are found in an activated state in close association with antigen-presenting cells (Bos et al., 1987Bos J.D. Zonneveld I. Das P.K. Krieg S.R. van der Loos C.M. Kapsenberg M.L. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin.J Invest Dermatol. 1987; 88: 569Abstract Full Text PDF PubMed Google Scholar;Foster et al., 1990Foster C.A. Yokozeki H. Rappersberger K. et al.Human epidermal T cells predominantly belong to the lineage expressing alpha/beta T cell receptor.J Exp Med. 1990; 171: 997Crossref PubMed Scopus (134) Google Scholar;Cavani et al., 1998Cavani A. Mei D. Guerra E. et al.Patients with allergic contact dermatitis to nickel and nonallergic individuals display different nickel-specific T cell responses. Evidence for the presence of effector CD8+ and regulatory CD4+ T cells.J Invest Dermatol. 1998; 111: 621Crossref PubMed Scopus (170) Google Scholar). Except for the expression of CLA, little is known about the differentiation and specificity of the cutaneous T cell population. Elucidation of the mechanisms that promote selection and diversity of skin-homing T cells is essential to understand organization and function of the skin immune system under both healthy and pathologic conditions. Several mechanisms may influence T cell diversity in defined anatomical compartments. Stimulation by regional antigens may induce clonal T cell expansion (McHeyzer-Williams and Davis, 1995McHeyzer-Williams M.G. Davis M.M. Antigen-specific development of primary and memory T cells in vivo.Science. 1995; 268: 106Crossref PubMed Scopus (398) Google Scholar;Maryanski et al., 1996Maryanski J.L. Jongeneel C.V. Bucher P. Casanova J.L. Walker P.R. Single-cell PCR analysis of TCR repertoires selected by antigen in vivo: a high magnitude CD8 response is comprised of very few clones.Immunity. 1996; 4: 47Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar) whereas superantigens favor accumulation of polyclonal T cell populations with preference for particular β-chain V (BV) genes (Choi et al., 1989Choi Y. Kotzin B. Herron L. Callahan J. Marrack P. Kappler J. Interaction of Staphylococcus aureus toxin ‘superantigens’ with human T cells.Proc Natl Acad Sci USA. 1989; 86: 8941Crossref PubMed Scopus (916) Google Scholar;Kappler et al., 1989Kappler J. Kotzin B. Herron L. et al.V beta-specific stimulation of human T cells by staphylococcal toxins.Science. 1989; 244: 811Crossref PubMed Scopus (613) Google Scholar). As T cell receptor (TCR) usage may differentiate between these specific modes of T cell enrichment and regional selection pressure, we analyzed the TCR usage in normal human skin to determine potential skewing of the repertoire. T cells expressing αβ TCR represent the vast majority of skin resident T cells in postnatal life (Foster et al., 1990Foster C.A. Yokozeki H. Rappersberger K. et al.Human epidermal T cells predominantly belong to the lineage expressing alpha/beta T cell receptor.J Exp Med. 1990; 171: 997Crossref PubMed Scopus (134) Google Scholar). Whereas the hypervariable complementarity-determining region 2 (CDR2) of both the TCR α- and β-variable chains (TCRAV/BV) contact the major histocompatibility complex-molecule, the CDR3, and to a lesser degree, CDR1, interact with the major histocompatibility complex bound peptide (Garboczi et al., 1996Garboczi D.N. Ghosh P. Utz U. Fan Q.R. Biddison W.E. Wiley D.C. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2.Nature. 1996; 384: 134Crossref PubMed Scopus (1173) Google Scholar;Garcia et al., 1996Garcia K.C. Degano M. Stanfield R.L. et al.An alpha/beta T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex.Science. 1996; 274: 209Crossref PubMed Scopus (1033) Google Scholar). Of these, it is the loop with the highest potential diversity, CDRβ3, generated by somatic recombination of the TCR variable (V), diversity (D), and joining (J) gene segments and further N-region diversification (Davis and Bjorkman, 1988Davis M.M. Bjorkman P.J. T-cell antigen receptor genes and T-cell recognition.Nature. 1988; 334: 395Crossref PubMed Scopus (2345) Google Scholar;Gellert, 1997Gellert M. Recent advances in understanding V (D) J recombination.Adv Immunol. 1997; 64: 39Crossref PubMed Google Scholar), which buries more than half of the peptide surface and hereby contributes substantially to antigen-specificity by its particular amino acid composition (Hedrick et al., 1988Hedrick S.M. Engel I. McElligott D.L. Fink P.J. Hsu H.M. Hansburg D. Matis L.A. Selection of amino acid sequences in the beta chains of the T cell antigen receptor.Science. 1988; 239: 1541Crossref PubMed Scopus (191) Google Scholar;Garboczi et al., 1996Garboczi D.N. Ghosh P. Utz U. Fan Q.R. Biddison W.E. Wiley D.C. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2.Nature. 1996; 384: 134Crossref PubMed Scopus (1173) Google Scholar). For determining cutaneous TCR diversity, it would have been desirable to isolate the T cells from skin biopsies as this would allow separation into subpopulations or analysis at a single cell level. Whereas about 2%-5% of the skin T cells are contained in the epidermis, the majority of the cutaneous T cells are located within the dermis, which consists of tight fibrous connective tissue and strongly resists direct T cell isolation (Bos et al., 1987Bos J.D. Zonneveld I. Das P.K. Krieg S.R. van der Loos C.M. Kapsenberg M.L. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin.J Invest Dermatol. 1987; 88: 569Abstract Full Text PDF PubMed Google Scholar;Foster et al., 1990Foster C.A. Yokozeki H. Rappersberger K. et al.Human epidermal T cells predominantly belong to the lineage expressing alpha/beta T cell receptor.J Exp Med. 1990; 171: 997Crossref PubMed Scopus (134) Google Scholar). Although, when planted in culture, dermal T cells may migrate out of biopsy tissue fragments (Prinz et al., 1994Prinz J.C. Gross B. Vollmer S. Trommler P. Strobel I. Meurer M. Plewig G. T cell clones from psoriasis skin lesions can promote keratinocyte proliferation in vitro.Eur J Immunol. 1994; 24: 593Crossref PubMed Scopus (129) Google Scholar;Horrocks et al., 1997Horrocks C. Holder J.E. Berth-Jones J. Camp R.D. Antigen-independent expansion of T cells from psoriatic skin lesions: phenotypic characterization and antigen reactivity.Br J Dermatol. 1997; 137: 331Crossref PubMed Scopus (14) Google Scholar), it is not known whether the T cell lines generated this way actually reflect the composition within the skin. To avoid a bias derived from the isolation procedure, we therefore chose to determine the cutaneous TCR usage directly from full thickness skin biopsies consisting of both dermis and epidermis. We used a duplex, semiquantitative reverse transcription–polymerase chain reaction (RT–PCR) technique to determine TCRBV gene expression in the skin of donors from four age groups, from infancy to seniority. Subcloned TCRBV-BC PCR products of several gene families were sequenced to determine junctional diversity of the CDRβ3. This approach has provided the basis for understanding diversity and specificity of T cell mediated immune responses (Panzara et al., 1992Panzara M.A. Oksenberg J.R. Steinman L. The polymerase chain reaction for detection of T-cell antigen receptor expression.Curr Opin Immunol. 1992; 4: 205Crossref PubMed Scopus (21) Google Scholar;Marguerie et al., 1992Marguerie C. Lunardi C. So A. PCR-based analysis of the TCR repertoire in human autoimmune diseases.Immunol Today. 1992; 13: 336Abstract Full Text PDF PubMed Scopus (47) Google Scholar). To distinguish regional TCR repertoire restrictions, TCR usage of skin samples was compared with peripheral blood TCR diversity of the same individuals. Our results demonstrate a restricted TCR diversity within the cutaneous T cell population. Overexpression of certain BV gene families and limited TCR transcript heterogeneity within all age groups suggest a preferential T cell selection in normal human skin. Skin samples were obtained with patients' informed consent from clinically normal, healthy skin of four female and five male individuals from four age groups: small infants (A, B, 4 and 6 mo); young adults (C, D, 22 and 23 y); middle-aged adults (E, F, 47 and 53 y) and elderly individuals (G, H and I, 70 (G) or 76 y). Usually, spindle-shaped skin samples of approximately 2 cm length comprising epidermis and full thickness dermis were obtained from the infraclavicular region of the trunk. Skin specimens of infants were derived from the dorsum of fingers that had been amputated due to hexadactylie (additional/sixth finger). Samples were homogenized in 4 M guanidinium isothiocyanate, 50 mM Tris–HCl, 10 mM ethylenediamine tetraacetic acid, and 100 μM β-mercaptoethanol. Paired blood samples were taken the same day as the biopsy. Preparation of blood lymphocytes and extraction of total RNA were performed essentially as described (Prinz et al., 1994Prinz J.C. Gross B. Vollmer S. Trommler P. Strobel I. Meurer M. Plewig G. T cell clones from psoriasis skin lesions can promote keratinocyte proliferation in vitro.Eur J Immunol. 1994; 24: 593Crossref PubMed Scopus (129) Google Scholar;Vollmer et al., 1994Vollmer S. Menssen A. Trommler P. Schendel D. Prinz J.C. T. lymphocytes derived from skin lesions of patients with psoriasis vulgaris express a novel cytokine pattern that is distinct from that of T helper type 1 and T helper type 2 cells.Eur J Immunol. 1994; 24: 2377Crossref PubMed Scopus (130) Google Scholar). TCRBV expression and transcript diversity were analyzed as described (Menssen et al., 1995Menssen A. Trommler P. Vollmer S. et al.Evidence for an antigen-specific cellular immune response in skin lesions of patients with psoriasis vulgaris.J Immunol. 1995; 155: 4078PubMed Google Scholar). TCR-specific cDNA templates were generated by reverse transcription using oligonucleotide primers specific for the TCRAB constant region mRNA: 3′Cα (5′TCATAAATTCGG-GTAGGATCC3′) and 3′Cβ (5′TGTCCGAAGAAGGGGCTGGT3′) (Choi et al., 1989Choi Y. Kotzin B. Herron L. Callahan J. Marrack P. Kappler J. Interaction of Staphylococcus aureus toxin ‘superantigens’ with human T cells.Proc Natl Acad Sci USA. 1989; 86: 8941Crossref PubMed Scopus (916) Google Scholar). cDNA was analyzed by duplex, semiquantitative TCRBV repertoire PCR using a common TCRBC 3′ primer in conjunction with one of 26 different 5′ TCRBV gene family primers. As the internal standard a second fragment was coamplified in each reaction by the use of two primers corresponding to regions of the TCRAC cDNA (3′Cα: 5′TCATAAATTCGGGTAGGATCC3′ 5′Cα: 5′GAACCC-TGACCCTGCCGTGTACC3′). TCRAC was chosen as it serves as a marker for TCR mRNA (Yamamura et al., 1991Yamamura M. Uyemura K. Deans R.J. Weinberg K. Rea T.H. Bloom B.R. Modlin R.L. Defining protective responses to pathogens: cytokine profile in leprosy lesions.Science. 1991; 254: 277Crossref PubMed Scopus (1038) Google Scholar). TCRBV1–20, BC and AC oligonucleotide primer sequences corresponded to those described byChoi et al., 1989Choi Y. Kotzin B. Herron L. Callahan J. Marrack P. Kappler J. Interaction of Staphylococcus aureus toxin ‘superantigens’ with human T cells.Proc Natl Acad Sci USA. 1989; 86: 8941Crossref PubMed Scopus (916) Google Scholar, and the TCRBV21–24 sequences to those described bySteinle et al., 1995Steinle A. Reinhardt C. Jantzer P. Schendel D.J. In vivo expansion of HLA-B35 alloreactive T cells sharing homologous T cell receptors: evidence for maintenance of an oligoclonally dominated allospecificity by persistent stimulation with an autologous MHC/peptide complex.J Exp Med. 1995; 181: 503Crossref PubMed Scopus (40) Google Scholar. Comparison of the BV repertoires requires that similarly sized populations of T cells be analyzed so that one sample is not on the nonlinear part of PCR amplification. Therefore, before amplification for TCRBV repertoire characterization, the cDNA of blood and skin samples were standardized by PCR analysis using the TCRA constant region primers on serial cDNA dilutions. cDNA concentrations were normalized according to the lower end of the visible linear response range. This approach facilitated that equivalent amounts of TCR cDNA were employed for TCRBV gene repertoire quantitation in samples from skin and blood. They usually corresponded to 2–15 ng (blood lymphocytes) or 0.2–1.2 μg (skin lesions) total cellular RNA. To validate that the reaction conditions allowed for the analysis of PCR products in the linear range of BV amplification cDNA samples were serially diluted and subjected to PCR amplification with a variety of BV primers. For each primer set, linear responses were obtained with similar slopes. This dose–response relationship between initial amounts of cDNA and quantity of the final products ensured that primer efficiencies were actually equivalent at the conditions chosen. After standardization of reaction conditions BV repertoire amplification was performed. Following electrophoresis and blotting to nylon membrane (Boehringer Mannheim GmbH, Mannheim, Germany) PCR products were hybridized stringently with a [γ32P]adenosine triphosphate end-labeled internal BC oligonucleotide (5′GTGTTCCCA-CCCGAGGTCGCT3′) and exposed to X-ray films (Eastman Kodak, Rochester, NY). PCR products were quantitated by densitometric analysis (Cybertech CS-1 Image Documentation System, Cybertech, Berlin, and Wincam software). Following normalization to the internal standard, individual BV expression was expressed as a percentage of the analyzed BV repertoire. By replicate analysis using newly transcribed cDNA selected PCR repertoires were validated for reproducibility. Skin and blood TCRBV gene expression values were compared by means of sign tests using SAS 6.12. Statistical tests were performed post hoc and without correction for multiple testing. Thus, the exploratory rather than confirmatory character of the analysis should be noted. Amplification and sequencing of TCR transcripts was performed as recently described (Menssen et al., 1995Menssen A. Trommler P. Vollmer S. et al.Evidence for an antigen-specific cellular immune response in skin lesions of patients with psoriasis vulgaris.J Immunol. 1995; 155: 4078PubMed Google Scholar). TCRBV cDNA was amplified using a primer corresponding to a common sequence of both BC1 and BC2 (3′Cβ-BglII: 5′GCCTTTTGGGTGTGGGAGATC3′) in combination with 5′ primers containing different restriction endonuclease sites: 5′Vβ2-HindIII: 5′TCATCAACCATGCAAGCTTGACCT3′ 5′Vβ3-PstI: 5′CCTGATTCTGCAGTCCGCCA3′ 5′Vβ6 BamHI: 5′AGGCCTGAGGGATCCGTCTC3′ 5′Vβ12-BglII: 5′GTGTCTCTAGATCTAAGACAGAG3′ 5′Vβ13-EcoRI: 5′CAGAGGAATTCCCGCTCAG3′ 5′Vβ17-PstI: 5′GGAGATATAGCTGCAGGGTACA3′. Negative control reactions without cDNA were set up with each primer pair and amplified for 40 PCR cycles. An aliquot of each PCR including negative control reactions was analyzed for the presence and the amount of PCR product. Then, the TCRBV-BC fragments were digested and ligated into pUC 19 vector, and used for Escherichia coli transformation. Clones with insert were sequenced by the dideoxynucleotide chain-termination method using Sequenase reagents and protocols (Sequenase, USB, Amersham-Buchler, Braunschweig, Germany) or cycle sequencing (Amersham-Buchler, Braunschweig, Germany) (Menssen et al., 1995Menssen A. Trommler P. Vollmer S. et al.Evidence for an antigen-specific cellular immune response in skin lesions of patients with psoriasis vulgaris.J Immunol. 1995; 155: 4078PubMed Google Scholar). To determine the relative expression of 24 TCRBV gene families of skin T cells, a semiquantitative, duplex reverse transcription–PCR methodology was employed. Except for samples from two infants (A and B) BV gene expression of skin T cells was compared with that of peripheral blood T cells derived from the same donor. To select outlying values an arbitrary cut-off was used: cutaneous BV genes were considered as overexpressed if they exceeded blood expression by at least 5%. This limit was chosen, as it was well above the variations observed between replicate experiments that were usually below 1%. It corresponded to or exceeded the cut-offs employed by many other studies utilizing similar protocols (Paliard et al., 1991Paliard X. West S.G. Lafferty J.A. Clements J.R. Kappler J.W. Marrack P. Kotzin B.L. Evidence for the effects of a superantigen in rheumatoid arthritis.Science. 1991; 251: 325Crossref PubMed Scopus (558) Google Scholar;Wang et al., 1993Wang X. Golkar L. Uyemura K. et al.T cells bearing Vβ6 T cell receptors in the cell-mediated immune response to Mycobacterium leprae.J Immunol. 1993; 151: 7105PubMed Google Scholar;Dwyer et al., 1993Dwyer E. Itescu S. Winchester R. Characterization of the primary structure of TCR β chains in cells infiltrating the salivary gland in the sicca syndrome of HIV-1 infection. Evidence of antigen-driven clonal selection suggested by restricted combinations of Vβ Jβ gene segment usage and shared somatically encoded amino acid residues.J Clin Invest. 1993; 92: 495Crossref PubMed Scopus (56) Google Scholar;Wang et al., 1993Wang X.H. Ohmen J.D. Uyemura K. Rea T.H. Kronenberg M. Modlin R.L. Selection of T lymphocytes bearing limited T-cell receptor β chains in the response to a human pathogen.Proc Natl Acad Sci USA. 1993; 90: 188Crossref PubMed Scopus (49) Google Scholar;Uyemura et al., 1995Uyemura K. Pirmez C. Sieling P.A. Kiene K. Paes-Oliveira M. Modlin R.L. CD4+ Type 1 and CD8+ Type 2 T cell subsets in human leismaniasis have distinct T cell receptor repertoires.J Immunol. 1995; 151: 7095Google Scholar). The TCR repertoires in normal skin of adults were characterized by a restricted TCRBV gene usage (Table 1). Generally, up to four BV gene families revealed a stronger expression in skin than in the blood. Most evident was a preferential usage of BV2 in skin (average contribution of BV2 in all skin samples: 32.5% ± 10.8%) versus blood (13.0% ± 4.3%) in six adult donors (p =0.01563). BV2 was the most highly expressed BV gene family in six of nine skin samples (Table 1). It contributed 21.4%-55.6% to the total skin T cell receptor usage after the BV gene expression level was normalized to the internal standard of the individual PCR reaction. BV6 was also strongly expressed in these skin samples (mean 18.0% ± 11.8%), but statistically this was not significantly different from blood (mean 9.6% ± 3.6%) (p =0.12500). Overexpression of BV6 above blood values according to the above-mentioned criteria was only observed in two samples (donor E: 46.1%/10.3%; donor F: 16.5%/5.3%). In individual samples other families also revealed a stronger expression in skin versus blood. These were BV3 (donor H: 14.9%/8.7%), BV12 (F: 16.2%/3.2%), BV17 (F: 6.5%/1.5%), BV19 (C: 20.9%/3.5%; F: 8.9%/3.6%), and BV20 (E: 9.4%/4.0%). In contrast, the relative expression of other gene families (BV1: skin 2.2% ± 1.7% vs blood 6.1% ± 2.8%; BV5S1: 2.0% ± 1.6% vs 4.1% ± 1.0%; BV7: 2.9% ± 1.8% vs 8.1% ± 2.4%, p =0.01563; BV8: 1.6% ±1.4% vs 5.4% ± 3.0%, p =0.01563) was usually lower in skin than in peripheral blood.Table ITCRBV gene expression in normal skin and paired blood samples Open table in a new tab Interestingly, skin of two young infants (donors A and B; ages 4 and 6 mo) exhibited different TCRBV repertoires than adult donors' skin. Although skin TCR overexpression relative to blood could not be determined because blood samples were not available, we could compare the relative degree of the individual cutaneous BV gene family expression (Table 1). In these two skin samples the strongest expression was observed for BV6 (A: 19.5%) and BV13S1 (B: 15.9%). Compared with the overexpression in adults, BV2 was only moderately represented (A: 7.2%, B: 13%). Usually, however, weakly expressed gene families like BV7, BV21, BV3, BV13S2, BV15, BV20, and BV24 could be detected in either or both infants' skin. Furthermore, even if higher amounts of cDNA were used, up to nine BV families were still below detection level. Consequently, the expression value of the present gene families was relatively high in the infants' skin repertoires. Thus, TCR repertoires of T cells in normal, clinically healthy infant and adult skin appear to be restricted, although only skin-derived T cells of adult individuals displayed a biased usage of BV2. BV2 was the dominant TCR gene family in all seven adult but in neither of the two infant skin samples. BV6 was always stronger represented than in blood but this difference was statistically not significant. To determine whether these gene families resulted from clonal T cell expansions in the skin, cloned BV2-BC and BV6-BC PCR fragments were sequenced. The analysis revealed that the majority of TCRBV2 transcripts from skin T cells were quite heterogeneous, with repetitive clones representing at maximum 10.5% of the total number of analyzed sequences (Figure 1). Furthermore, high diversity was also reflected by TCRBJ gene segment usage as well as by the complementarity-determining region 3 (CDR3) length distribution of the analyzed transcripts (data not shown). In contrast, in one elderly donor (H), a single BV2 rearrangement accounted for 54% (13 of 24 functional transcripts) of the TCR and thereby revealed evidence for clonal T cell expansion (Figure 1). Additionally, three other rearrangements were present in two copies each. In this sample, the BV2 expression level constituted 21.4% of the TCR repertoire (Table 1). Furthermore, none of these sequences were found among 18 heterogeneous BV2 transcripts in the donor's blood (data not shown). Owing to technical difficulties, attempts to subclone BV2 transcripts from infants' skin only allowed the determination of five heterogeneous BV2 transcripts (donor B) (Figure 1). TCRBV6 rearrangements were also diverse, with single sequences accounting for a maximum of 20% (Figure 1). Again, there was no obvious bias towards a particular BJ gene segment or a preferred CDR3 length beyond the transcripts (data not shown). In both infants' skin, however, the majority of cutaneous TCRBV6 gene segments were recombined to the BJ2S7 gene segment (donor A: seven of 10 TCR transcripts; B: six of 10). Their VDJ sequences are given in Table 2. This observation of a BJ gene segment preference within heterogeneous transcripts was unique to the two infants' samples.Table IINucleotide and deduced amino acid sequences of TCR" @default.
• W1972647860 created "2016-06-24" @default.
• W1972647860 creator A5010965658 @default.
• W1972647860 creator A5023428863 @default.
• W1972647860 creator A5025092013 @default.
• W1972647860 creator A5062842851 @default.
• W1972647860 creator A5077831667 @default.
• W1972647860 date "2000-07-01" @default.
• W1972647860 modified "2023-10-12" @default.
• W1972647860 title "Analysis of the TCRBV Repertoire of T Cells in Normal, Human Skin: Evidence for a Restricted Diversity" @default.
• W1972647860 cites W1487217491 @default.
• W1972647860 cites W1521074671 @default.
• W1972647860 cites W1531134742 @default.
• W1972647860 cites W1538906753 @default.
• W1972647860 cites W1548757996 @default.
• W1972647860 cites W1581000856 @default.
• W1972647860 cites W1963100415 @default.
• W1972647860 cites W1968113131 @default.
• W1972647860 cites W1970579419 @default.
• W1972647860 cites W1972735498 @default.
• W1972647860 cites W1973556048 @default.
• W1972647860 cites W1976213001 @default.
• W1972647860 cites W1976885228 @default.
• W1972647860 cites W1979836429 @default.
• W1972647860 cites W1982300086 @default.
• W1972647860 cites W1982917969 @default.
• W1972647860 cites W1987427461 @default.
• W1972647860 cites W2006645462 @default.
• W1972647860 cites W2009094377 @default.
• W1972647860 cites W2010436799 @default.
• W1972647860 cites W2031011895 @default.
• W1972647860 cites W2042626190 @default.
• W1972647860 cites W2043464691 @default.
• W1972647860 cites W2044972759 @default.
• W1972647860 cites W2046580930 @default.
• W1972647860 cites W2049478058 @default.
• W1972647860 cites W2049596623 @default.
• W1972647860 cites W2056649469 @default.
• W1972647860 cites W2059646198 @default.
• W1972647860 cites W2069955769 @default.
• W1972647860 cites W2071238735 @default.
• W1972647860 cites W2071743575 @default.
• W1972647860 cites W2072154495 @default.
• W1972647860 cites W2073742871 @default.
• W1972647860 cites W2086417745 @default.
• W1972647860 cites W2087730578 @default.
• W1972647860 cites W2101298293 @default.
• W1972647860 cites W2105786952 @default.
• W1972647860 cites W2110062670 @default.
• W1972647860 cites W2118774861 @default.
• W1972647860 cites W2121660662 @default.
• W1972647860 cites W2123517465 @default.
• W1972647860 cites W2133908456 @default.
• W1972647860 cites W2155740919 @default.
• W1972647860 cites W2162787845 @default.
• W1972647860 cites W4235730252 @default.
• W1972647860 cites W4239027833 @default.
• W1972647860 cites W4251843555 @default.
• W1972647860 cites W44299764 @default.
• W1972647860 doi "https://doi.org/10.1046/j.1523-1747.2000.00982.x" @default.
• W1972647860 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10886510" @default.
• W1972647860 hasPublicationYear "2000" @default.
• W1972647860 type Work @default.
• W1972647860 sameAs 1972647860 @default.
• W1972647860 citedByCount "11" @default.
• W1972647860 countsByYear W19726478602013 @default.
• W1972647860 crossrefType "journal-article" @default.
• W1972647860 hasAuthorship W1972647860A5010965658 @default.
• W1972647860 hasAuthorship W1972647860A5023428863 @default.
• W1972647860 hasAuthorship W1972647860A5025092013 @default.
• W1972647860 hasAuthorship W1972647860A5062842851 @default.
• W1972647860 hasAuthorship W1972647860A5077831667 @default.
• W1972647860 hasBestOaLocation W19726478601 @default.
• W1972647860 hasConcept C124952713 @default.
• W1972647860 hasConcept C142362112 @default.
• W1972647860 hasConcept C144024400 @default.
• W1972647860 hasConcept C15744967 @default.
• W1972647860 hasConcept C19165224 @default.
• W1972647860 hasConcept C2778473898 @default.
• W1972647860 hasConcept C2781316041 @default.
• W1972647860 hasConcept C46312422 @default.
• W1972647860 hasConcept C86803240 @default.
• W1972647860 hasConceptScore W1972647860C124952713 @default.
• W1972647860 hasConceptScore W1972647860C142362112 @default.
• W1972647860 hasConceptScore W1972647860C144024400 @default.
• W1972647860 hasConceptScore W1972647860C15744967 @default.
• W1972647860 hasConceptScore W1972647860C19165224 @default.
• W1972647860 hasConceptScore W1972647860C2778473898 @default.
• W1972647860 hasConceptScore W1972647860C2781316041 @default.
• W1972647860 hasConceptScore W1972647860C46312422 @default.
• W1972647860 hasConceptScore W1972647860C86803240 @default.
• W1972647860 hasIssue "1" @default.
• W1972647860 hasLocation W19726478601 @default.
• W1972647860 hasLocation W19726478602 @default.
• W1972647860 hasOpenAccess W1972647860 @default.
• W1972647860 hasPrimaryLocation W19726478601 @default.
• W1972647860 hasRelatedWork W1641042124 @default.
• W1972647860 hasRelatedWork W1990804418 @default.

• next